Abstract
Summary A leucine tRNA (anticodon UAG) was isolated from the mitochondria of a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pACUUU/GUAUm 1 Am 2 GGAUAGAAGDAAUCCAUUGGUCU UAG m 1 GAACCAAAAACm 5 CUUGGUGCAACUCCAAAUAAAAGUACCA OH , can be arranged in cloverleaf form. It exhibits several unusual features, such as the absence of the constant GG sequence in loop I, the presence of a G11·C23 base pair in the stem of this loop, the presence of UGC instead of the constant TUC (UUC) in loop IV, a short variable arm, predominance of A·U base pairs, and the presence of m 1 A in position 9. The other modified nucleosides (N 2 -methylguanosine, dihydrouridine, pseudouridine, 1-methylguanosine, and 5-methylcytidine) occupy expected positions. In position 5, 2 nucleosides (uridine + guanosine) were found, possibly signifying a tumor-specific point mutation in mitochondrial DNA.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have