Heat Shock Protein 70 Homolog Research Articles

Molecular characterization and identification of Stellaria aquatica virus C, a novel putative member of the genus Closterovirus infecting Stellaria aquatica in South Korea.

A novel virus infecting Stellaria aquatica plants, tentatively named "Stellaria aquatica virus C" (StAVC), was identified in Gangwon-do Province, South Korea. Its monopartite genome consists of a single-stranded RNA of 15,024 nucleotides, and it shares 38.24 to 56.2% nucleotide sequence identity with known closterovirus genome sequences. Its genome contains nine hypothetical open reading frames. These encode the multifunctional protein RNA-dependent RNA polymerase (RdRp), hydrophobic protein (P7), heat shock protein 70 homolog (HSP70h), coat protein homolog (CPh), minor coat protein (CPm), and major coat protein (CP), along with proteins involved in suppressing RNA silencing. Phylogenetic analysis reveals that, based on its HSP70h amino acid sequence, StAVC is closely related to members of the genus Closterovirus within the family Closteroviridae. This is the first record of the full genome sequence of StAVC in South Korea.

DnaK duplication and specialization in bacteria correlates with increased proteome complexity.

The chaperone 70 kDa heat shock protein (Hsp70) is important for cells from bacteria to humans to maintain proteostasis, and all eukaryotes and several prokaryotes encode Hsp70 paralogs. Although the mechanisms of Hsp70 function have been clearly illuminated, the function and evolution of Hsp70 paralogs is not well studied. DnaK is a highly conserved bacterial Hsp70 family. Here, we show that dnaK is present in 98.9% of bacterial genomes, and 6.4% of them possess two or more DnaK paralogs. We found that the duplication of dnaK is positively correlated with an increase in proteomic complexity (proteome size, number of domains). We identified the interactomes of the two DnaK paralogs of Myxococcus xanthus DK1622 (MxDnaKs), which revealed that they are mostly nonoverlapping, although both prefer α and β domain proteins. Consistent with the entire M. xanthus proteome, MxDnaK substrates have both significantly more multi-domain proteins and a higher isoelectric point than that of Escherichia coli, which encodes a single DnaK homolog. MxDnaK1 is transcriptionally upregulated in response to heat shock and prefers to bind cytosolic proteins, while MxDnaK2 is downregulated by heat shock and is more associated with membrane proteins. Using domain swapping, we show that the nucleotide-binding domain and the substrate-binding β domain are responsible for the significant differences in DnaK interactomes, and the nucleotide binding domain also determines the dimerization of MxDnaK2, but not MxDnaK1. Our work suggests that bacterial DnaK has been duplicated in order to deal with a more complex proteome, and that this allows evolution of distinct domains to deal with different subsets of target proteins.IMPORTANCEAll eukaryotic and ~40% of prokaryotic species encode multiple 70 kDa heat shock protein (Hsp70) homologs with similar but diversified functions. Here, we show that duplication of canonical Hsp70 (DnaK in prokaryotes) correlates with increasing proteomic complexity and evolution of particular regions of the protein. Using the Myxococcus xanthus DnaK duplicates as a case, we found that their substrate spectrums are mostly nonoverlapping, and are both consistent to that of Escherichia coli DnaK in structural and molecular characteristics, but show differential enrichment of membrane proteins. Domain/region swapping demonstrated that the nucleotide-binding domain and the β substrate-binding domain (SBDβ), but not the SBDα or disordered C-terminal tail region, are responsible for this functional divergence. This work provides the first direct evidence for regional evolution of DnaK paralogs.

Transcriptomics Reveals the Killing Mechanism by Which Entomopathogenic Fungi Manipulate the RNA Expression Profiles of Termites and Provides Inspiration for Green Pest Management

As chemical pesticides have caused serious environmental pollution, fungus-based biological control has become a developing alternative to chemical control. Here, we aimed to determine the molecular mechanism underlying how Metarhizium anisopliae facilitated invasive infection. We found that the fungus increased its virulence by downregulating glutathione S-transferase (GST) and superoxide dismutase (SOD) throughout termite bodies. Among 13 fungus-induced microRNAs throughout termite bodies, miR-7885-5p and miR-252b upregulation significantly downregulated several mRNAs in response to toxic substances to increase the fungal virulence [e.g., phosphoenolpyruvate carboxykinase (GTP) and heat shock protein homologue SSE1]. In addition, nanodelivered small interfering RNA of GST and SOD and miR-7885-5p and miR-252b mimics increased the virulence of the fungus. These findings provide new insights into the killing mechanism of entomopathogens and their utilization of the host miRNA machinery to reduce host defenses, laying the groundwork to enhance virulence of biocontrol agents for green pest management.

Development of a one-step RT-qPCR assay for the detection of Grapevine leafroll-associated virus 7.

Grapevine leafroll disease (GLD) is one of the most economically important viral diseases of grapevines. GLD is caused by a complex of several ssRNA (+) viruses referred to as Grapevine leafroll-associated viruses (GLRaVs). To date, five different GLRaV species have been identified. One of those species, GLRaV-7, was first reported from a symptomless white-fruited wine grape cultivar from Albania. Since its discovery, GLRaV-7 has been reported from 14 countries. Although serological assays have been developed to detect GLRaV-7, commercially available antibodies produce high background signals making them unsuitable for regulatory testing. Furthermore, while molecular detection assays have been shown to be more sensitive when compared to the serological assays, published molecular assays, except the one Reverse Transcription-quantitaive Polymerase Chain Reaction (RT-qPCR) assay based on heat shock protein 70 homologue (HSP70h) gene, have been reported to be inadequate in detecting all reported isolates of GLRaV-7. Availability of multiple assays provides flexibility to diagnostic laboratories in cases where the chosen assay fails to detect a strain or an isolate of a pathogen due to variation in its targeted region or where additional confirmation of the results is required. In this study, we developed a sensitive and specific RT-qPCR assay, based on a region of p61 gene of GLRaV-7, which detected all available isolates.

Complete genome sequence of peony leafroll-associated virus, a novel ampelovirus in subgroup I.

The complete genome sequence of peony leafroll-associated virus (PLRaV) was determined by deep sequencing of ribosomal-RNA-depleted total RNA extracted from a peony plant exhibiting leafroll symptoms. Further PCR and RACE analysis showed that the PLRaV genome consists of 15,406 nucleotides and contains 10 putative open reading frames, with an organization typical of members of the genus Ampelovirus, family Closteroviridae. Amino acid sequence comparisons showed that the viral heat shock protein 70 homolog (HSP70h) shared the highest sequence identity (41.7%) with the corresponding region of grapevine leafroll-associated virus 1, and the coat protein (CP) and RNA-dependent RNA polymerase (RdRp) shared the highest sequence identity (32.1% and 52.3%, respectively) with grapevine leafroll-associated virus 13. Phylogenetic analysis of the HSP70h, CP, and RdRp aa sequences showed that PLRaV clustered with members of subgroup I of the genus Ampelovirus.

Prevalence of Virus Infections and GLRaV-3 Genetic Diversity in Selected Clones of Croatian Indigenous Grapevine Cultivar Plavac Mali.

The cultivar Plavac Mali (Vitis vinifera L.), the most important indigenous red grapevine cultivar in Croatia, was tested for the presence of 16 grapevine viruses. Thirty-five samples from the collection vineyard were tested for the presence of grapevine leafroll-associated viruses-1, -2, and -3 (GLRaV-1, GLRaV-2 and GLRaV-3, respectively), grapevine fanleaf virus (GFLV), arabis mosaic virus (ArMV), grapevine virus-A (GVA), -B (GVB), -G (GVG), -H (GVH), -I (GVI), -J (GVJ), grapevine fleck virus (GFkV), grapevine rupestris stem pitting associated virus (GRSPaV), and grapevine pinot gris virus (GPGV) by reverse transcription–polymerase chain reaction (RT-PCR). Furthermore, standard PCR was conducted for grapevine badnavirus 1 (GBV-1) and grapevine red blotch virus (GRBV). Mixed infections were most common and GLRaV-3, the most abundant virus found in 85.71% of the vines tested, was further molecularly characterised. Different genomic variants of the heat shock protein homologue (HSP70h) were separated by cloning, detected by single-strand conformation polymorphism (SSCP) analysis, sequenced, and phylogenetically analysed. The presence of phylogenetic groups I and II was only confirmed. This study demonstrates the high virus infection rate of Plavac Mali vines and the heterogeneity of GLRaV-3 present nowadays in a collection vineyard.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Genome-wide identification of small heat shock protein (HSP20) homologs in three cucurbit species and the expression profiles of CsHSP20s under several abiotic stresses

Small heat shock protein (HSP20) genes play important roles in biological processes of plants. In this study, a total of 47 CsHSP20 genes, 45 CmHSP20 genes, and 47 ClHSP20 genes were genome-wide identified by ‘hmmsearch’ and BLASTP using the latest versions of cucumber, melon, and watermelon genomes, respectively. According to the phylogenetic relationships and predicted subcellular localizations, HSP20s of these three cucurbit species were divided into 8 subfamilies (CI-CIV, CP, ER, M, and PX), in which some HSP20s were closely related with each other based on the collinearity analysis. Specific expression patterns of CsHSP20s were checked in 10 different tissues of cucumber plants. RNA-seq analysis of transcript levels, combined with cis-acting elements and GO enrichment analysis suggested that CsHSP20s were responsive to several different types of abiotic stresses, including chilling, temperature and photoperiod, high temperature and high humidity, and salinity. In conclusion, results of this work not only provided valuable information for exploring the regulating mechanisms of CsHSP20s in responding to abiotic stresses in cucumber, but also shed light on the potentially evolutional relations among cucumber, melon, and watermelon from a perspective of comparative genomics that specified on HSP20 gene families.

Novel Ampeloviruses Infecting Cassava in Central Africa and the South-West Indian Ocean Islands.

Cassava is one of the most important staple crops in Africa and its production is seriously damaged by viral diseases. In this study, we identify for the first time and characterize the genome organization of novel ampeloviruses infecting cassava plants in diverse geographical locations using three high-throughput sequencing protocols [Virion-Associated Nucleotide Acid (VANA), dsRNA and total RNA], and we provide a first analysis of the diversity of these agents and of the evolutionary forces acting on them. Thirteen new Closteroviridae isolates were characterized in field-grown cassava plants from the Democratic Republic of Congo (DR Congo), Madagascar, Mayotte, and Reunion islands. The analysis of the sequences of the corresponding contigs (ranging between 10,417 and 13,752 nucleotides in length) revealed seven open reading frames. The replication-associated polyproteins have three expected functional domains: methyltransferase, helicase, and RNA-dependent RNA polymerase (RdRp). Additional open reading frames code for a small transmembrane protein, a heat-shock protein 70 homolog (HSP70h), a heat shock protein 90 homolog (HSP90h), and a major and a minor coat protein (CP and CPd respectively). Defective genomic variants were also identified in some cassava accessions originating from Madagascar and Reunion. The isolates were found to belong to two species tentatively named Manihot esculenta-associated virus 1 and 2 (MEaV-1 and MEaV-2). Phylogenetic analyses showed that MEaV-1 and MEaV-2 belong to the genus Ampelovirus, in particular to its subgroup II. MEaV-1 was found in all of the countries of study, while MEaV-2 was only detected in Madagascar and Mayotte. Recombination analysis provided evidence of intraspecies recombination occurring between the isolates from Madagascar and Mayotte. No clear association with visual symptoms in the cassava host could be identified.

Pseudomonas aeruginosa DnaK Stimulates the Production of Pentraxin 3 via TLR4-Dependent NF-κB and ERK Signaling Pathways.

Microbe-derived factors trigger innate immune responses through the production of inflammatory mediators, including pentraxin 3 (PTX3). PTX3 is a soluble pattern recognition molecule that stimulates the clearance of clinically important bacterial pathogens such as Pseudomonas aeruginosa. However, the P. aeruginosa factors responsible for the production of PTX3 have not been elucidated. In this study, we found that P. aeruginosa DnaK, a homolog of heat shock protein 70, induced PTX3 production. Induction was mediated by intracellular signals transmitted through the Toll-like receptor 4 (TLR4) signaling pathway. Following receptor engagement, the stimulatory signals were relayed initially through the nuclear factor kappa B (NF-κB) signaling pathway and subsequently by extracellular signal-regulated kinases (ERK), which are mitogen-activated protein kinases. However, ERK activation was negatively controlled by NF-κB, implying the existence of negative crosstalk between the NF-κB and the ERK pathways. These data suggest that P. aeruginosa DnaK acts as a pathogen-associated molecular pattern to trigger modulation of host defense responses via production of PTX3.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Characterization and complete genome sequences of two novel variants of the family Closteroviridae from Chinese kiwifruit.

Two distinct closterovirus-like genome sequences (termed AdV-1 v1 and v2) were identified in Actinidia chinensis var. deliciosa ‘Miliang-1’ that had no disease symptoms using high-throughput sequencing. Using overlapping reverse transcription-polymerase chain reaction and rapid amplification of cDNA ends, the genomic sequences of AdV-1 v1 and v2 were confirmed as 17,646 and 18,578 nucleotides in length, respectively. The two complete genomes contained 9 and 15 open reading frames, respectively, coding for proteins having domains typical of Closteroviridae, such as RNA-dependent RNA polymerase (RdRp), heat shock protein 70 homolog (HSP70h) and coat protein (CP). Sequence analysis showed that the amino acid sequences of RdRp, HSP70h, and CP of the two variants exhibited high similarity (> 80%), while their genomic organization was somewhat different. This suggested that the two viral genomes identified here are variants of the family Closteroviridae in a single kiwifruit host. Furthermore, phylogenetic relationship analysis revealed that the two variants had a closer relationship with the unclassified virus Persimmon virus B (PeVB) and Actinidia virus 1 (AcV-1) than with other members of the family Closteroviridae, as did their genomic organization. It is speculated that the two variants, together with PeVB and AcV-1 belong to a new subfamily of Closteroviridae.

The Pseudomonas aeruginosa HSP90-like protein HtpG regulates IL-8 expression through NF-κB/p38 MAPK and CYLD signaling triggered by TLR4 and CD91

Pulmonary infection activates acute inflammatory responses by recruiting neutrophils to the infection site; this recruitment is promoted by interleukin-8 (IL-8). However, IL-8 production in response to Pseudomonas aeruginosa HtpG (PA1596), a homolog of heat shock protein 90, has yet not been characterized in detail. htpG expression in P. aeruginosa strain was elevated upon infection of host cells, and HtpG was released into bacterial culture supernatant. Treatment of dTHP-1 macrophages with recombinant HtpG (rHtpG) increased production of IL-8 in a dose- and time-dependent manner, and this effect was abolished by inhibition of nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinase (MAPK) p38 signaling. By contrast, the rHtpG-mediated production of IL-8 was increased by suppression of cylindromatosis (CYLD), suggesting that CYLD is a negative regulator of this pathway. The upregulation of expression was coordinated by signals transmitting through toll-like receptor 4 (TLR4) with the aid of CD91. Together, these observations suggest that P. aeruginosa HtpG activates NF-κB, CYLD, and p38 MAPK in a TLR4-and CD91-dependent manner, leading to stimulation of IL-8 production in macrophages.

First Report of Tomato Chlorosis Virus Infecting Tomato in Pakistan

Tomato chlorosis virus (ToCV) is a bipartite crinivirus (Closteroviridae) consisting of two positive-sense single-stranded RNAs: RNA1 and RNA2 (Fiallo-Olive and Navas-Castillo 2019). It is a phloem-limited virus transmitted by whiteflies (Bemisia tabaci and Trialeurodes vaporariorum) in a semipersistent manner (Fiallo-Olive and Navas-Castillo 2019; Lee et al. 2018). In March 2019, a survey of the tomato crop (cv. Richman) was conducted in the Multan district of Pakistan; 35% of plants in the crop showed virus-like symptoms such as interveinal chlorosis, brittleness, and general yellowing in the older and middle leaves. These symptoms were similar to those caused by ToCV and tomato infectious chlorosis virus (TICV) (Wisler et al. 1998). Tomato plants were infested by dense (20/leaf) whitefly (B. tabaci) populations. Thirty-six samples were collected from different plants (30 symptomatic and six asymptomatic) and were tested for ToCV and TICV. Total RNA was extracted from leaf samples using TRIzol reagent and assayed by RT-PCR, targeting the ToCV movement protein gene with primers ToCV-RNA2-IF and ToCV-RNA2-1R (Lee et al. 2018) and the TICV heat shock protein homolog gene with primers TICV-32 and TICV532 (Vaira et al. 2002). RT-PCR was also performed to target the clathrin adaptor complexes medium subunit (CAC), a reference protein gene of tomato, by using the forward primer 5′-CCTCCGTTGTGATGTAACTGG-3′ and the reverse primer 5′-ATTGGTGGAAAGTAACATCATCG-3′ (amplification size: 173 bp) (Gonzalez-Aguilera et al. 2016). Twenty-seven of 30 samples yielded the 827-bp ToCV product, whereas no amplification was obtained in any of the asymptomatic samples. TICV was not detected in any of the analyzed samples. Whiteflies (B. tabaci biotype B) collected from disease-free cotton plants and reared on cucumber plants (nonhost of ToCV) under greenhouse conditions were used in the transmission assay. One hundred nonviruliferous whiteflies were given an acquisition access period (AAP) of 48 h on an infected ToCV tomato plant and then transferred onto 20 healthy tomato seedlings (hybrid Richman, 5 whiteflies/seedling in one cage) for a 48-h inoculation access period (IAP). To ascertain that the whiteflies were nonviruliferous, 100 whiteflies were transferred onto five healthy tomato plants (20 whiteflies/plant) for an IAP of 48 h. Sixteen of 20 inoculated plants showed typical ToCV symptoms 28 days postinoculation, and ToCV was detected by RT-PCR using the ToCV-specific primers. No symptoms were observed on the negative control plants, confirming the nonviruliferous nature of whiteflies. The ToCV-positive tomato plants were used as a source for back inoculation to an indicator host, Nicotiana benthamiana. About 200 nonviruliferous whiteflies were given a 48-h AAP on the ToCV-infected tomatoes and then transferred to four healthy N. benthamiana plants (50 whiteflies/plant) for a 48-h IAP, and two healthy N. benthamiana plants were controls (fed on by nonviruliferous whiteflies). All ToCV-inoculated N. benthamiana plants showed distinctive symptoms of yellowing, interveinal chlorosis, and leaf brittleness; no symptoms were observed on the control plants. RT-PCR confirmed ToCV in symptomatic indicator plants and its absence in the control plants. The amplicons (movement protein gene) of two selected ToCV isolates from the field plants were sequenced in both directions. The resulting sequences were submitted to NCBI (MN385628 and MN385629). BLASTn analysis of the sequences revealed that the newly identified isolates are 99.88% identical to isolates reported from Turkey (KY419528), China (KJ815045), and Greece (EU284744). To our knowledge, this is the first report of ToCV infecting tomato in Pakistan. The wide occurrence of ToCV and its whitefly vectors in tomato crops in the region indicates that effective integrated management measures are needed to minimize losses caused by the virus in tomato.

Further genomic characterization of pineapple mealybug wilt-associated viruses using high-throughput sequencing

In this study, we describe the further genomic characterization of several pineapple mealybug wilt-associated virus (PMWaV) members of the genus Ampelovirus, family Closteroviridae, using high-throughput sequencing (HTS). PMWaV-2 is a necessary factor in the complex etiology of mealybug wilt disease of pineapple (MWP). The complete PMWaV-1 genome was described previously, but the genomes of PMWaV-2, PMWaV-3, and putative PMWaV-4 and PMWaV-5 species lack complete characterization. To further study MWP etiology through genomic characterization of PMWaVs, a cDNA library from total RNA of pineapple plants was generated and underwent HTS. A PMWaV-4 genome of 12,932 nucleotides was assembled from the HTS data. Proteins from the PMWaV-4 genome shared high amino acid similarity to those of PMWaV-1. The RNA-dependent RNA polymerase (RdRp), heat shock protein 70 homolog (HSP70h), and coat protein (CP) proteins of PMWaV-4 shared 88, 87, and 85% amino acid identity, respectively, to those of PMWaV-1 (AF414119) indicating PMWaV-4 is a distinct strain of PMWaV-1 but not a distinct ampelovirus species. Therefore, we suggest that PMWaV-4 be designated PMWaV-1 strain 4 (MN539275). Further, we used HTS to obtain a new isolate of PMWaV-1 (MN539276) and supplemented the available sequences of the genomes of PMWaV-2 (MN539272 and MN539273) and PMWaV-3 (MN539274) in their 5′-terminal regions.

Genomic Variability and Recombination Analysis of Grapevine leafroll-associated virus-1 Isolates from Turkey

Grapevine leafroll-associated virus-1 (GLRaV-1), one of the causal agents of Grapevine leafroll disease (GLRD), is one of the most important viral diseases of grapevine worldwide. In this study, the prevalence of GLRaV-1, genetic variation and recombination events among GLRaV-1 isolates in Turkey were investigated. Initially, 197 grapevine samples from different provinces of the country were serologically tested. Of the total samples, 109 (55.32%) were identified as GLRaV-1 infected. Subsequently, 9 samples representing different geographic distribution were selected for further sequence analysis of the heat-shock protein 70 homolog (HSP70h), open reading frame 9 (p24), coat protein (CP) and coat protein duplicate 2 (CPd2). Among the four gene regions, CPd2 was found the most divergent region while HSP70h gene exhibited the lowest genetic diversity. The phylogenetic analysis of four genomic regions including GenBank records clustered all variants in two major groups and grouped Turkish isolates mostly together. However, the isolate clusters were not correlated to their geographic origin. Furthermore, several putative recombination events were detected with trace to moderate evidence support of algorithms implemented in Recombination Detection Program (RDP). Taken together, the results provide a better understanding on genetic variation of Turkish GLRaV-1 isolates in the country and worldwide and can help to improve sanitation of propagated material programs for the grape growers.

Improvement of stress tolerance and riboflavin production of Bacillus subtilis by introduction of heat shock proteins from thermophilic bacillus strains.

In this study, stress tolerance devices consisting of heat shock protein (HSP) genes from thermophiles Geobacillus and Parageobacillus were introduced into riboflavin-producing strain Bacillus subtilis 446 to improve its stress tolerance and riboflavin production. The 12 HSP homologs were selected from 28 Geobacillus and Parageobacillus genomes according to their sequence clustering and phylogenetically analysis which represents the diversity of HSPs from thermophilic bacillus. The 12 HSP genes and 2 combinations of them (PtdnaK-PtdnaJ-PtgrpE and PtgroeL-PtgroeS) were heterologously expressed in B. subtilis 446 under the control of a strong constitutive promoter P43. Most of the 14 engineered strains showed increased cell density at 44 to 48°C and less cell death at 50°C compared with the control strains. Among them, strains B.s446-HSP20-3, B.s446-HSP20-2, and B.s446-PtDnaK-PtDnaJ-PtGrpE increased their cell densities over 25% at 44 to 48°C. They also showed 5-, 4-, and 4-fold improved cell survivals after the 10-h heat shock treatment at 50°C, respectively. These three strains also showed reduced cell death rates under osmotic stress of 10% NaCl, indicating that the introduction of HSPs improved not only the heat tolerance of B. subtilis 446 but also its osmotic tolerance. Fermentation of these three strains at higher temperatures of 39 and 43°C showed 23-66% improved riboflavin titers, as well as 24-h shortened fermentation period. These results indicated that implanting HSPs from thermophiles to B. subtilis 446 would be an efficient approach to improve its stress tolerance and riboflavin production.

Glomalin gene as molecular marker for functional diversity of arbuscular mycorrhizal fungi in soil

Among the ecological services provided by arbuscular mycorrhizal fungi (AMF), the process of soil aggregation is hypothesized to be partially mediated by glomalin, an alkaline-soluble glycoprotein released by AM fungi into soil during hyphal turnover and after the death of the fungus in the soil. The protein is characterized by abundant production and hydrophobic properties. Although glomalin has been identified in Rhizophagus irregularis DAOM 197198 as a putative homolog of heat shock protein 60, the use of expressed fungal genes encoding glomalin as a marker for functional AMF diversity was never exploited. The present work describes the first attempt to identify the glomalin gene in several AMF species, verify its reliability as gene marker for the identification and discrimination of AMF, and test the possibility to detect its expression in soil. We designed a specific PCR primers set able to amplify many known lineages of AMF glomalin gene. We demonstrated its applicability to create a new reference glomalin sequence dataset for comparative sequence analysis. The designed primer set was successfully used to amplify glomalin transcript from soil cDNA template.

Electrostatic interactions between middle domain motif-1 and the AAA1 module of the bacterial ClpB chaperone are essential for protein disaggregation

ClpB, a bacterial homologue of heat shock protein 104 (Hsp104), can disentangle aggregated proteins with the help of the DnaK, a bacterial Hsp70, and its co-factors. As a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), ClpB forms a hexameric ring structure, with each protomer containing two AAA+ modules, AAA1 and AAA2. A long coiled-coil middle domain (MD) is present in the C-terminal region of the AAA1 and surrounds the main body of the ring. The MD is subdivided into two oppositely directed short coiled-coils, called motif-1 and motif-2. The MD represses the ATPase activity of ClpB, and this repression is reversed by the binding of DnaK to motif-2. To better understand how the MD regulates ClpB activity, here we investigated the roles of motif-1 in ClpB from Thermus thermophilus (TClpB). Using systematic alanine substitution of the conserved charged residues, we identified functionally important residues in motif-1, and using a photoreactive cross-linker and LC-MS/MS analysis, we further explored potential interacting residues. Moreover, we constructed TClpB mutants in which functionally important residues in motif-1 and in other candidate regions were substituted by oppositely charged residues. These analyses revealed that the intra-subunit pair Glu-401-Arg-532 and the inter-subunit pair Asp-404-Arg-180 are functionally important, electrostatically interacting pairs. Considering these structural findings, we conclude that the Glu-401-Arg-532 interaction shifts the equilibrium of the MD conformation to stabilize the activated form and that the Arg-180-Asp-404 interaction contributes to intersubunit signal transduction, essential for ClpB chaperone activities.

Pseudomonas aeruginosa GroEL Stimulates Production of PTX3 by Activating the NF-κB Pathway and Simultaneously Downregulating MicroRNA-9.

As one of the first lines of host defense, monocytes play important roles in clearing infected microbes. The defensive response is triggered by recognition of diverse microbial moieties, including released factors, which modulate host immune responses to establish a harsh environment for clinically important bacterial pathogens. In this study, we found that the expression of PTX3, a soluble form of pattern recognition receptor, was induced by infection with live Pseudomonas aeruginosa or treatment of cells with its supernatant. P. aeruginosa GroEL, a homolog of heat shock protein 60, was identified as one of the factors responsible for inducing the expression of PTX3 in host cells. GroEL induced PTX3 expression by activating the Toll-like receptor 4 (TLR4)-dependent pathway via nuclear factor-kappa B (NF-κB), while simultaneously inhibiting expression of microRNA-9, which targets the PTX3 transcript. Finally, by acting as an opsonin, GroEL-induced PTX3 promoted the association and phagocytosis of Staphylococcus aureus into macrophages. These data suggest that the host defensive environment is supported by the production of PTX3 in response to GroEL, which thus has therapeutic potential for clearance of bacterial infections.