GUS Expression Research Articles

Vascular dodecanoic acid of Arabidopsis mediates an insect resistance against Myzuspersicae.

The present study explores the compatible interaction between Arabidopsis thaliana and Myzus persicae to reduce host resistance from the previous aphid herbivore-mediated priming. The resumption of host resistance from the "reduced host resistance" was also recorded in due time when aphid herbivore was removed from leaf foliage. The vascular sap, isolated from the midpoint timing from the "reduced host resistance" to the "resumed host resistance" phase resolved in gas chromatography-mass spectrometry (GC-MS) analysis that identified an enrichment of dodecanoic acid (DA), an antibacterial metabolite and a saturated medium-chain fatty acid with a 12-carbon backbone. DA infiltration into leaf foliage revealed a significant reduction of aphid clonal proliferation on leaf foliage with concomitant reduction of the vascular microbiota titer as well as aphid body. The "resumed host resistance" from "reduced host resistance" also showed a comparable microbiota titer in comparison to control but the "reduced host resistance" evidenced a significant higher microbiota titer which was correlated with an enhanced aphid clonal proliferation on the leaf foliage. The DA infiltrated leaf foliage had no effect on total vascular sap ingestion by the aphid herbivore but induced RNA level of GUS expression under the control of promoter of pad-4, mpl-1, and sag-13. A similar pattern of gus expression was recorded from aphid herbivore. Thus, DA mediates aphid resistance towardaphid clonal proliferation in the host plant by manipulating vascular and aphid body microbiota titer.

Male-linked gene TsRPL10a' in androdioecious tree Tapiscia sinensis: implications for sex differentiation by influencing gynoecium development.

The mechanism of sex differentiation in androdioecy is of great significance for illuminating the origin and evolution of dioecy. Tapiscia sinensis Oliv. is a functionally androdioecious species with both male and hermaphroditic individuals. Male flowers of T. sinensis lack the ovules of gynoecia compared with hermaphrodites. To identify sex simply and accurately, and further find the potential determinants of sex differentiation in T. sinensis, we found that TsRPL10a', a duplicate of TsRPL10a, was a male-linked gene. The promoter (5' untranslated region and the first intron) of TsRPL10a' can be used to accurately identify sex in T. sinensis. TsRPL10a is a ribosomal protein that is involved in gynoecium development, and sufficient ribosomal levels are necessary for female gametogenesis. The expression level of TsRPL10a was significantly downregulated in male flower primordia compared with hermaphrodites. The RNA fluorescence in situ hybridization (FISH) assay demonstrated that TsRPL10a was almost undetectable in male gynoecia at the gynoecial ridge stage, which was a key period of ovule formation by scanning electron microscope observation. In male flowers, although the promoter activity of TsRPL10a was significantly higher than TsRPL10a' verified by transgenic Arabidopsis thaliana, the transcriptional expression ratio of TsRPL10a was obviously lower than TsRPL10a' and reached its lowest at the gynoecial ridge stage, indicating the existence of a female suppressor. The promoter similarity of TsRPL10a and TsRPL10a' was only 45.29%; the genomic sequence similarity was 89.8%; four amino acids were altered in TsRPL10a'. The secondary structure of TsRPL10a' was different from TsRPL10a, and TsRPL10a' did not exhibit FISH and GUS expression in the gynoecium the way TsRPL10a did. From the perspective of RT-qPCR, its high expression level, followed by the low expression level of TsRPL10a in male flowers, indicates its antagonism function with TsRPL10a. The evolutionary analysis, subcellular localization and flower expression pattern suggested that TsRPL10a might be functionally conserved with AtRPL10aA, AtRPL10aB and AtRPL10aC in A. thaliana. Overall, we speculated that TsRPL10a and its duplicate TsRPL10a' might be involved in sex differentiation by influencing gynoecium development in T. sinensis.

Natural variations in the promoter of a vacuolar invertase gene from Elsholtzia haichowensis lead to different responses to glucose

Invertases hydrolyze sucrose and play crucial roles in plant growth and development as well as defense responses to stresses. However, little is known about the molecular basis controlling invertase gene regulation under stresses. Our previous study has shown that the expression of a vacuolar invertase gene, EhvINVMP, in roots of a metalliferous population of Elsholtzia haichowensis was induced under Cu stress, whereas the expression of EhvINVNMP, an allele from a non-metalliferous population, was not affected. Here, we cloned the promoters of EhvINVNMP and EhvINVMP and found 12 % sequence divergence between them. The promoters of both alleles drive GUS expression in roots, leaves, stems, flowers and seeds of transgenic Arabidopsis thaliana with preferences for the vascular tissues. GUS activities conferred by the two promoters were not responsive to Cu stress, drought, IAA, 6-BA, ABA, ACC, MeJA and SA in transgenic A. thaliana, but were induced by GA3. The promoter activity and expression of EhvINVMP were induced by glucose while those of EhvINVNMP were not affected. Deletion analysis of the pEhvINVMP promoter showed that a 40 bp insertion sequence containing a SP8b and a SURE2-like AATACTAT element might be responsible for its glucose induction. The glucose-induction of EhvINVMP provides a positive feed-forward mechanism to maintain and amplify the induction of EhvINVMP by Cu stress, thus might explaining the different regulation of EhvINVNMP and EhvINVMP under Cu stress. Our study provides new insight into the regulation of invertase gene under stresses.

Indole pyruvate decarboxylase gene regulates the auxin synthesis pathway in rice by interacting with the indole-3-acetic acid-amido synthetase gene, promoting root hair development under cadmium stress.

This research focused on cadmium (Cd), which negatively affects plant growth and auxin hemostasis. In plants, many processes are indirectly controlled through the expression of certain genes due to the secretion of bacterial auxin, as indole-3-acetic acid (IAA) acts as a reciprocal signaling molecule in plant-microbe interaction. The aim of current studies was to investigate responsible genes in rice for plant-microbe interaction and lateral root development due to the involvement of several metabolic pathways. Studies revealed that GH3-2 interacts with endogenous IAA in a homeostasis manner without directly providing IAA. In rice, indole-3-pyruvate decarboxylase (IPDC) transgenic lines showed a 40% increase in lateral roots. Auxin levels and YUCCA (auxin biosynthesis gene) expression were monitored in osaux1 mutant lines inoculated with Bacillus cereus exposed to Cd. The results showed an increase in root hairs (RHs) and lateral root density, changes in auxin levels, and expression of the YUCCA gene. B. cereus normalizes the oxidative stress caused by Cd due to the accumulation of and H2O2 in osaux1 mutant lines. Furthermore, the inoculation of B. cereus increases DR5:GUS expression, indicating that bacterial species have a positive role in auxin regulation. Thus, the current study suggests that B. cereus and IPDC transgenic lines increase the RH development in rice by interacting with IAA synthetase genes in the host plant, alleviating Cd toxicity and enhancing plant defense mechanisms.

Transcriptome analysis reveals pathogenesis-related gene 1 pathway against salicylic acid treatment in grapevine (Vitis vinifera L).

Salicylic acid (SA) is a well-studied phenolic plant hormone that plays an important role in plant defense against the hemi-biothrophic and biothrophic pathogens and depends on the living cells of host for the successful infection. In this study, a pathogenesis test was performed between Vitis davidii and V. vinifera cultivars against grape white rot disease (Coniella diplodiella). V. davidii was found to be resistant against this disease. SA contents were found to be higher in the resistant grape cultivar after different time points. RNA-seq analysis was conducted on susceptible grapevine cultivars after 12, 24, and 48h of SA application with the hypothesis that SA may induce defense genes in susceptible cultivars. A total of 511 differentially expressed genes (DEGs) were identified from the RNA-seq data, including some important genes, VvWRKY1/2, VvNPR1, VvTGA2, and VvPR1, for the SA defense pathway. DEGs related to phytohormone signal transduction and flavonoid biosynthetic pathways were also upregulated. The quantitative real-time PCR (qRT-PCR) results of the significantly expressed transcripts were found to be consistent with the transcriptome data, with a high correlation between the two analyses. The pathogenesis-related gene 1 (VvPR1), which is an important marker gene for plant defense, was selected for further promoter analysis. The promoter sequence showed that it contains some important cis-elements (W-box, LS7, as-1, and TCA-element) to recruit the transcription factors VvWRKY, VvNPR1, and VvTGA2 to express the VvPR1 gene in response to SA treatment. Furthermore, the VvPR1 promoter was serially deleted into different fragments (-1,837, -1,443, -1,119, -864, -558, -436, and -192 ) bp and constructed vectors with the GUS reporter gene. Deletion analysis revealed that the VvPR1 promoter between -1837bp to -558bp induced significant GUS expression with respect to the control. On the basis of these results, the -558bp region was assumed to be an important part of the VvPR1 promoter, and this region contained the important cis-elements related to SA, such as TCA-element (-1,472bp), LS7 (-1,428 bp), and as-1 (-520bp), that recruit the TFs and induce the expression of the VvPR1 gene. This study expanded the available information regarding SA-induced defense in susceptible grapes and recognized the molecular mechanisms through which this defense might be mediated.

Assessment of root-specific promoters in banana and tobacco and identification of a banana TIP2 promoter with strong root activity.

Genetic modification is one possible strategy to generate bananas (Musa spp.) with resistance to the soil-borne pathogen causing Fusarium wilt. The availability of banana root-specific promoters to target transgene expression to the sites of infection would be beneficial. We have assessed 18 promoter sequences derived from a range of plant species for their expression profiles in banana tissues to identify those with root-specific activity. Promoter sequences were isolated and fused to the β-glucuronidase (GUS) gene to assess their expression levels and tissue specificity in both banana and the model plant tobacco. Two heterologous promoters conferring high root expression levels in banana were identified, including a β‐glucosidase 1 (GLU1) promoter from maize and the RB7-type tonoplast intrinsic protein (TIP)-2 promoter from strawberry. Further, a novel Musa TIP2-2 promoter sequence was isolated and characterized which, when fused to the GUS gene, conferred very high GUS expression levels in banana roots. These promoters will expand the options for the control of gene expression in genetically modified bananas, providing a tool to develop plants with resistance not only to soil-borne diseases such as Fusarium wilt, but also for the improvement of other traits, such as nematode resistance, nutrition or abiotic stress resistance.

Identification and Functional Analysis of the Promoter of a Leucoanthocyanidin Reductase Gene from Gossypium hirsutum.

Leucoanthocyanidin reductase (LAR) is the critical enzyme in the synthesis pathway of proanthocyanidins, which are the primary pigments in brown cotton fibers. Our previous study has revealed significant differences in the expression levels of GhLAR1 between white and brown cotton fibers at 10 DPA. In this work, the expression pattern of the GhLAR1 gene was further studied, and the promoter of GhLAR1 (1780bp) was isolated and characterized. Bioinformatic analysis indicated that GhLAR1 promoter contained many known light response elements and several defenses related to transcriptional factor-binding boxes, which may partially explain the response of the GhLAR1 to temperature, NaCl, and PEG treatments. Furthermore, GhLAR1 was preferentially and strongly expressed in fibers and flowers of cotton, and the expression levels in all tested tissues (especially fibers) of brown cotton were significantly higher than those in white cotton. Consistent with the expression analysis, the GhLAR1 promoter mainly drove GUS expression in epidermal trichomes and floral organs.

Establishment of an efficient transformation method of garden stock (Matthiola incana) using a callus formation chemical inducer.

Matthiola incana is an important floricultural plant that blooms from winter to spring, and had been desired to be established a transformation system. This study successfully obtained stable transgenic plants from M. incana. We used Agrobacterium tumefaciens harboring a binary vector containing the β-glucuronidase gene (GUS) under the control of cauliflower mosaic virus 35S promoter to evaluate the transformation frequency of M. incana. We observed that cocultivation with the A. tumefaciens strain GV3101 for 5 days effectively enhanced the infection frequency, assessed through a transient GUS expression area in the seedling. Furthermore, the addition of 100 µM acetosyringone was necessary for Agrobacterium infection. However, we could not obtain transgenic plants on a shoot formation medium supplemented with 1 mg l-1 6-benzyladenine (BA). For callus formation from the leaf sections, a medium supplemented with 1-50 µM fipexide (FPX), a novel callus induction chemical, was employed. Then, the callus formation was observed after 2 weeks, and an earlier response was detected than that in the BA medium (4-6 weeks). Results also showed that cultivation in a selection medium supplemented with 12.5 µM FPX obtained hygromycin-resistant calli. Thus, this protocol achieved a 0.7% transformation frequency. Similarly, progenies from one transgenic line were observed on the basis of GUS stains on their leaves, revealing that the transgenes were also inherited stably. Hence, FPX is considered a breakthrough for establishing the transformation protocol of M. incana, and its use is proposed in recalcitrant plants.

The Characterization of Columnar Apple Gene MdCoL Promoter and Its Response to Abscisic Acid, Brassinosteroid and Gibberellic Acid.

Columnar apple was an important germplasm resource to develop compact cultivars for labor-saving cultivation and to study fruit tree architecture. MdCoL is a strong candidate gene for controlling the columnar phenotype in apple. In this study, a 2000 bp upstream region of MdCoL was cloned as a full-length promoter, named MdCoLp1. To gain a better understanding of the characterization of the MdCoL promoter, cis-acting elements and the binding sites of transcription factors were predicted and analyzed, and four binary expression vectors consisting of the GUS reporter gene under the control of the MdCoL promoter was transformed into Arabidopsis thaliana to analyze the response to abscisic acid (ABA), brassinosteroid (BR) and gibberellic acid (GA3) of MdCoL promoters. Multiple transcription factors involving TCP, BEL1 and BES1/BZR1 and other transcription factor (TF) binding sites were predicted on the promoter of MdCoL. Histochemical staining showed that both full-length and 5′ truncated promoters could initiate GUS expression. The GUS activity was the most in leaf and stem, and mainly concentrated in the fibrovascular tissue, followed by root, and the least activity was observed in silique and flower. In addition, MdCoL expression was mainly localized in the quiescent center (QC) and lateral root growing point of root tip and the vascular tissue of stem and leaf by in situ hybridization. The results of exogenous hormones treatment showed that ABA and BR could activate the activity of the MdCoL promoter, while GA3 had opposite effects. In columnar apple seedlings, ABA treatment could upregulate the expression of MdCoL, but GA3 and BR restrained the transcription level of MdCoL. These results provide the foundation for deciphering the regulatory network of hormones affecting MdCoL transcription.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Agrobacterium-Mediated Genetic Transformation of Larix kaempferi (Lamb.) Carr. Embryogenic Cell Suspension Cultures and Expression Analysis of Exogenous Genes

A simple and efficient protocol for the genetic transformation of Japanese larch (Larix kaempferi (Lamb.) Carr.) was developed by altering the infection method and duration and the bacterial removal process. More than 600 hygromycin-resistant embryonal masses with the vector pCAMBIA1301 were obtained, with an average of 20 transgenic lines per gram of fresh weight. Nine hygromycin-resistant transformation events (designated P1–P9) were analyzed using PCR, quantitative real-time PCR, and histochemical β-glucuronidase (GUS) assays. The GUS transcript abundance in each transformed cell line ranged from 101 to 103 magnitudes, with a maximum abundance of 2.89 × 103. In addition, the pLaTCTP::GUS vector, which contains GUS under the control of the L. kaempferi LaTCTP promoter, led to constitutive expression of GUS in embryonal-suspensor mass and somatic embryos. The transcript abundance of the exogenous genes HPT and GUS, driven by the CaMV 35S or LaTCTP promoter, ranged from 101 to 104, which was equivalent to genes with moderate and low abundances in Japanese larch. The relatively low expression levels of exogenous genes in transformants might reflect the large genome of Japanese larch. Additional transgenic cell lines need to be screened to obtain transformants with higher expression levels of foreign genes for further functional research in Japanese larch.

Establishment of in planta transformation protocol of tomato (Solanum lycopersicum L.) through antiporter gene for improved salinity tolerance

Tomato stands as the world’s third most consumed vegetable, but its production has been suffering due to climate vulnerability, notably for saline sensitivity. Despite its economic importance, developing salinity tolerant tomato has not been prioritized lately. Current study was aimed to establish a simple and efficient Agrobacterium-mediated in planta transformation protocol to transform Na+/H+ antiporter gene into 5 Bangladeshi tomato varieties, namely BARI tomato 2, BARI tomato 3, BINA tomato 2, BINA tomato 3 and Bahar, to improve their salt tolerance, through optimization of crucial transformation factors like optical density, infection time, co-cultivation period etc. Two vectors were constructed by cloning Na+/H+ antiporter gene from Arabidopsis (pK7WG2_AtNHX1_1.6) and Rice (pK7WG2_OsNHX1_1.6) individually to gateway vector pENTR/D-TOPO and electroporated to Agrobacterium while another vector pBI121 was used as control. Non-pricked seeds were found optimum for achieving more than 90% efficiency for GUS expression and germination percentages under conditions of OD600 1.1-1.4 with 30 min of infection time followed by 24 hrs co-cultivation period during transformation using the 3 vectors. Transformed plantlets were screened through resistance to Kanamycin 50 mg/l in germination medium while Cefotaxime 100 mg/l was applied to prevent Agrobacterium overgrowth during co-cultivation. Tolerance of 100 mM NaCl for 14 days has been observed in putative transformants in Leaf Disc Bioassay. No significant morphological changes were observed during the acclimatization of putatively transformed plantlets. This established protocol is novel and can efficiently produce genotype-independent transgenic tomato plants obviating intervening tissue culture. Hence, this study provides scope for climate-resilient crop improvement to ensure nutritional security.

Aspartic proteases modulate programmed cell death and secondary cell wall synthesis during wood formation in poplar.

Programmed cell death (PCD) is essential for wood development in trees. However, the determination of crucial factors involved in xylem PCD of wood development is still lacking. Here, two Populus trichocarpa typical aspartic protease (AP) genes, AP17 and AP45, modulate xylem maturation, especially fibre PCD, during wood formation. AP17 and AP45 were dominantly expressed in the fibres of secondary xylem, as suggested by GUS expression in APpro::GUS transgenic plants. Cas9/gRNA-induced AP17 or AP45 mutants delayed secondary xylem fibre PCD, and ap17ap45 double mutants showed more serious defects. Conversely, AP17 overexpression caused premature PCD in secondary xylem fibres, indicating a positive modulation in wood fibre PCD. Loss of AP17 and AP45 did not alter wood fibre wall thickness, whereas the ap17ap45 mutants showed a low lignin content in wood. However, AP17 overexpression led to a significant decrease in wood fibre wall thickness and lignin content, revealing the involvement in secondary cell wall synthesis during wood formation. In addition, the ap17ap45 mutant and AP17 overexpression plants resulted in a significant increase in saccharification yield in wood. Overall, AP17 and AP45 are crucial modulators in xylem maturation during wood development, providing potential candidate genes for engineering lignocellulosic wood for biofuel utilization.

Characterization of Virus-Inducible Orchid Argonaute 5b Promoter and Its Functional Characterization in Nicotiana benthamiana during Virus Infection.

Plant ARGONAUTES (AGOs) play a significant role in the defense against viral infection. Previously, we have demonstrated that AGO5s encoded in Phalaenopsis aphrodite subsp. formosana (PaAGO5s) took an indispensable part in defense against major viruses. To understand the underlying defense mechanism, we cloned PaAGO5s promoters (pPaAGO5s) and analyzed their activity in transgenic Nicotiana benthamiana using β-glucuronidase (GUS) as a reporter gene. GUS activity analyses revealed that during Cymbidium mosaic virus (CymMV) and Odontoglossum ringspot virus (ORSV) infections, pPaAGO5b activity was significantly increased compared to pPaAGO5a and pPaAGO5c. Analysis of pPaAGO5b 5′-deletion revealed that pPaAGO5b_941 has higher activity during virus infection. Further, yeast one-hybrid analysis showed that the transcription factor NbMYB30 physically interacted with pPaAGO5b_941 to enhance its activity. Overexpression and silencing of NbMYB30 resulted in up- and downregulation of GUS expression, respectively. Exogenous application and endogenous measurement of phytohormones have shown that methyl jasmonate and salicylic acid respond to viral infections. NbMYB30 overexpression and its closest related protein, PaMYB30, in P. aphrodite subsp. formosana reduced CymMV accumulation in P. aphrodite subsp. formosana. Based on these discoveries, this study uncovers the interaction between virus-responsive promoter and the corresponding transcription factor in plants.

An Attempt to Establish an Agrobacterium-mediated Transient Expression in Euphorbia tirucalli (L.) an Important Medicinal Plant

Background: Optimization of co-cultivation parameters during Agrobacterium-mediated transformation to Euphorbia tirucalli evaluated were bacterial density, infection period, acetosyringone (AS) concentration and co-cultivation temperature. Optimized parameters resulted in high transformation efficiency 3 fold increase at transient GUS expression .The optimized conditions were Agrobacterium tumefaciens growth phase of A600nm 0.17, infection period of 30 min, addition of acetosyringone (AS) in co-cultivation medium (100 µM) and cocultivation temperature of 25°C. Methods: Nodal explants were used for transformation. Bacterial culture was added to 50 ml of liquid YEP medium with kanamycin and rifampicin and grown until reaching the growth phase (A600nm). Bacterial density ranged from A600nm 0.17, 0.56, 0.8 and 1.2 OD were used in the present study. The co-cultivation medium made of solid MS medium consisted of NAA 2 mg L-1 and various concentrations of AS at 0, 50, 100, 200, 400, 600 and 800 µM. Histochemical analysis of gus gene expression was carried out. Result: Higher bacterial density resulted in more transformation efficiency, but also higher necrosis in the explants. Dilution of bacterial suspension reduced necrosis in explants and resulted in higher transformation. The transformation efficiency is 72% when the infection process was carried out with acetosyringone in co-cultivation medium (100 µM). Our studies proved that among the optimized conditions, cocultivation temperature and acetosyringone were the critical parameters during Agrobacterium mediated transformation.

Analysis of the salt-stress responsive element of the promoter of peanut small GTP binding protein gene AhRabG3f

To study the molecular mechanism of salt stress response of peanut small GTP binding protein gene AhRabG3f, a 1 914 bp promoter fragment upstream of the start codon of AhRabG3f gene (3f-P) from peanut was cloned. Subsequently, five truncated fragments (3f-P1-3f-P5) with lengths of 1 729, 1 379, 666, 510 and 179 bp were obtained through deletion at the 5' end, respectively. Plant expression vectors where these six promoter fragments were fused with the gus gene were constructed and transformed into tobacco by Agrobacterium-mediated method, respectively. GUS expression in transgenic tobacco and activity analysis were conducted. The gus gene expression can be detected in the transgenic tobacco harboring each promoter segment, among which the driving activity of the full-length promoter 3f-P was the weakest, while the driving activity of the promoter segment 3f-P3 was the strongest. Upon exposure of the transgenic tobacco to salt stress, the GUS activity driven by 3f-P, 3f-P1, 3f-P2 and 3f-P3 was 3.3, 1.2, 1.9 and 1.2 times compared to that of the transgenic plants without salt treatment. This suggests that the AhRabG3f promoter was salt-inducible and there might be positive regulatory elements between 3f-P and 3f-P3 in response to salt stress. The results of GUS activity driven by promoter fragments after salt treatment showed that elements included MYB and GT1 between 1 930 bp and 1 745 bp. Moreover, a TC-rich repeat between 682 bp and 526 bp might be positive cis-elements responsible for salt stress, and an MYC element between 1 395 bp and 682 bp might be a negative cis-element responsible for salt stress. This study may facilitate using the induced promoter to regulate the salt resistance of peanut.

Arabidopsis ABSCISIC ACID INSENSITIVE4 targets PROTEIN L-ISOASPARTYL METHYLTRANSFERASE1 in seed.

Arabidopsis ABSCISIC ACID INSENSITIVE4 (ABI4) positively regulates the protein repairing enzyme (PRE) PROTEIN L-ISOASPARTYL METHYLTRANSFERASE1 (PIMT1) in seed for its implication in seed vigor and longevity. PROTEIN L-ISOASPARTYL METHYLTRANSFERASE (PIMT) is a protein repairing enzyme (PRE) and is implicated in seed vigor and longevity. PIMT has been shown to be induced by ABA, however, its detailed regulation by ABA signaling components is unknown. Herein, we report that ABSCISIC ACID INSENSITIVE4 (ABI4) directly binds to the PIMT1 promoter and regulates its expression in Arabidopsis seeds. AtPIMT1 promoter analysis demonstrated the presence of putative ABI4 binding sites. Our Y1H analysis revealed that AtABI4 transcription factor binds to the AtPIMT1 promoter. Dual luciferase assay also demonstrated the binding of the AtABI4 transcription factor to the AtPIMT1 promoter. Subsequently, we have generated AtPIMT1 promoter GUS lines and revealedthat ABA induced expression of GUS in Arabidopsis thaliana. Expression analyses exhibited reduced accumulation of PIMT1 protein and transcript with significant reduction in total PIMT activity in abi4-1 mutants as compared to that of the wild type. The AtPIMT1 promoter GUS expression in abi4-1 mutants was also found to be severely affected in both the control and ABA treatment. Hence, through molecular and genetic evidences we show that the AtABI4 plays a central role in regulating the expression of AtPIMT1 to impart seed vigor and longevity to orthodox seeds.

The qLTG1.1 candidate gene CsGAI regulates low temperature seed germination in cucumber.

The CsGAI gene, identified by map-based, was involved in regulating seed germination in low temperature via the GA and ABA signaling pathways. Low temperature reduces the percentage of seeds germinating and delays seed germinating time, thus posing a threat to cucumber production. However, the molecular mechanism regulating low temperature germination in cucumber is unknown. We here dissected a major quantitative trait locus qLTG1.1 that controls seed germination at low temperature in cucumber. First, we fine-mapped qLTG1.1 to a 46.3-kb interval, containing three candidate genes. Sequence alignment and gene expression analysis identified Csa1G408720 as the gene of interest that was highly expressed in seeds, and encoded a highly conserved, low temperature-regulated DELLA family protein CsGAI. GUS expression analysis indicated that higher promoter activity underscored higher transcriptional expression of the CsGAI gene. Consistent with the known roles of GAI in ABA and GA signaling during germination, genes involved in the GA (CsGA2ox, CsGA3ox) and ABA biosynthetic pathways (CsABA1, CsABA2, CsAAO3 and CsNCED) were found to be differently regulated in the tolerant and sensitive genotypes under low temperatures, and this was reflected in differences in their ratio of GA-to-ABA. Based on these data, we proposed a working model explaining how CsGAI integrates the GA and ABA signaling pathways, to regulate cucumber seed germination at low temperature, thus providing new insights into this mechanism.

Microneedle Array-Assisted, Direct Delivery of Genome-Editing Proteins Into Plant Tissue

Genome editing in plants employing recombinant DNA often results in the incorporation of foreign DNA into the host genome. The direct delivery of genome-editing proteins into plant tissues is desired to prevent undesirable genetic alterations. However, in most currently available methods, the point of entry of the genome-editing proteins cannot be controlled and time-consuming processes are required to select the successfully transferred samples. To overcome these limitations, we considered a novel microneedle array (MNA)-based delivery system, in which the needles are horizontally aligned from the substrate surface, giving it a comb-like configuration. We aimed to deliver genome-editing proteins directly into the inner layers of leaf tissues; palisade, the spongy and subepidermal L2 layers of the shoot apical meristem (SAM) which include cells that can differentiate into germlines. The array with needles 2 μm wide and 60 μm long was effective in inserting into Arabidopsis thaliana leaves and Glycine max (L.) Merr. (soybeans) SAM without the needles buckling or breaking. The setup was initially tested for the delivery of Cre recombinase into the leaves of the reporter plant A. thaliana by quantifying the GUS (β-glucuronidase) expression that occurred by the recombination of the loxP sites. We observed GUS expression at every insertion. Additionally, direct delivery of Cas9 ribonucleoprotein (RNP) targeting the PDS11/18 gene in soybean SAM showed an 11 bp deletion in the Cas9 RNP target site. Therefore, this method effectively delivered genome-editing proteins into plant tissues with precise control over the point of entry.

NbNAC42 and NbZFP3 Transcription Factors Regulate the Virus Inducible NbAGO5 Promoter in Nicotiana benthamiana.

Plant argonautes (AGOs) play important roles in the defense responses against viruses. The expression of Nicotiana benthamiana AGO5 gene (NbAGO5) is highly induced by Bamboo mosaic virus (BaMV) infection; however, the underlying mechanisms remain elusive. In this study, we have analyzed the potential promoter activities of NbAGO5 and its interactions with viral proteins by using a 2,000 bp fragment, designated as PN1, upstream to the translation initiation of NbAGO5. PN1 and seven serial 5′-deletion mutants (PN2–PN8) were fused with a β-glucuronidase (GUS) reporter and introduced into the N. benthamiana genome by Agrobacterium-mediated transformation for further characterization. It was found that PN4-GUS transgenic plants were able to drive strong GUS expression in the whole plant. In the virus infection tests, the GUS activity was strongly induced in PN4-GUS transgenic plants after being challenged with potexviruses. Infiltration of the transgenic plants individually with BaMV coat protein (CP) or triple gene block protein 1 (TGBp1) revealed that only TGBp1 was crucial for inducing the NbAGO5 promoter. To identify the factors responsible for controlling the activity of the NbAGO5 promoter, we employed yeast one-hybrid screening on a transcription factor cDNA library. The result showed that NbNAC42 and NbZFP3 could directly bind the 704 bp promoter regions of NbAGO5. By using overexpressing and virus-induced gene silencing techniques, we found that NbNAC42 and NbZFP3 regulated and downregulated, respectively, the expression of the NbAGO5 gene. Upon virus infection, NbNAC42 played an important role in regulating the expression of NbAGO5. Together, these results provide new insights into the modulation of the defense mechanism of N. benthamiana against viruses. This virus inducible promoter could be an ideal candidate to drive the target gene expression that could improve the anti-virus abilities of crops in the future.