Leafroll Research Articles

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

Identification of grapevine virus G and grapevine virus H in Sardinia, Italy

Grapevine virus G (GVG) and grapevine virus H (GVH) (genus Vitivirus) are recently discovered viruses. Analysis of 38 samples from Sardinian grapevine cultivars for the presence of GVG and GVH was carried out using RT-PCR. All samples were also tested for grapevine Pinot gris virus (GPGV) using RT-PCR, and for grapevine leafroll virus -1, -2 and -3, grapevine virus A (GVA) and B (GVB), arabis mosaic virus (ArMV), grapevine fanleaf virus (GFLV) and grapevine fleck virus (GFkV) using multiplex RT-PCR. GVG was confirmed in four vines, and GVH was detected in only one sample. In phylogenetic analyses of the coat protein (CP) region, the Sardinian GVG isolates clustered separately from isolates from Croatia and New Zealand. The Sardinian GVH isolate clustered with most sequences from other countries, but with greater affinity to isolates from California (USA) for the CP region, whereas it clustered with isolates from Croatia in the RNA-dependent RNA polymerase (RdRp) region. In addition to GVG and GVH, many samples were coinfected with GVA, viruses from the leafroll complex, and GPGV. This is the first record of GVG and GVH occurring in Italy.

Identification of Interactions between Proteins Encoded by Grapevine Leafroll-Associated Virus 3.

The roles of proteins encoded by members of the genus Ampelovirus, family Closteroviridae are largely inferred by sequence homology or analogy to similarly located ORFs in related viruses. This study employed yeast two-hybrid and bimolecular fluorescence complementation assays to investigate interactions between proteins of grapevine leafroll-associated virus 3 (GLRaV-3). The p5 movement protein, HSP70 homolog, coat protein, and p20B of GLRaV-3 were all found to self-interact, however, the mechanism by which p5 interacts remains unknown due to the absence of a cysteine residue crucial for the dimerisation of the closterovirus homolog of this protein. Although HSP70h forms part of the virion head of closteroviruses, in GLRaV-3, it interacts with the coat protein that makes up the body of the virion. Silencing suppressor p20B has been shown to interact with HSP70h, as well as the major coat protein and the minor coat protein. The results of this study suggest that the virion assembly of a member of the genus Ampelovirus occurs in a similar but not identical manner to those of other genera in the family Closteroviridae. Identification of interactions of p20B with virus structural proteins provides an avenue for future research to explore the mechanisms behind the suppression of host silencing and suggests possible involvement in other aspects of the viral replication cycle.

Occurrence of Nine Grapevine Viruses in Commercial Vineyards of Mendoza, Argentina

Grapevine is a widely grown fruit crop that is seriously affected by different viruses, reducing grape yield and quality, as well as threatening profitability. Vineyard disease management requires accurate identification of viral infections. This study aimed to survey the presence of ten grapevine viruses in four geographic sites in the Mendoza province of Argentina. Two hundred twenty-three composite cane samples from 1060 plants of six cultivars were collected from 26 blocks distributed across 11 vineyards. The cane samples were screened by RT-PCR for the following viruses: grapevine leafroll-associated viruses 1-4 (GLRaV 1, 2, 3, and 4), grapevine fanleaf virus (GFLV), grapevine fleck virus (GFkV), grapevine virus A (GVA) and B (GVB), grapevine rupestris stem pitting associated virus (GRSPaV), and arabis mosaic virus (ArMV). The results showed an uneven occurrence of viruses through the sampled regions, with GRSPaV being prevalent (71.1%), followed by GFLV (28.9%), GFkV (20.6%), and GLRaV-2 (14.7%). GVB was not detected. This study revealed a moderate prevalence of viruses associated with economically impactful diseases in the vineyards surveyed.

Real-time RT-PCR high-resolution melting curve analysis to detect and differentiate Brazilian variants of grapevine viruses

Detecting and identifying viral infections in perennial plants, such as grapevines, can be challenging. Therefore, the aim of this study was to perform a real-time RT-PCR (RT-qPCR) high-resolution melting (HRM) curve analysis to detect and differentiate Brazilian variants of grapevine leafroll-associated virus 3 (GLRaV-3) and grapevine fanleaf virus (GFLV) in 74 and 10 infected plants, respectively, maintained in a collection block of grapevines. A single amplification curve was generated for each sample by RT-qPCR. Considering the amplified region of genomes of these two viruses, it was possible to identify and distinguish different variants of GLRaV-3 and of GFLV, which showed significantly different melting temperature (Tm) values between themselves, reflecting differences in the nucleotide sequences of the respective amplicons, and allowing discriminating variants and assess the viral diversity in grapevine accessions. The HRM analysis was validated by sequencing and nucleotide comparisons among Brazilian isolates of GLRaV-3 and GFLV.

In vitro silicon supplementation enhanced acclimatisation and growth of sugarcane (Saccharum officinarum) via improved antioxidant and nutrient acquisition patterns in saline soil.

Salinity affects crop growth by modulating cellular ionic concentrations and generation of reactive oxygen species. Application of silicon (Si) has proved beneficial in ameliorating salinity-triggered plant growth and yield retardations. Leaf roll explants of three sugarcane (Saccharum officinarum ) genotypes (HSF-240, CPF-246, CPF-250) were cultured in Murashige and Skoog (MS) medium supplemented with K2 SiO3 . In vitro regenerated plantlets were acclimatised and grown in natural saline soil. In absence of Si, cv. CPF-246 exhibited better salt tolerance as indicted by maximum chlorophyll a and chlorophyll b contents, rate of photosynthesis and root K+ uptake along with less cellular hydrogen peroxide content. Silicon restricted root Na+ uptake but assisted in K+ , Ca2+ , Mg2+ and Fe2+ accretion in roots and their translocation towards shoots. Cv. HSF-240 and cv. CPF-250 exhibited more increase in photosynthetic pigment content, stomatal conductance and photosynthetic rate after addition of 25 or 50mgL-1 Si than control group. Optimum phenolic content and antioxidant enzyme activity along with decreased lipid peroxidation and hydrogen peroxide content were recorded in all three sugarcane genotypes raised in presence of 25 or 50mgL-1 Si. These findings signify Si supplementation (50mgL-1 ) in tissue culture medium and plant adaptation in saline soil. Further in vitro studies involving Si-mediated gene expression modulations in sugarcane protoplasts shall assist in deciphering cross-talk between Si uptake and cellular responses. The application of Si can further be tested for other plant species to devise strategies for improved crop growth and utilisation of saline areas for crop cultivation.

Effectiveness of Botanical Pesticides from Wastes of Virginia Tobacco Stems in Reducing Populations of Leaf-Sucking Pest and Occurrence of Virus Disease Symptoms on Potato Plants

The potato plant (Solanum tuberosum L.) is a tuber-producing plant which is rich in carbohydrates, protein and minerals, and can be used as a staple food, and potatoes have great potential as one of the horticultural crops that can support world food diversification. One of the constraining factors in increasing potato productivity is leaf-sucking pests including aphids (Aphids spp.,), whitefly (Bemisia tabaci), and thrips (Thrips Palmi Karny), which besides damaging plants directly, can act as vectors for viruses that cause potato plant diseases such as Potato virus Y (PVY) and Potato leaf roll virus (PLRV). These two viruses can cause quite severe damage and through the health of the seeds they produce, they can reduce potato productivity by up to 70-80%. This study aims to determine the effect of several concentrations of botanical pesticides from Virginia tobacco stem waste on the emergence of viral disease symptoms in potato plants. The experiment was carried out in Sembalun Bumbung Village, East Lombok Regency (Indonesia), which was arranged using a Randomized Block Design consisting of 6 treatments namely control, abamectin, and Virginia tobacco stem waste botanical pesticides with concentrations of 2, 4, 6 and 8 ml/L. The results showed that the botanical pesticides from Virginia tobacco stem waste were effective in reducing leaf-sucking pest populations and suppressing the intensity of leaf-sucking pest attacks and were able to suppress the emergence of viral disease symptoms, with a concentration of 8 ml/L botanical pesticides more effective than other treatments in controlling populations. and attacks by potato leaf-sucking pests suspected as virus vectors.

Prevalence and molecular characterization of important potato viruses in the Tokat province of Turkey.

It is believed that viruses affect potato yield more than any other pathogens worldwide. We report here on a survey of the four most common potato viruses in the Tokat Province of northern Turkey. Leaf samples were collected from potato plants showing signs of viral diseases in five districts of the province. Over 400 leaf samples were tested using RT-PCR with virus-specific primers. Among the one or more viruses detected in 218 (52%) leaf samples, Potato virus Y (PVY) was the most common (47.1%), followed by potato virus S (PVS; 16.7%), potato virus X (PVX; 6.0%) and potato leaf roll virus (PLRV; 5.3%). The most common mixed infections were PVY + PVS (6.9%). A phylogenetic analysis of the gene sequences showed all Turkish PVS isolates to be clustered with the PVSO group, two PVY isolates with the PVYN-WI group and one isolate with the PVYNTN group. Turkish PVX isolates are in the Type X group of the two major PVX isolate groups. The Turkish PLRV isolates were separated into two major groups depending on the results of the phylogenetic analysis, with six cases in Group 1 and one in Group 2. PVY, PVX, PVS and PLRV were detected in potato production areas in Tokat. A phylogenetic comparison of the gene sequences revealed all Turkish isolates to be immigrant members of the world populations of these viruses. Our results emphasize the importance of the strict quarantine control of plant materials entering Turkey.

Grapevine Leafroll-Associated Virus 3 in Single and Mixed Infections Triggers Changes in the Oxidative Balance of Four Grapevine Varieties.

With the aim to characterize changes caused by grapevine leafroll-associated virus 3 (GLRaV-3) singly or in coinfection with other viruses and to potentially determine genotype-specific or common markers of viral infection, thirty-six parameters, including nutrient status, oxidative stress parameters, and primary metabolism as well as symptoms incidence were investigated in 'Cabernet Franc,' 'Merlot,' 'Pinot Noir,' and 'Tribidrag' grapevine varieties. Host responses were characterized by changes in cellular redox state rather than disturbances in nutrient status and primary metabolic processes. Superoxide dismutase, hydrogen peroxide, and proteins were drastically affected regardless of the type of isolate, the host, and the duration of the infection, so they present cellular markers of viral infection. No clear biological pattern could be ascertained for each of the GLRaV-3 genotypes. There is a need to provide a greater understanding of virus epidemiology in viticulture due to the increasing natural disasters and climate change to provide for global food production security. Finding grape varieties that will be able to cope with those changes can aid in this task. Among the studied grapevine varieties, autochthonous 'Tribidrag' seems to be more tolerant to symptoms development despite numerous physiological changes caused by viruses.

A Survey of Grapevine Leafroll-Associated Virus 1 and 3 in the South of Ukraine and Development of Primers for GLRaV-3 Identification

Viticulture is one of the most intensive and complex branches of Ukraine agriculture. Grapevine virus diseases are responsible for considerable economic losses to grape productivity and wine industries. One of the most notable and widespread viruses associated with vine leafroll disease is grapevine leafroll-associated viruses (GLRaV), belonging to the genus Ampelovirus, family Closteroviridae. Thus, the aim of this study was to conduct a survey targeting two viruses involved in the grapevine leafroll, namely grapevine leafroll-associated virus 1 (GLRaV-1) and virus 3(GLRaV-3) distributed in commercial wine grapes growing in the vineyards of the Ovidiopol and Bolhrad districts of the Odesa region. For efficient and accurate virus detection, we aimed to design universal primers based on conserved nucleotide sequences. Methods. Virus surveys of vineyards, visual diagnosis, immunoassay (ELISA), polymerase chain reaction with reverse transcription (RT-PCR), and Sanger sequencing of partial genome sequences of GLRaV. Results. The results obtained indicate that grapevine leafroll disease symptoms in field-grown grapevines in the south of Ukraine are caused by GLRaV-3. GLRaV-1 was not detected in any of the samples tested. To confirm the presence of GLRaV-3 in the samples, specific primers were designed targeting the coat protein region (GLRaV3-7f 5’-AGTAGGGGATGCAGCACAAG-3’; GLRaV3-7r 5’-ATCCAAAGCTATTCCCTTGC-3’) of the virus. A new set of primers (GLRaV3-7f / GLRaV3-7r) has been validated for sensitive detection of GLRaV-3 by RT-PCR and may be useful for routine virus detection in the laboratory as well as for large-scale testing. The partial coat protein gene of the isolate, GLRaV-3 ukr, distributed in the south of Ukraine, was sequenced, and the obtained sequence was deposited in GenBank under Acc. No. ON015835. The phylogenetic study demonstrated that GLRaV-3 ukr was closely related to isolates from Russia (MZ065372 and MZ065370).

Transmission of Grapevine Leafroll-Associated Viruses and Grapevine Virus A by Vineyard-Sampled Soft Scales (Parthenolecanium corni, Hemiptera: Coccidae).

Grapevine-infecting ampelo- and vitiviruses are transmitted by scale insects belonging to several species, among which is the European fruit lecanium, Parthenolecanium corni (Bouché) (Hemiptera Coccidae). Our objective was to characterize the transmission biology of grapevine leafroll-associated viruses (GLRaV) and grapevine virus A (GVA) by this soft scale species in order to evaluate its ability to spread these viruses. In transmission experiments with nymphs sampled from different vineyards infected with GLRaV 1, 2, 3 and GVA, P. corni transmitted only GLRaV 1 and GVA to healthy vines. GVA was predominantly transmitted along with GLRaV 1, whereas the latter could be transmitted alone from single or co-infected vines. Vineyard-sampled second instar nymphs were more efficient than first instars at transmitting GLRaV 1, whereas both instars displayed similar transmission rates for GVA. Short virus inoculation access periods and the absence of virus in eggs of females living on infected grapevines fulfilled the criteria of non-circulative semi-persistent transmission mode.

Grapevine Leafroll-Associated Virus 3 Replication in Grapevine Hosts Changes through the Dormancy Stage

Grapevine leafroll-associated virus 3 (GLRaV-3) is a graft-transmissible virus present in every viticultural region of the world and poses a large threat to grapevine production. Frequent coinfections with other viruses, the large number of grapevine varieties, the complexity of processes involved in plant response to virus infection, and the lack of studies on GLRaV-3 replication limit our knowledge of GLRaV-3 damaging effects and their background. In this study, five different inocula, one containing GLRaV-3 and others containing GLRaV-3 in combination with different grapevine viruses were green grafted to 52 different grapevine plants of four varieties to analyze the influence of the phenological stage and virus composition on GLRaV-3 replication. Relative concentration analysis by quantitative PCR conducted over a 16-month period revealed that other viruses as well as plant stage had a significant effect on GLRaV-3 replication and symptoms expression. The replication was most pronounced in the deep dormancy stage at the beginning of the infection, and the least at the exit of the dormancy stage. This study brings new insight into GLRaV-3 replication and discusses about viral interactions in one of the most economically important perennial plants, the grapevine.

Metagenomic Analysis of Ampelographic Collections of Dagestan Revealed the Presence of Two Novel Grapevine Viruses.

In this study, we analyzed the virome of 73 grape samples from two Dagestan ampelographic collections in Russia using high-throughput sequencing of total RNAs. Fourteen viruses and four viroids were identified, with one to eleven of them detected in each plant. For the first time in Russia, we identified grapevine leafroll-associated virus 7 and grapevine Kizil Sapak virus. A total of 206 genomes of viruses and viroids were obtained, and their phylogenetic analysis was carried out. The de novo assembly and tblastx analysis allowed us to obtain contigs of a novel (+) ssRNA genome of a plant virus from the genus Umbravirus, which was tentatively named grapevine umbra-like virus (GULV), as well as contigs of a novel dsDNA pararetrovirus from the genus Caulimovirus, which was tentatively named grapevine pararetrovirus (GPRV). Complete genomes of these viruses were obtained and used for Sequence Demarcation Tool (SDT) analysis and phylogeny studies. GULV and GPRV were detected in 16 and 33 germplasm samples from the Dagestan collections, respectively.

Caracterización del Cabernet-Sauvignon del Valle del Maipo (Chile) usando mediciones de fluorescencia

Virus infection in Vitis vinifera negatively impacts vineyard production and grape quality. Examples are grapevine leafroll-associated viruses (GLRaVs) and grapevine rupestris stem pitting-associated viruses (GRSPaV). We investigated transient fluorescence of chlorophyll a in leaves of Cabernet-Sauvignon, the primary red cultivar planted in Chile, using the OJIV test. First, we evaluated fluorescence in productive grapevines throughout their development, and then we analyzed the same parameters in plants infected with GLRaVs or GLRaVs+GRSPaV. We observed that throughout phenological development, as in the virus-affected clones, the kinetics of fluorescence emission decreased, particularly in values such as Fo and FM, reflecting the limitation in electron donation by the oxygen-releasing complexes and changes in the PSII antenna complex. The parameter reflecting the most significant differences was the performance index (PIABS), whose value decreases throughout phenological development and is also lower in virus-affected plants compared to healthy plants. This decrease would indicate that PSII changes the conversion of light energy of chemical energy to heat dissipation, making PIABS an excellent parameter to evaluate the vitality of Cabernet-Sauvignon vineyards.

The Spatial Diffusion of Cherry Leaf Roll Virus Revealed by a Bayesian Phylodynamic Analysis.

Cherry leaf roll virus (CLRV) is an important plant pathogen that causes severe and detrimental effects on cherry and other fruit plants. Despite recent progress in plant pathology, molecular biology, and population genetics of CLRV, the spatiotemporal spread of this virus remains poorly studied. In this study, we employed a Bayesian phylodynamics framework to investigate the spatial diffusion patterns of CLRV by analyzing the coat protein gene sequences of 81 viral isolates collected from five different countries. Consistent with the trade of cherry, our Bayesian phylodynamic analyses pointed to viral origins in New Zealand and identified multiple migration pathways between Germany and other countries, suggesting that Germany has played an important role in CLRV transmission. The results of our study will be useful in developing sustainable management strategies to control this pathogen.

Screening of cherry leaf roll virus in Sambucus nigra plants in Ukraine

Goal. Cherry leaf roll virus (CLRV) infects naturally a wide range of herbaceous and woody plants, different species of trees, shrubs, horticultural, ornamental, weed plants and causes significant economic losses in many hosts and countries. CLRV on elderberry species was reported in Europe, USA, Iran and North America. Recently this virus has been detected in sour and sweet cherry fruit orchards in Ukraine. Testing of other hosts than Prunus was performed in Ukraine only recently. The aim of the study was to test the black elderberry plants (Sambucus nigra L.). for the presence of CLRV in the Poltava region and Kyiv regions.
 Methods. Sampling was carried out in the summer–autumn period in 2019—2021 in the territories of the Poltava and Kyiv regions and in Kyiv city. Samples of healthy elderberry plants were also analyzed. Visual diagnostics, enzyme-linked immunosorbent assay in DAS-ELISA modification, total RNA extraction, RT-PCR with primers for a 412 bp fragment of the 3’ untranslated region of the CLRV genome, and statistical data analysis were used in this research. PCR products were separated on an 1.5% agarose gel. Commercial CLRV preparations were used for positive controls in DAS-ELISA.
 Results. Thirty three elderberry samples with symptoms of leaf rolling and mosaics of varying degrees were selected in the territory of the Poltava and Kyiv regions and in Kyiv city in 2019 and 2021 and used in the study. ELISA and RT-PCR results showed that 82% of the tested black elderberry samples were infected by CLRV.
 Conclusions. The presence of CLRV, its harmfulness for elderberry plants, and Sambucus potential to serve as a reservoir for the virus indicate the necessity of testing a wider range of plant species for сherry leaf roll virus in Ukraine.

First report of grapevine leafroll-associated virus-3 on peony plants in Ukraine

First report of grapevine leafroll-associated virus-3 on peony plants in Ukraine

The Effect of Differential Pest Load of Leaf Folder, Cnaphalocrocis medinalis (Guenee) on Extent of Leaf Damage and Alteration in Leaf Biochemical Composition in Rice

The effect of feeding damages induced by the leaf folder, Cnaphalocrocis medinalis (Guenee) at various damage levels on the biochemical parameters of rice leaves was investigated along with the estimation of leaf roll rate. The leaf roll rate was shown to be higher as the pest population increased. Biochemical profile of rice leaves damaged by a leaf folder was studied for quantitative and qualitative variations in soluble carbohydrate, starch and the ratio of chlorophyll a/b using standard biochemical procedures. The tests were carried out on a susceptible rice variety TN1. The result revealed that with increase in infestation by C. medinalis resulted in decreased soluble carbohydrates and starch content in rice leaves. But the trend was different for chlorophyll a/b and the ratio was found higher in pest infested vegetation.

Adoption of Best Management Practices for Grapevine Leafroll and Red Blotch Diseases: A Survey of West Coast Growers

Grapevine leafroll disease (GLD) and red blotch disease (RBD) threaten the sustainability of the U.S. wine grape industry. To understand the factors influencing the adoption of disease management practices, we surveyed wine grape industry professionals in California, Oregon, and Washington ( n = 154). Economic factors were the fundamental cost of implementing management practices and the ability to sell products from diseased vines (salability). Respondents who encountered reduced salability were more likely to adopt virus testing, replace infected vines, and view these practices as economically favorable. Salability was a strong driver for adoption among Californian respondents but less so in Washington, where wineries appeared more willing to accept infected products. Respondents who had acquired technical knowledge of disease ecology were more likely to adopt management practices and to perceive them as economical. Conversely, when there was a lack of knowledge of GLD ecology, notably that mealybugs transmit the pathogen, adoption was reduced, and practices were considered less economical. Factors affecting adoption were broadly generalizable across diseases. However, knowledge of GLD ecology was more strongly associated with adoption, likely reflecting the remaining knowledge gaps in RBD related to vector ecology and field spread. An emphasis on grower knowledge acquisition and the development of economical disease management practices can improve adoption of best management practices for viral diseases of grapevine. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

INCIDENCE OF APHID BORNE VIRUSES AND THEIR VECTOR DYNAMICS INFECTING POTATO CROP IN DIFFERENT DISTRICTS OF AZAD JAMMU AND KASHMIR, PAKISTAN

Potato crop production is hampered by several fungal, viral, and bacterial diseases. Among the viral Potato leaf roll virus (PLRV), Potato virus Y (PVY), Potato-mop-top-virus (PMTV), Potato virus S (PVS) and Potato virus X (PVX) are the most important. Potato growing fields were surveyed during 2016 and 2017 to determine the incidence of two aphid-borne viruses, PVY and PLRV and to explore the dynamics of potato aphids in four potato-producing district of Azad Jammu & Kashmir (AJK), Pakistan. During survey 930 leaf samples were collected from various locations of Bagh, Sudhnoti, Poonch and Neelum. Parameters determined included aphid population, symptomology, DAC-ELISA based virus incidence, rate of co-infection and disease severity. Overall relative disease incidence of PLRV and PVY was 48.71% and 53.23% respectively. The highest average aphid’s population per field was 390.27 in Sudhnoti due to the low altitude of the surveyed locations. Three aphid species Myzuspersicae Myzusornatusand, Macrosiphum euphorbiaewere identified in AJK potato fields. Themaximum co-infection was recorded from Poonch. It was found that aphid populations decreased with the increase of altitude. The incidence of PLRV and PVY were high where aphid population was high. Therefore, it is necessary to promote awareness among the farmers on virus and aphid symptoms identification and to recommend use of healthy, uncontaminated certified potato seed.