GRN Expression Research Articles

Benzoxazole-derivatives enhance progranulin expression and reverse the aberrant lysosomal proteome caused by GRN haploinsufficiency

Heterozygous loss-of-function mutations in the GRN gene are a major cause of hereditary frontotemporal dementia. The mechanisms linking frontotemporal dementia pathogenesis to progranulin deficiency are not well understood, and there is currently no treatment. Our strategy to prevent the onset and progression of frontotemporal dementia in patients with GRN mutations is to utilize small molecule positive regulators of GRN expression to boost progranulin levels from the remaining functional GRN allele, thus restoring progranulin levels back to normal within the brain. This work describes a series of blood-brain-barrier-penetrant small molecules which significantly increase progranulin protein levels in human cellular models, correct progranulin protein deficiency in Grn+/− mouse brains, and reverse lysosomal proteome aberrations, a phenotypic hallmark of frontotemporal dementia, more efficiently than the previously described small molecule suberoylanilide hydroxamic acid. These molecules will allow further elucidation of the cellular functions of progranulin and its role in frontotemporal dementia and will also serve as lead structures for further drug development.

Alpha-synuclein inclusion responsive microglia are resistant to CSF1R inhibition

BackgroundParkinson’s disease (PD) is a neurodegenerative disorder that is characterized by the presence of proteinaceous alpha-synuclein (α-syn) inclusions (Lewy bodies), markers of neuroinflammation and the progressive loss of nigrostriatal dopamine (DA) neurons. These pathological features can be recapitulated in vivo using the α-syn preformed fibril (PFF) model of synucleinopathy. We have previously determined that microglia proximal to PFF-induced nigral α-syn inclusions increase in soma size, upregulate major-histocompatibility complex-II (MHC-II) expression, and increase expression of a suite of inflammation-associated transcripts. This microglial response is observed months prior to degeneration, suggesting that microglia reacting to α-syn inclusion may contribute to neurodegeneration and could represent a potential target for novel therapeutics. The goal of this study was to determine whether colony stimulating factor-1 receptor (CSF1R)-mediated microglial depletion impacts the magnitude of α-syn aggregation, nigrostriatal degeneration, or the response of microglial in the context of the α-syn PFF model.MethodsMale Fischer 344 rats were injected intrastriatally with either α-syn PFFs or saline. Rats were continuously administered Pexidartinib (PLX3397B, 600 mg/kg), a CSF1R inhibitor, to deplete microglia for a period of either 2 or 6 months.ResultsCSF1R inhibition resulted in significant depletion (~ 43%) of ionized calcium-binding adapter molecule 1 immunoreactive (Iba-1ir) microglia within the SNpc. However, CSF1R inhibition did not impact the increase in microglial number, soma size, number of MHC-II immunoreactive microglia or microglial expression of Cd74, Cxcl10, Rt-1a2, Grn, Csf1r, Tyrobp, and Fcer1g associated with phosphorylated α-syn (pSyn) nigral inclusions. Further, accumulation of pSyn and degeneration of nigral neurons was not impacted by CSF1R inhibition. Paradoxically, long term CSF1R inhibition resulted in increased soma size of remaining Iba-1ir microglia in both control and PFF rats, as well as expression of MHC-II in extranigral regions.ConclusionsCollectively, our results suggest that CSF1R inhibition does not impact the microglial response to nigral pSyn inclusions and that CSF1R inhibition is not a viable disease-modifying strategy for PD.

Abstract 5862: ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC)

Abstract ATP-binding cassette member B5 (ABCB5) identifies cancer-initiating cells (CICs) in multiple malignancies, including malignant melanoma, colorectal cancer, glioblastoma, and hepatocellular carcinoma (HCC). In human melanoma, ABCB5-positive CIC subpopulations have been shown to preferentially express the immune checkpoint molecules PD-1 and PD-L1, and tumor-intrinsic PD-1 receptor functions have been found to promote tumor growth, even in mice lacking adaptive immunity. In HCC, where ABCB5 mediates CIC chemoresistance, PD-1 expression has also recently been identified. However, whether ABCB5 regulates tumor-intrinsic PD-1 expression in HCC or other malignancies is currently unknown. Here, we employed RNA interference in Hep G2 HCC cells with high endogenous ABCB5 expression to study the potential role of ABCB5 in regulating PD-1 expression, utilizing the ABCB5 shRNA target sequence GCTGGAAAGATAGCAACTGAA for ABCB5 knockdown (KD) as described previously. Endogenous ABCB5 levels in ABCB5-KD cells were successfully reduced by 92.8% compared to controls. Investigation of the effects of ABCB5-KD on tumor-intrinsic immune checkpoint molecule expression and on expression of the HCC-CIC marker GRN revealed that ABCB5-KD significantly reduced PD-1 expression by 98.0%, and PD-L1 expression by 62.8% compared to controls. Expression of GRN was also significantly reduced in ABCB5-KD cells by 78.8% compared to controls, suggesting ABCB5 KD-dependent loss of CIC phenotype. Injection of ABCB5-KD cells in NSG mice showed 32.3% reduction in tumor size at endpoint (6 weeks) compared to controls (728.7 ± 199.3mm3 vs 1076.0 ± 450.9 mm3, mean ± SD; p<0.005, repeated measures ANOVA) and 8.53% reduction in tumor weight at endpoint (0.47 ± 0.21g vs 0.51 ± 0.21g, mean ± SD). These results provide initial evidence in an HCC cell line model system that ABCB5 functionally regulates tumor-intrinsic PD-1 and PD-L1 expression. They therefore suggest that ABCB5 blockade represents a novel therapeutic strategy for targeted inhibition of pro-tumorigenic tumor-intrinsic PD-1/PD-L1 expression, with important additional implications for immune checkpoint-targeted cancer immunotherapy. Citation Format: Chun Philip Yeung, Brian J. Wilson, Yuzuru Sasamoto, Ana Maria Waaga-Gasser, Svetlana Karpova, Qin Guo, Natasha Y. Frank, Markus H. Frank. ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5862.

Progranulin upregulation by antisense oligonucleotides targeting regRNAs for treatment of FTD‐GRN

AbstractBackgroundHeterozygous mutations in progranulin (GRN) gene leading to progranulin protein (PGRN) haploinsufficieny are the major genetic cause of GRN‐related frontotemporal dementia (FTD‐GRN)1, 2 and 3. Decreased levels of PGRN disrupt lysosome homeostasis, cause aberrant microglia activation and neuronal cell death resulting in progressive behavioral changes, language deficits and memory impairment4. We hypothesize that upregulation of PGRN in both neuronal cells and microglia would be effective for treating FTD‐GRN patients.MethodRegulatory RNAs (regRNAs) are a class of noncoding RNAs that modulate gene transcription. We have developed an RNA Actuating Platform (RAPTM) that identified regRNAs and enables tunable upregulation of genes by specific targeting of regRNAs with antisense oligonucleotides (ASOs).ResultOur platform identified shared GRN regRNAs in human iPSC‐derived neuron and microglia like cells (iMGLs). ASOs targeting shared regRNAs were screened in a human neuroblastoma cell line to identify lead ASOs that upregulate GRN at least 2‐fold. We showed that the lead ASOs upregulate GRN in both human iPSC‐derived neurons and iMGL cells. Moreover, this level of GRN upregulation was sufficient to rescue staurosporine‐induced toxicity in FTD‐GRN patient iPSC‐derived neurons.Furthermore, we identified mouse Grn regRNA‐targeting ASOs that upregulate Grn transcription 2.5‐fold in mouse neuroblastoma cell lines and primary neurons. We tested these ASOs for efficacy in an FTD‐GRN mouse model (Grn+/tm1.1Far )5 by intracerebroventricular injection. Grn upregulation is observed across disease‐relevant brain regions, including cortex in the Grn haploinsufficient mice.ConclusionHere, we describe the development of oligonucleotide drug candidates that target regRNAs to upregulate GRN expression as a therapeutic approach for FTD‐GRN. We believe that our strategy will restore secreted and lysosomal PGRN levels in both microglia and neurons thereby decreasing neuroinflammation and neurotoxicity. We are developing these oligonucleotides as a disease modifying treatment for patients with FTD‐GRN.

Progranulin upstream open reading frames of different 5’ leaders affect downstream protein expression

Heterozygous loss-of-function (LOF) mutations in the progranulin gene (GRN) cause frontotemporal lobar degeneration (FTLD) by a mechanism of haploinsufficiency. Progranulin expression is regulated at multiple levels, including by its 5' untranslated region (UTR). Two different GRN 5' leaders contain upstream open reading frames (uORFs). These non-coding elements could contribute to the regulation of GRN expression by acting as cis repressors of translation. Selected from the Flanders-Belgian FTD patient cohort, 302 unrelated patients (mean age at onset 64.9 ± 9.8 years, range 29 to 84 years, 46.3% female) without a GRN LOF mutation. The GRN cohort of LOF mutation carriers comprised members of the GRN founder family (n=83, mean onset age 63.1 ± 7.7 years) and carriers of other LOF mutations (n=53, mean onset age 58.9 ± 7.1 years). Targeted resequencing of uORF regions of GRN transcripts by amplicon target amplification assays (https://www.agilent.com). Luciferase reporter assays and semi-quantitative Real-Time PCR for characterization of GRN uORFs and identified variants. Western blotting for investigation of uORF-mediated translation. Quantification of alternative splicing by analyzing two brain RNA-seq datasets from healthy controls (AMP-AD Knowledge Portal, https://adknowledgeportal.synapse.org/). We identified the presence of an alternative 5' UTR in human brain. Quantification of the alternative splicing in the exon1-intron1 splicing-site suggests low expression for the alternative spliced 5' UTR with notable variability between samples in both datasets. Abolishment of each uORF (n=3) of the alternative 5' UTR increases protein expression, with a mild impact on mRNA levels. The two ATG-initiated uORFs were capable of initiating translation. Targeted resequencing of the uORF regions identified two genetic variants, one in each 5' UTR. Both variants increase downstream protein levels, with the main 5' UTR variant rs76783532 causing a significant 1.5-fold increase in protein expression (p=0.03), with no impact on mRNA levels. The alternatively spliced GRN 5'UTR contains 3 uORFs that can regulate downstream protein expression by acting on the translational level. The variant identified in the main 5'UTR, significantly increases protein expression by altering uORF codon identity. These results promote further experimental work to elucidate the potential mechanistic involvement of GRN uORFs in GRN associated FTLD.

Evidence for GRN connecting multiple neurodegenerative diseases.

Previous research using genome-wide association studies has identified variants that may contribute to lifetime risk of multiple neurodegenerative diseases. However, whether there are common mechanisms that link neurodegenerative diseases is uncertain. Here, we focus on one gene, GRN, encoding progranulin, and the potential mechanistic interplay between genetic risk, gene expression in the brain and inflammation across multiple common neurodegenerative diseases. We utilized genome-wide association studies, expression quantitative trait locus mapping and Bayesian colocalization analyses to evaluate potential causal and mechanistic inferences. We integrate various molecular data types from public resources to infer disease connectivity and shared mechanisms using a data-driven process. Expression quantitative trait locus analyses combined with genome-wide association studies identified significant functional associations between increasing genetic risk in the GRN region and decreased expression of the gene in Parkinson's, Alzheimer's and amyotrophic lateral sclerosis. Additionally, colocalization analyses show a connection between blood-based inflammatory biomarkers relating to platelets and GRN expression in the frontal cortex. GRN expression mediates neuroinflammation function related to multiple neurodegenerative diseases. This analysis suggests shared mechanisms for Parkinson's, Alzheimer's and amyotrophic lateral sclerosis.

Exome-wide age-of-onset analysis reveals exonic variants in ERN1 and SPPL2C associated with Alzheimer\u2019s disease

Despite recent discoveries in genome-wide association studies (GWAS) of genomic variants associated with Alzheimer’s disease (AD), its underlying biological mechanisms are still elusive. The discovery of novel AD-associated genetic variants, particularly in coding regions and from APOEε4 non-carriers, is critical for understanding the pathology of AD. In this study, we carried out an exome-wide association analysis of age-of-onset of AD with ~20,000 subjects and placed more emphasis on APOEε4 non-carriers. Using Cox mixed-effects models, we find that age-of-onset shows a stronger genetic signal than AD case-control status, capturing many known variants with stronger significance, and also revealing new variants. We identified two novel variants, rs56201815, a rare synonymous variant in ERN1, and rs12373123, a common missense variant in SPPL2C in the MAPT region in APOEε4 non-carriers. Besides, a rare missense variant rs144292455 in TACR3 showed the consistent direction of effect sizes across all studies with a suggestive significant level. In an attempt to unravel their regulatory and biological functions, we found that the minor allele of rs56201815 was associated with lower average FDG uptake across five brain regions in ADNI. Our eQTL analyses based on 6198 gene expression samples from ROSMAP and GTEx revealed that the minor allele of rs56201815 was potentially associated with elevated expression of ERN1, a key gene triggering unfolded protein response (UPR), in multiple brain regions, including the posterior cingulate cortex and nucleus accumbens. Our cell-type-specific eQTL analysis using ~80,000 single nuclei in the prefrontal cortex revealed that the protective minor allele of rs12373123 significantly increased the expression of GRN in microglia, and was associated with MAPT expression in astrocytes. These findings provide novel evidence supporting the hypothesis of the potential involvement of the UPR to ER stress in the pathological pathway of AD, and also give more insights into underlying regulatory mechanisms behind the pleiotropic effects of rs12373123 in multiple degenerative diseases including AD and Parkinson’s disease.

A GRN Autocrine-Dependent FAM135B/AKT/mTOR Feedforward Loop Promotes Esophageal Squamous Cell Carcinoma Progression.

Esophageal squamous cell carcinoma (ESCC) is one of the most common and deadly diseases. In our previous comprehensive genomics study, we found that family with sequence similarity 135 member B (FAM135B) was a novel cancer-related gene, yet its biological functions and molecular mechanisms remain unclear. In this study, we demonstrate that the protein levels of FAM135B are significantly higher in ESCC tissues than in precancerous tissues, and high expression of FAM135B correlates with poorer clinical prognosis. Ectopic expression of FAM135B promoted ESCC cell proliferation in vitro and in vivo, likely through its direct interaction with growth factor GRN, thus forming a feedforward loop with AKT/mTOR signaling. Patients with ESCC with overexpression of both FAM135B and GRN had worse prognosis; multivariate Cox model analysis indicated that high expression of both FAM135B and GRN was an independent prognostic factor for patients with ESCC. FAM135B transgenic mice bore heavier tumor burden than wild-type mice and survived a relatively shorter lifespan after 4-nitroquinoline 1-oxide treatment. In addition, serum level of GRN in transgenic mice was higher than in wild-type mice, suggesting that serum GRN levels might provide diagnostic discrimination for patients with ESCC. These findings suggest that the interaction between FAM135B and GRN plays critical roles in the regulation of ESCC progression and both FAM135B and GRN might be potential therapeutic targets and prognostic factors in ESCC. SIGNIFICANCE: These findings investigate the mechanisms of FAM135B in promoting ESCC progression and suggest new potential prognostic biomarkers and therapeutic targets in patients with ESCC.

Serum Protein Profiling Reveals a Specific Upregulation of the Immunomodulatory Protein Progranulin in Coronavirus Disease 2019.

BackgroundSevere courses of COVID-19 are associated with elevated levels of interleukin 6. However, there is a growing body of evidence pointing to a broad and more complex disorder of pro-inflammatory and anti-viral responses with disturbed interferon signaling in COVID-19.MethodsIn this prospective single-center registry, we included SARS-CoV-2 positive patients and patients with similar symptoms and severity of disease but negative for SARS-CoV-2 admitted to the emergency department and compared their serum protein expression profiles.ResultsInterleukin-6 abundance was similar in SARS-CoV-2 positive patients (n = 24) compared to SARS-CoV-2 negative control (n = 61). In contrast, we observed a specific upregulation of the immunomodulatory protein progranulin (GRN). High GRN abundance was associated with adverse outcomes and increased expression of interleukin-6 in COVID-19.ConclusionThe data from this registry reveals that GRN is specifically upregulated in SARS-CoV-2 positive patients while interleukin-6 may serve as marker for disease severity. The potential of GRN as a biomarker and a possible impact of increased GRN expression on interferon signaling, virus elimination, and virus-induced lung tissue damage in COVID-19 should be further explored.

Analysis of brain atrophy and local gene expression in genetic frontotemporal dementia.

Frontotemporal dementia is a heterogeneous neurodegenerative disorder characterized by neuronal loss in the frontal and temporal lobes. Despite progress in understanding which genes are associated with the aetiology of frontotemporal dementia, the biological basis of how mutations in these genes lead to cell loss in specific cortical regions remains unclear. In this work, we combined gene expression data for 16 772 genes from the Allen Institute for Brain Science atlas with brain maps of grey matter atrophy in symptomatic C9orf72, GRN and MAPT mutation carriers obtained from the Genetic Frontotemporal dementia Initiative study. No significant association was seen between C9orf72, GRN and MAPT expression and the atrophy patterns in the respective genetic groups. After adjusting for spatial autocorrelation, between 1000 and 5000 genes showed a negative or positive association with the atrophy pattern within each individual genetic group, with the most significantly associated genes being TREM2, SSBP3 and GPR158 (negative association in C9Orf72, GRN and MAPT respectively) and RELN, MXRA8 and LPA (positive association in C9Orf72, GRN and MAPT respectively). An overrepresentation analysis identified a negative association with genes involved in mitochondrial function, and a positive association with genes involved in vascular and glial cell function in each of the genetic groups. A set of 423 and 700 genes showed significant positive and negative association, respectively, with atrophy patterns in all three maps. The gene set with increased expression in spared cortical regions was enriched for neuronal and microglial genes, while the gene set with increased expression in atrophied regions was enriched for astrocyte and endothelial cell genes. Our analysis suggests that these cell types may play a more active role in the onset of neurodegeneration in frontotemporal dementia than previously assumed, and in the case of the positively associated cell marker genes, potentially through emergence of neurotoxic astrocytes and alteration in the blood–brain barrier, respectively.

One novel GRN null mutation, two different aphasia phenotypes

Progranulin gene (GRN) mutations are among the leading causes of frontotemporal lobar degeneration, a group of neurodegenerative diseases characterized by remarkable clinical heterogeneity. In this article, we report the new GRN 708+4A>T splicing mutation, identified in 2 siblings of a family with several members affected by cognitive, behavioral, and motor disorders. Plasma progranulin dosage and GRN expression analysis, together with in silico prediction studies, supported the pathogenicity of the mutation. Both the patients displayed a clinical syndrome in which language impairment was largely predominant. However, motor speech deficits were the major feature in one case, diagnosed as progressive nonfluent aphasia, whereas marked semantic alterations were present in the other, whose clinical phenotype was in favor of a mixed aphasia. The profile of neuroanatomical alterations from imaging studies was in line with the clinical phenotypes. Therefore, also this novel GRN mutation is associated with haploinsufficiency and phenotypic heterogeneity, which are both typical features of progranulinopathies.

Dissecting the Prognostic Significance and Functional Role of Progranulin in Chronic Lymphocytic Leukemia.

Chronic lymphocytic leukemia (CLL) is known for its strong dependency on the tumor microenvironment. We found progranulin (GRN), a protein that has been linked to inflammation and cancer, to be upregulated in the serum of CLL patients compared to healthy controls, and increased GRN levels to be associated with an increased hazard for disease progression and death. This raised the question of whether GRN is a functional driver of CLL. We observed that recombinant GRN did not directly affect viability, activation, or proliferation of primary CLL cells in vitro. However, GRN secretion was induced in co-cultures of CLL cells with stromal cells that enhanced CLL cell survival. Gene expression profiling and protein analyses revealed that primary mesenchymal stromal cells (MSCs) in co-culture with CLL cells acquire a cancer-associated fibroblast-like phenotype. Despite its upregulation in the co-cultures, GRN treatment of MSCs did not mimic this effect. To test the relevance of GRN for CLL in vivo, we made use of the Eμ-TCL1 CLL mouse model. As we detected strong GRN expression in myeloid cells, we performed adoptive transfer of Eμ-TCL1 leukemia cells to bone marrow chimeric Grn−/− mice that lack GRN in hematopoietic cells. Thereby, we observed that CLL-like disease developed comparable in Grn−/− chimeras and respective control mice. In conclusion, serum GRN is found to be strongly upregulated in CLL, which indicates potential use as a prognostic marker, but there is no evidence that elevated GRN functionally drives the disease.

SA44WHAT CPGS CAN TELL: AN APPROACH TO THE METHYLATION PATTERN OF BDNF PROMOTER IV IN MAJOR DEPRESSION DISORDER AND ITS RELATION TO STRESS

Progranulin gene (GRN) mutations are among the leading causes of frontotemporal lobar degeneration, a group of neurodegenerative diseases characterized by remarkable clinical heterogeneity. In this article, we report the new GRN 708+4A>T splicing mutation, identified in 2 siblings of a family with several members affected by cognitive, behavioral, and motor disorders. Plasma progranulin dosage and GRN expression analysis, together with in silico prediction studies, supported the pathogenicity of the mutation. Both the patients displayed a clinical syndrome in which language impairment was largely predominant. However, motor speech deficits were the major feature in one case, diagnosed as progressive nonfluent aphasia, whereas marked semantic alterations were present in the other, whose clinical phenotype was in favor of a mixed aphasia. The profile of neuroanatomical alterations from imaging studies was in line with the clinical phenotypes. Therefore, also this novel GRN mutation is associated with haploinsufficiency and phenotypic heterogeneity, which are both typical features of progranulinopathies.

Progranulin levels in blood in Alzheimer's disease and mild cognitive impairment.

ObjectiveChanges in progranulin (GRN) expression have been hypothesized to alter risk for Alzheimer's disease (AD). We investigated the relationship between GRN expression in peripheral blood and clinical diagnosis of AD and mild cognitive impairment (MCI).MethodsPeripheral blood progranulin gene expression was measured, using microarrays from Alzheimer's (n = 186), MCI (n = 118), and control (n = 204) subjects from the University of California San Francisco Memory and Aging Center (UCSF‐MAC) and two independent published series (AddNeuroMed and ADNI). GRN gene expression was correlated with clinical, demographic, and genetic data, including APOE haplotype and the GRN rs5848 single‐nucleotide polymorphism. Finally, we assessed progranulin protein levels, using enzyme‐linked immunosorbent assay, and methylation status using methylation microarrays.ResultsWe observed an increase in blood progranulin gene expression and a decrease in GRN promoter methylation in males (P = 0.007). Progranulin expression was 13% higher in AD and MCI patients compared with controls in the UCSF‐MAC cohort (F 2,505 = 10.41, P = 3.72*10−5). This finding was replicated in the AddNeuroMed (F 2,271 = 17.9, P = 4.83*10−8) but not the ADNI series. The rs5848 SNP (T‐allele) predicted decreased blood progranulin gene expression (P = 0.03). The APOE4 haplotype was positively associated with progranulin expression independent of diagnosis (P = 0.04). Finally, we did not identify differences in plasma progranulin protein levels or gene methylation between diagnostic categories.InterpretationProgranulin mRNA is elevated in peripheral blood of patients with AD and MCI and its expression is associated with numerous genetic and demographic factors. These data suggest a role in the pathogenesis of neurodegenerative dementias besides frontotemporal dementia.

GATA factor genes in the Drosophila midgut embryo.

The Drosophila GATA factor gene serpent (srp) is required for the early differentiation of the anterior and posterior midgut primordia. In particular, srp is sufficient and necessary for the primordial gut cells to undertake an epithelial-to-mesenchimal transition (EMT). Two other GATA factor genes, dGATAe and grain (grn), are also specifically expressed in the midgut. On the one hand, dGATAe expression is activated by srp. Embryos homozygous for a deficiency uncovering dGATAe were shown to lack the expression of some differentiated midgut genes. Moreover, ectopic expression of dGATAe was sufficient to drive the expression of some of these differentiation marker genes, thus establishing the role of dGATAe in the regulation of their expression. However, due to the gross abnormalities associated with this deficiency, it was not possible to assess whether, similarly to srp, dGATAe might play a role in setting the midgut morphology. To further investigate this role we decided to generate a dGATAe mutant. On the other hand, grn is expressed in the midgut primordia around stage 11 and remains expressed until the end of embryogenesis. Yet, no midgut function has been described for grn. First, here we report that, as for dGATAe, midgut grn expression is dependent on srp; conversely, dGATAe and grn expression are independent of each other. Our results also indicate that, unlike srp, dGATAe and grn are not responsible for setting the general embryonic midgut morphology. We also show that the analysed midgut genes whose expression is lacking in embryos homozygous for a deficiency uncovering dGATAe are indeed dGATAe-dependent genes. Conversely, we do not find any midgut gene to be grn-dependent, with the exception of midgut repression of the proventriculus iroquois (iro) gene. In conclusion, our results clarify the expression patterns and function of the GATA factor genes expressed in the embryonic midgut.

Selectivity and Kinetic Requirements of HDAC Inhibitors as Progranulin Enhancers for Treating Frontotemporal Dementia

Frontotemporal dementia (FTD) arises from neurodegeneration in the frontal, insular, and anterior temporal lobes. Autosomal dominant causes of FTD include heterozygous mutations in the GRN gene causing haploinsufficiency of progranulin (PGRN) protein. Recently, histone deacetylase (HDAC) inhibitors have been identified as enhancers of PGRN expression, although the mechanisms through which GRN is epigenetically regulated remain poorly understood. Using a chemogenomic toolkit, including optoepigenetic probes, we show that inhibition of class I HDACs is sufficient to upregulate PGRN in human neurons, and only inhibitors with apparent fast binding to their target HDAC complexes are capable of enhancing PGRN expression. Moreover, we identify regions in the GRN promoter in which elevated H3K27 acetylation and transcription factor EB (TFEB) occupancy correlate with HDAC-inhibitor-mediated upregulation of PGRN. These findings have implications for epigenetic and cis-regulatory mechanisms controlling human GRN expression and may advance translational efforts to develop targeted therapeutics for treating PGRN-deficient FTD.

MicroRNA-588 suppresses tumor cell migration and invasion by targeting GRN in lung squamous cell carcinoma.

MicroRNAs (miRNAs) have been demonstrated to be critical in regulating tumor development and progression. The present study investigated the expression of miR-588 using reverse transcription-quantitative polymerase chain reaction analysis in 85 cases of lung squamous cell carcinoma (SCC), and observed the correlation between the expression of miR-588 with clinical pathologic features. The results indicated that the expression of miR-588 was predominantly lower in the tumor samples, compared with non-tumorous samples, and was negatively associated with tumor stages and lymph node invasion. The present study also examined the significance of the expression of miR-588 in SCC using gain- and loss-of-function analyses. It was found that miR-588 inhibited tumor cell migration and invasion. In addition, it was revealed that the overexpression of miR-588 in SCC cells reduced the mRNA and protein levels of progranulin (GRN), whereas miR-588 silencing increased the expression of GRN. A luciferase activity assay showed that miR-588 was able to directly bind to the 3′untranslated region of GRN and regulate its expression. Furthermore, it was found that the expression of GRN was inversely correlated with the expression of miR-588 in 85 paired SCC samples. These results indicated that GRN was involved in the miR-588-mediated suppressive functions in the progression of SCC.

Reduced secretion and altered proteolytic processing caused by missense mutations in progranulin

Progranulin (GRN) is a secreted growth factor involved in various cellular functions, and loss-of-function mutations are a major cause of frontotemporal lobar degeneration (FTLD) with TDP-43 positive pathology. Most FTLD-related GRN mutations are nonsense mutations resulting in reduced GRN expression. Nonsynonymous GRN missense mutations have been described as risk factor for neurodegenerative brain diseases, but their pathogenic nature remains largely elusive. We identified a double missense mutation in GRN leading to amino acid changes p.D33E and p.G35R in an FTLD patient from Turkish origin. Biochemical and cell biological analysis of the double-mutation together with 2 so-far uncharacterized GRN missense mutations (p.C105R and p.V514M) revealed a reduced secretion efficiency of the GRN p.D33E/p.G35R and p.C105R proteins. Furthermore, loss of the conserved cysteine residue affects protein folding and altered proteolytic processing by neutrophil elastase and proteinase 3. Our data indicate that the described variants may cause a loss-of-function, albeit to a lesser extent than GRN null mutations, and hence could be considered as low-penetrant risk factors for neurodegenerative diseases.

The TMEM106B locus and TDP-43 pathology in older persons without FTLD.

To determine the independent association of the TMEM106B variants with transactive response DNA binding protein 43 (TDP-43) pathology in older persons without frontotemporal lobar degeneration (FTLD) and to explore functional pathways that link the risk variants to the pathology, including a GRN mRNA pathway. Data came from 544 autopsied participants without FTLD in 2 community-based studies of aging. Participants underwent uniform neuropathologic evaluations, including TDP-43 cytoplasmic inclusions. We examined the association of TMEM106B variants with a semiquantitative measure of TDP-43 pathology in a series of regression analysis. We explored potential pathways by leveraging genetic, brain DNA methylation, miRNA, and transcriptomic data collected from this same group of participants. TDP-43 pathology was identified in 51.7% of the participants. The index single-nucleotide polymorphism (SNP), rs1990622(A), was associated with more advanced TDP-43 pathology. Top hits from fine mapping of the locus were in linkage disequilibrium of the index SNP. The association remained significant after adjustment for other neuropathologies including Alzheimer disease and hippocampal sclerosis (odds ratio = 1.351, 95% confidence interval = 1.068-1.709, p = 0.012). GRN expression was upregulated in rs1990622(AA/AG) carriers, and was associated with more advanced TDP-43 pathology. The TMEM106B variants were associated with lower level of DNA methylation in an active enhancer in GRN. Common variants in TMEM106B serve as a distinct risk factor for TDP-43 pathology in older persons without FTLD. The role of GRN expression and epigenetic mechanisms associating TMEM106B in the accumulation of TDP-43 in older persons require further study.

Anti-LeY antibody enhances therapeutic efficacy of celecoxib against gastric cancer by downregulation of MAPKs/COX-2 signaling pathway: correlation with clinical study.

Helicobacter pylori (H. pylori) is a major causative agent for the induction of chronic gastritis, gastric ulcer and gastric cancer. Celecoxib (COX-2 inhibitor) inhibits gastric cancer cell proliferation, but with low treatment efficacy, limiting its applications. It is important to develop a better strategy to improve the efficacy of celecoxib. Lewis Y (LeY) is a difucosylated oligosaccharide, highly expressed in 60-90% of human epithelial cancers, including gastric cancer. We previously found that H. pylori infection was associated with high level of LeY in gastric cancer. Herein, we analyzed the correlation between H. pylori and cyclo-oxygenase-2 (COX-2), LeY, gastric markers (CA724 and GRN) in gastric patient's tissue and serum samples by IHC and ELISA. Furthermore, we treated the primary gastric cancer cells with celecoxib, anti-LeY antibody or the combination, and analyzed their therapeutic efficacy on CA724, GRN and COX-2 expression by Western blot, flow cytometry and ELISA. We found that gastric cancer had significantly high expression of H. pylori, COX-2, CA724, and GRN compared to gastric ulcers and chronic gastritis (P < 0.0001). H. pylori level showed significant correlation with COX-2 (R--0.552), LeY (R--0.861), CA724 (R--0.714) and GRN (R--0.664) (P < 0.0001). Additionally, the combination therapy led to impressive inhibition of gastric cancer cell proliferation, with decreased expression of COX-2, CA724 and GRN through downregulation of MAPKs/COX-2 pathway (P < 0.01). Our findings suggest that anti-LeY antibody enhances the cancer cell proliferation inhibitory effects of celecoxib, which might be a new feasible way for gastric cancer therapy.