Hairpin Ends Research Articles

RecA-mediated joint molecule formation between O-methylated RNA/DNA hairpins and single-stranded targets.

Chimeric oligonucleotides consisting of one DNA strand paired with an O-methylated RNA strand interrupted by six DNA residues have been used in gene targeting experiments. Here we demonstrate that these hairpins can form a heteroduplex (or joint molecule) with single-stranded DNA targets in a reaction mediated by the E. coli RecA protein. One end of the double hairpin may unwind to form a 14-base-RecA filament which initiates the reaction. Chimeric oligonucleotides containing only O-methylated RNA residues on one strand or truncated hairpins lacking this 14-base segment did not participate in RecA-driven heteroduplex formation under these reaction conditions. The results presented here represent a first step in studying one facet of a strategy which uses O-methylated RNA residues as participants in homologous pairing events.

Defects in Concatemer Processing of Bacteriophage T7 DNA Deleted in the M-Hairpin Region

The intracellular replicating form of T7 DNA is a concatemer in which linear genomes are joined head to tail by sharing 160-bp terminally repeated sequences. A unique hairpin (M-hairpin) end generated on the left side of the TR was proposed to be responsible for the duplication of the concatemer junction for efficient packaging. We characterized the defects caused by loss of the M-hairpin by constructing a recombinant T7 (T7Δm) deleted in themregion. Initially, the intracellular growth rate of progeny phage was normal in T7Δminfection. However, the titer of progeny phage was eventually reduced by two- to threefold and lysis was significantly delayed. The restriction fragment, LEΔ160, generated simultaneously with the double-strand cleavage at the onset of packaging reaction was found more or less at the same intensity in both T7+and T7Δminfection at the beginning but preferentially in T7Δminfection during the later phase of infection. These observations suggest that the DNA packaging of T7 proceeds on the intact concatemer junctions during the early stage of infection while the duplication of the concatemer junction by the M-hairpin seemed to be important during the later phase, presumably due to reduced replication. While the generation of the M-hairpin involves DNA replication, the loss ofmdid not reduce DNA synthesis, suggesting that the role of the M-hairpin as an origin of replication is minimal.

Cell-free V(D)J recombination.

V(D)J recombination generates diversity in the immune system through the lymphoid-specific assembly of multiple gene segments into functional immunoglobulin and T-cell receptor genes. The first step in V(D)J recombination is cleavage of DNA at recombination signal sequences. Cleavage produces a blunt DNA end on each signal sequence and a hairpin end on adjacent coding gene segments, and can be reproduced in vitro by using purified RAG and RAG2 proteins. The later steps involve processing and joining of the cleaved DNA ends, and until now have been studied only in cells. Here we reconstitute the complete V(D)J recombination reaction in a cell-free system. We find that the RAG proteins are not only involved in cleavage, but are also needed in the later steps for efficient joining of coding ends. Joining is largely directed by short pieces of identical sequence in the coding flanks, but addition of human DNA ligase I results in greater diversity. Coding junctions contain short deletions as well as additions complementary to a coding flank (P nucleotides). Addition of non-templated nucleotides into coding junctions is mediated by terminal deoxyribonucleotidyl transferase. The cell-free reaction can therefore reproduce the complete set of processing events that occur in cells.

Isolation of a Mutant Bacteriophage T7 Deleted in Nonessential Genetic Elements, Gene19.5andm

Half of the 55 potential genes of bacteriophage T7 appear to be dispensable. One of the major obstacles in the study of these nonessential genes is the difficulty in obtaining mutants. During a study of genes involved in the packaging of bacteriophage T7, we hypothesized that some nonessential genes may be required for optimal growth. Mutant phages lacking such nonessential genes may form plaques but grow slowly. One gene located at the extreme right end of the linear T7 genome, gene19.5with no known mutants, and a genetic elementmresponsible for a unique hairpin end, were studied. Mutant T7 phages deleted in gene19.5andm(T7Δ19.5-M) were generatedin vivoby homologous recombination with a recombinant plasmid. This phage produces small plaques and the production of progeny phage particles per infected cell was reduced fourfold. Investigation of the intracellular DNA after infection with T7Δ19.5-Mshowed the persistence ofEscherichia coliDNA as well as delayed conversion of concatemers to unit-length T7 DNA. The inefficiency of concatemer processing confirmed the proposed function of the M-hairpin in duplication of the concatemer junction. Since it is not likely that the M-hairpin influences the degradation of host DNA, we propose that the gene19.5product is partly responsible for the degradation ofE. colichromosomal DNA.

A structural motif for the voltage-gated potassium channel pore.

Mutation studies have identified a region of the S5-S6 loop of voltage-gated K+ channels (P region) responsible for teraethylammonium (TEA) block and permeation/selectivity properties. We previously modeled a similar region of the Na+ channel as four beta-hairpins with the C strands from each of the domains forming the external vestibule and with charged residues at the beta-turns forming the selectivity filter. However, the K+ channel P region amino acid composition is much more hydrophobic in this area. Here we propose a structural motif for the K+ channel pore based on the following postulates (Kv2.1 numbering). (i) The external TEA binding site is formed by four Tyr-380 residues; P loop residues participating in the internal TEA binding site are four Met-371 and Thr-372 residues. (ii) P regions form extended hairpins with beta-turns in sequence ITMT. (iii) only C ends of hairpins form the inner walls of the pore. (iv) They are extended nonregular strands with backbone carbonyl oxygens of segment VGYGD facing the pore with the conformation BRLRL. (v) Juxtaposition of P loops of the four subunits forms the pore. Fitting the external and internal TEA sites to TEA molecules predicts an hourglass-like pore with the narrowest point (GYG) as wide as 5.5 A, suggesting that selectivity may be achieved by interactions of carbonyls with partially hydrated K+. Other potential cation binding sites also exist in the pore.

Topography of Variola Smallpox Virus Inverted Terminal Repeats

We examined the nucleotide sequences of the inverted terminal repeat (ITR) regions adjacent to the covalently closed hairpin end sequences of three variola major and four minor strains from smallpox outbreaks in Europe, Asia, Africa, and South America. The ITR regions ranged in size from 581 to 1051 base pairs (bp) and contained no apparent open reading frames. Two nonrepetitive sequence elements, NR1 and NR2, were conserved and resembled nonrepetitive elements in the ITRs of other orthopoxviruses. Depending on strain, the terminally positioned NR1 and the more internal NR2 flanked a direct repeat region containing from none to four copies of a 69-bp sequence and one copy of a 54-bp related sequence partial repeat. A distinctive pattern of ITR topography of NR1 and NR2 flanking a single copy of the 69-bp unit characterized each of three examined alastrim variola minor strains. A nonalastrim African minor strain from the last natural case of smallpox in Somalia in 1977 showed the largest ITR region of the examined viruses because of a second direct repeat cluster following NR2.

Hairpin opening by single-strand-specific nucleases.

DNA molecules with covalently sealed (hairpin) ends are probable intermediates in V(D)J recombination. According to current models hairpin ends are opened to produce short single-stranded extensions that are thought to be precursors of a particular type of extra nucleotides, termed P nucleotides, which are frequently present at recombination junctions. Nothing is known about the activities responsible for hairpin opening. We have used two single-strand-specific nucleases to explore the effects of loop sequence on the hairpin opening reaction. Here we show that a variety of hairpin ends are opened by P1 nuclease and mung bean nuclease (MBN) to leave short, 1-2 nt single-stranded extensions. Analysis of 22 different hairpin sequences demonstrates that the terminal 4 nt of the hairpin loop strongly influence the sites of cleavage. Correlation of the nuclease digestion patterns with structural (NMR) data for some of the hairpin loops studied here provides new insights into the structural features recognized by these enzymes.

Hairpin Loop Structure at the Termini of the Chlorella Virus PBCV-1 Genome

The termini of the chlorella virus PBCV-1 330-kb dsDNA genome consist of 35-nucleotide-long, incompletely base-paired, covalently closed hairpin loops that exist in one of two forms. The two forms are complementary when the 35 nucleotide sequences are inverted with respect to one another (flip and flop). Each hairpin loop structure is followed by an identical 2221-bp inverted repeat sequence after which the DNA sequence diverges. The strategy for cloning the PBCV-1 DNA hairpin ends may be useful for cloning other hairpin termini.

Characterization of the terminal inverted repeats and their neighboring tandem repeats in the Chlorella CVK1 virus genome.

A unique group of large icosahedral viruses that infect a unicellular green alga (Chlorella sp. NC64A) were isolated from freshwater sources in Japan. These viruses contain a linear double-stranded DNA (dsDNA) genome with hairpin ends. A physical map was constructed for the genomic DNA of CVK1 (Chlorella virus isolated in Kyoto, no. 1) by pulsed-field gel electrophoresis of restriction fragments. The nucleotide sequences around both termini of the CVK1 DNA revealed the presence of inverted terminal repeats (ITR) of approximately 1.0 kb. Adjacent to the ITR, unique sequence elements of 10 to 20 bp were directly repeated 20 to 30 times in tandem array. Several copies of these repeat elements were deleted in virus mutants that were occasionally generated from Chlorella cells that were in a putative CVK1 carrier state. These repeats might represent a hot spot of rearrangement in the CVK1 genome.

Morphological observations on the unique paired capillaries of the opossum retina.

Light-microscopic and ultrastructural analysis of the ocular tissues of the North American opossum (Didelphis virginiana) revealed that the arterial and venous segments of retinal vessels, including capillaries of the smallest calibre, occur in pairs. They do not form anastomotic networks, the common pattern in mammals with vascularised retinae, but instead the two segments of the pair join to form hairpin end loops. The paired vessels, with the arteriolar limb usually on the vitread aspect, penetrate the retina and branch to form three distinct layers of capillaries. The most superficial lies in the nerve fiber layer, the middle is situated in the inner nuclear layer and the deepest extends to the external limiting membrane, which is considerably deeper than in normal mammalian holangiotic retinae. The paired capillaries display classical morphological features of central nervous system capillaries, i.e., they are lined by continuous endothelial cells united by tight junctions. The lining endothelium is supported by a distinct basal lamina that splits to envelop pericytes. The latter, although abundant, are invariably interposed between the two vessels that form each vascular unit. Phylogenetic and functional aspects of this unique form of retinal vascularisation are discussed.

Bacteriophage T7 DNA packaging: III. A “Hairpin” end formed on T7 concatemers may be an intermediate in the processing reaction

An unusual left end (M-end) has been identified on bacteriophage T7 DNA isolated from T7-infected cells. This end has a "hairpin" structure and is formed at a short inverted repeat sequence centered around nucleotide 39,587 of T7, 190 base-pairs to the left of the site where a mature left end is formed on the T7 concatemer. We do not detect the companion right end that would be formed if the M-end is produced by a double-stranded cut on the T7 concatemer. This suggests that the hairpin left end may be generated from a single-stranded cut in the DNA that is used to prime rightward DNA synthesis. The formation of M-end does not require the products of T7 genes 10, 18 or 19, proteins that are essential for the formation of mature T7 ends. During infection with a T7 gene 3 (endonuclease) mutant, phage DNA synthesis is reduced and the concatemers are not processed into unit length DNA molecules, but both M-end and the mature right end are formed on the concatemer DNA. These two ends are also found associated with the large, rapidly sedimenting concatemers formed during a normal T7 infection while the mature left end is present only on unit length T7 DNA molecules. We propose that DNA replication primed from the hairpin end produced by a nick in the inverted repeat sequence provides a mechanism to duplicate the terminal repeat before DNA packaging. Packaging is initiated with the formation of a mature right end on the branched concatemer and, as the phage head is filled, the T7 gene 3 endonuclease may be required to trim the replication forks from the DNA. Concatemer processing is completed by the removal of the 190 base-pair hairpin end to produce the mature left end.

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

Chlorella viruses contain linear nonpermuted double-stranded DNA genomes with covalently closed hairpin ends

Pulsed field electrophoresis established that Chlorella viruses contain linear, nonpermuted, 330- to 380-kb dsDNA genomes. Terminal DNA restriction fragments of one virus, PBCV-1, were identified by Bal31 exonuclease digestion; the termini probably contain covalently closed hairpin ends. The end fragments cross-hybridize indicating terminal repetition; the region of repetition extends no more than 2.5 kb from the ends.

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.

Cruciform-resolvase interactions in supercoiled DNA.

T4 endonuclease VII, which cleaves Holliday-like junctions in DNA, specifically cleaves short inverted repeats in supercoiled plasmids. These sequences are subject to site-specific cleavage by single-strand-specific nucleases, and cruciform formation has been suggested as an explanation for this observation. This proposal is greatly strengthened by the present data, since a formal analogy between cruciform structures and Holliday junctions exists. Resolution of a variety of unrelated cruciform sequences demonstrates that the cleavage process results in a linear molecule with hairpin ends and single ligatable nicks at positions corresponding to the stem-base of the cruciform. In two examples mapped in detail, the cleavages are exclusively introduced at two or three nucleotides from the end of the symmetric sequence at the 5' side on each strand. These studies demonstrate the potential of endonuclease VII as a probe of cruciform structure and the utility of short cruciform structures as Holliday junction models.

Directional transport and integration of donor DNA in Haemophilus influenzae transformation.

DNA transport and integration in Haemophilus influenzae transformation was studied with a plasmid clone of homologous DNA (pCML6). Our results indicate that: (i) donor DNA enters specialized membranous extensions on the cell surface, which we have termed "transformasomes"; (ii) linear DNA undergoes degradation upon exiting transformasomes; and (iii) DNA without a free end remains within transformasomes and is not degraded. By comparing the fate of label from uniformly labeled versus middle-labeled DNA, it appears that donor DNA undergoes degradation from an end prior to recombining with the chromosome. Using donor DNA with covalently closed termini (hairpin ends) prevents efficient exit from transformasomes. When one hairpin is removed, exit of donor DNA is shown to be directional from the free end, with preferential homologous integration of the 3' strand from that end.

Precise localization of several covalent RNA-RNA cross-link in Escherichia coli 16S RNA.

The RNA-RNA cross-linking reagent N-acetyl-N'-(p-glyoxylyl-benzoyl)cystamine, which reacts via its glyoxal residue with guanines not involved in G X C base pairs, has been used to introduce reversible RNA-RNA cross-links into Escherichia coli 16S rRNA. A two-dimensional gel method has been devised for the separation of the cross-linked oligonucleotides, and the precise location of guanines involved in four of these cross-links has been determined by sequencing the oligonucleotides. One cross-link involves guanosines 1315 and 1360 situated in two hairpin end loops of domain III. The other cross-links involves pairs of guanosine situated within the same hairpin end loops.

A Case of Abortion.

Wheeling, W. Va., September, 1894. To the Editor: —The following case terminated so happily that I feel like recommending the method as much more safe than that employed in a case recently before our court, in which the fundus of a pregnant girl had been punctured by a sound with fatal result. Mrs. A., age 25 years, mother of two children, last menstruated August 5-8. At 10a.m., September 14, thirty-seven days after last date she introduced the closed end of a common wire hairpin into the cervix, in the effort to produce an abortion. It slipped from her fingers and disappeared beyond her reach. Eleven hours later I saw her, and no sign or symptom of local disturbance was present. My index finger, inserted as far as possible into the cervix, felt no foreign body. I concluded that the woman was so agitated during her criminal effort that the