Glycosylphosphatidylinositol Transamidase Research Articles

Spectrum of Multiple Congenital Anomalies-Hypotonia-Seizures Syndrome 3 (MCAHS3) Due to Phosphatidylinositol Glycan Biosynthesis Class T (PIGT) Gene Mutations: A Narrative Review.

Multiple congenital anomalies-hypotonia-seizures syndrome 3 (MCAHS3) results from mutations in the phosphatidylinositol glycan biosynthesis class T (PIGT) gene leading to defects in glycosylphosphatidylinositol transamidase complex (GPI-TA) synthesis. Glycosylphosphatidylinositol serves as an anchor to more than 150 mammalian proteins for attachment on cell surfaces, enabling specific functional properties. Mutations in the PIGT gene result in disruption of this extremely important post-translational protein modification, yielding dysfunctional proteins leading to MCAHS3. An exhaustive literature search was conducted across various electronic databases to reveal only 41 reported cases of MCAHS3 worldwide, emphasizing the rarity of this condition. Multiple congenital anomalies-hypotonia-seizures syndrome 3 has been reported as secondary to 18 different known PIGT variants to date, manifesting as a varying spectrum of craniofacial dysmorphism, developmental delay with epilepsy, cardiac and renal malformations, and unique features in biochemical testing and neuroimaging. This review aims to highlight the constellation of clinical symptoms, diagnostic modalities, and management challenges associated with MCAHS3 cases. It would help determine optimal diagnostic and treatment strategies for newly identified cases and facilitate new research on this rare condition.

Targeting the GPI transamidase subunit GPAA1 abrogates the CD24 immune checkpoint in ovarian cancer

CD24 is frequently overexpressed in ovarian cancer and promotes immune evasion by interacting with its receptor Siglec10, present on tumor-associated macrophages, providing a "don't eat me" signal that prevents targeting and phagocytosis by macrophages. Factors promoting CD24 expression could represent novel immunotherapeutic targets for ovarian cancer. Here, using a genome-wide CRISPR knockout screen, we identify GPAA1 (glycosylphosphatidylinositol anchor attachment 1), a factor that catalyzes the attachment of a glycosylphosphatidylinositol (GPI) lipid anchor to substrate proteins, as a positive regulator of CD24 cell surface expression. Genetic ablation of GPAA1 abolishes CD24 cell surface expression, enhances macrophage-mediated phagocytosis, and inhibits ovarian tumor growth in mice. GPAA1 shares structural similarities with aminopeptidases. Consequently, we show that bestatin, a clinically advanced aminopeptidase inhibitor, binds to GPAA1 and blocks GPI attachment, resulting in reduced CD24 cell surface expression, increased macrophage-mediated phagocytosis, and suppressed growth of ovarian tumors. Our study highlights the potential of targeting GPAA1 as an immunotherapeutic approach for CD24+ ovarian cancers.

PIGT promotes cell growth, glycolysis, and metastasis in bladder cancer by modulating GLUT1 glycosylation and membrane trafficking

BackgroundBladder cancer is very common worldwide. PIGT is a subunit of the glycosylphosphatidylinositol transamidase which involves in tumorigenesis and invasiveness. m6A modification of mRNA has been linked to cell proliferation, tumor progression and other biological events. However, how PIGT is regulated and what is the function of PIGT in bladder cancer remains to be elucidated.MethodsPIGT was silenced or overexpressed to study its role in regulating bladder cancer. Cell proliferation and invasion were examined with the Cell Counting Kit-8, colony formation and Transwell assay, respectively. Cellular oxygen consumption rates or extracellular acidification rates were detected by a XF24 Analyzer. Quantitative RT-PCR and immunoblots were performed to detect mRNA and protein levels.ResultsPIGT was overexpressed in bladder cancer. Silencing PIGT inhibited cell proliferation, oxidative phosphorylation, and glycolysis. Overexpressing PIGT promoted cell proliferation, oxidative phosphorylation, glycolysis in vitro and tumor metastasis in vivo by activating glucose transporter 1 (GLUT1). PIGT also promoted GLUT1 glycosylation and membrane trafficking. Wilms’ tumor 1-associated protein (WTAP) mediated PIGT m6A modification, and m6A reader, insulin-like growth factor 2 mRNA-binding protein (IGF2BP2), binds to the methylated PIGT to promote the stability of PIGT, leading to up-regulation of PIGT.ConclusionWTAP mediates PIGT m6A modification to increase the stability of PIGT via the IGF2BP2, which enhances cell proliferation, glycolysis, and metastasis in bladder cancer by modulating GLUT1 glycosylation and membrane trafficking.

Structure and Function of the Glycosylphosphatidylinositol Transamidase, a Transmembrane Complex Catalyzing GPI Anchoring of Proteins.

Glycosylphosphatidylinositol (GPI) anchoring of proteins is a ubiquitous posttranslational modification in eukaryotic cells. GPI-anchored proteins (GPI-APs) play critical roles in enzymatic, signaling, regulatory, and adhesion processes. Over 20 enzymes are involved in GPI synthesis, attachment to client proteins, and remodeling after attachment. The GPI transamidase (GPI-T), a large complex located in the endoplasmic reticulum membrane, catalyzes the attachment step by replacing a C-terminal signal peptide of proproteins with GPI. In the last three decades, extensive research has been conducted on the mechanism of the transamidation reaction, the components of the GPI-T complex, the role of each subunit, and the substrate specificity. Two recent studies have reported the three-dimensional architecture of GPI-T, which represent the first structures of the pathway. The structures provide detailed mechanisms for assembly that rationalizes previous biochemical results and subunit-dependent stability data. While the structural data confirm the catalytic role of PIGK, which likely uses a caspase-like mechanism to cleave the proproteins, they suggest that unlike previously proposed, GPAA1 is not a catalytic subunit. The structures also reveal a shared cavity for GPI binding. Somewhat unexpectedly, PIGT, a single-pass membrane protein, plays a crucial role in GPI recognition. Consistent with the assembly mechanisms and the active site architecture, most of the disease mutations occur near the active site or the subunit interfaces. Finally, the catalytic dyad is located ~22Å away from the membrane interface of the GPI-binding site, and this architecture may confer substrate specificity through topological matching between the substrates and the elongated active site. The research conducted thus far sheds light on the intricate processes involved in GPI anchoring and paves the way for further mechanistic studies of GPI-T.

UP57 - Therapeutic and diagnostic potential of folic acid receptors and glycosylphosphatidylinositol transamidase in prostate cancer

UP57 - Therapeutic and diagnostic potential of folic acid receptors and glycosylphosphatidylinositol transamidase in prostate cancer

CLPTM1L is a GPI-anchoring pathway component targeted by HCMV.

The GPI-anchoring pathway plays important roles in normal development and immune modulation. MHC Class I Polypeptide-related Sequence A (MICA) is a stress-induced ligand, downregulated by human cytomegalovirus (HCMV) to escape immune recognition. Its most prevalent allele, MICA*008, is GPI-anchored via an uncharacterized pathway. Here, we identify cleft lip and palate transmembrane protein 1-like protein (CLPTM1L) as a GPI-anchoring pathway component and show that during infection, the HCMV protein US9 downregulates MICA*008 via CLPTM1L. We show that the expression of some GPI-anchored proteins (CD109, CD59, and MELTF)-but not others (ULBP2, ULBP3)-is CLPTM1L-dependent, and further show that like MICA*008, MELTF is downregulated by US9 via CLPTM1L during infection. Mechanistically, we suggest that CLPTM1L's function depends on its interaction with a free form of PIG-T, normally a part of the GPI transamidase complex. We suggest that US9 inhibits this interaction and thereby downregulates the expression of CLPTM1L-dependent proteins. Altogether, we report on a new GPI-anchoring pathway component that is targeted by HCMV.

Accumulated precursors of specific GPI-anchored proteins upregulate GPI biosynthesis with ARV1.

We previously reported that glycosylphosphatidylinositol (GPI) biosynthesis is upregulated when endoplasmic reticulum-associated degradation (ERAD) is defective; however, the underlying mechanistic basis remains unclear. Based on a genome-wide CRISPR-Cas9 screen, we show that a widely expressed GPI-anchored protein CD55 precursor and ER-resident ARV1 are involved in upregulation of GPI biosynthesis under ERAD-deficient conditions. In cells defective in GPI transamidase, GPI-anchored protein precursors fail to obtain GPI, with the remaining uncleaved GPI-attachment signal at the C-termini. We show that ERAD deficiency causes accumulation of the CD55 precursor, which in turn upregulates GPI biosynthesis, where the GPI-attachment signal peptide is the active element. Among the 31 GPI-anchored proteins tested, only the GPI-attachment signal peptides of CD55, CD48, and PLET1 enhance GPI biosynthesis. ARV1 is prerequisite for the GPI upregulation by CD55 precursor. Our data indicate that GPI biosynthesis is balanced to need by ARV1 and precursors of specific GPI-anchored proteins.

Multiple congenital anomalies-hypotonia-seizures syndrome 3 secondary to phosphatidylinositol glycan class T mutation: a neonatal case report

Multiple congenital anomalies-hypotonia-seizures syndrome 3 (MCAHS3) is caused by genetic defects in glycosyl-phosphatidylinositol transamidase complex synthesis due to mutations in the PIGT gene. The disease encompasses dysmorphism, cardiac, genito-urinary and skeletal anomalies, developmental delay and epilepsy in variable severity. Only 39 such cases have been reported till date in literature. We reported the first Indian case with neonatal presentation and overall the sixth case of MCAHS3 to present in neonatal age. The pro-band was a male baby born to non-consanguineous parents. He had perinatal depression, craniofacial dysmorphism, epileptic encephalopathy, left radio-ulnar congenital fractures and respiratory failure managed with multiple anti-epileptics, invasive ventilation and limb splinting. Clinical exome sequencing revealed an autosomal recessive homozygous PIGT gene mutation on exon 6 of chromosome 20 with a variant nomenclature of C.709G>C with heterozygous parents confirming MCAHS3. This report expands the range of information available on MCAHS3. It highlights the need to elaborately investigate dysmorphic newborns with severe hypotonia along with the described neurological symptoms, so as to pin point this potentially diagnosable entity.

A Soluble, Minimalistic Glycosylphosphatidylinositol Transamidase (GPI-T) Retains Transamidation Activity.

Glycosylphosphatidylinositol (GPI) anchoring of proteins is a eukaryotic, post-translational modification catalyzed by GPI transamidase (GPI-T). The Saccharomyces cerevisiae GPI-T is composed of five membrane-bound subunits: Gpi8, Gaa1, Gpi16, Gpi17, and Gab1. GPI-T has been recalcitrant to in vitro structure and function studies because of its complexity and membrane-solubility. Furthermore, a reliable, quantitative, in vitro assay for this important post-translational modification has remained elusive despite its discovery more than three decades ago.Three recent reports describe the structure of GPI-T from S. cerevisiae and humans, shedding critical light on this important enzyme and offering insight into the functions of its different subunits. Here, we present the purification and characterization of a truncated soluble GPI-T heterotrimer complex (Gpi823-306, Gaa150-343, and Gpi1620-551) without transmembrane domains. Using this simplified heterotrimer, we report the first quantitative method to measure GPI-T activity in vitro and demonstrate that this soluble, minimalistic GPI-T retains transamidase activity. These results contribute to our understanding of how this enzyme is organized and functions, and provide a method to screen potential GPI-T inhibitors.

Molecular insights into biogenesis of glycosylphosphatidylinositol anchor proteins

Eukaryotic cells are coated with an abundance of glycosylphosphatidylinositol anchor proteins (GPI-APs) that play crucial roles in fertilization, neurogenesis, and immunity. The removal of a hydrophobic signal peptide and covalent attachment of GPI at the new carboxyl terminus are catalyzed by an endoplasmic reticulum membrane GPI transamidase complex (GPI-T) conserved among all eukaryotes. Here, we report the cryo-electron microscopy (cryo-EM) structure of the human GPI-T at a global 2.53-Å resolution, revealing an equimolar heteropentameric assembly. Structure-based mutagenesis suggests a legumain-like mechanism for the recognition and cleavage of proprotein substrates, and an endogenous GPI in the structure defines a composite cavity for the lipid substrate. This elongated active site, stemming from the membrane and spanning an additional ~22-Å space toward the catalytic dyad, is structurally suited for both substrates which feature an amphipathic pattern that matches this geometry. Our work presents an important step towards the mechanistic understanding of GPI-AP biosynthesis.

Structure of human glycosylphosphatidylinositol transamidase.

Glycosylphosphatidylinositol (GPI) molecules are complex glycophospholipids and serve as membrane anchors for tethering many proteins to the cell surface. Attaching GPI to the protein in the endoplasmic reticulum (ER) is catalyzed by the transmembrane GPI transamidase (GPIT) complex, which is essential for maturation of the GPI-anchored proteins. The GPIT complex is known to be composed of five subunits: PIGK, PIGU, PIGT, PIGS and GPAA1. Here, we determined the structure of the human GPIT complex at a resolution of 3.1 Å using single-particle cryo-EM, elucidating its overall assembly. The PIGK subunit functions as the catalytic component, in which we identified a C206-H164-N58 triad that is critical for the transamination reaction. Transmembrane helices constitute a widely opened cleft, which is located underneath PIGK, serving as a GPI substrate-binding site. The ubiquitin E3 ligase RNF121 is visualized at the back of the complex and probably serves as a quality control factor for the GPIT complex.

Persistence of Trypanosoma brucei as early procyclic forms and social motility are dependent on glycosylphosphatidylinositol transamidase.

Glycosylphosphatidylinositol (GPI)‐linked molecules are surface‐exposed membrane components that influence the infectivity, virulence and transmission of many eukaryotic pathogens. Procyclic (insect midgut) forms of Trypanosoma brucei do not require GPI‐anchored proteins for growth in suspension culture. Deletion of TbGPI8, and inactivation of the GPI:protein transamidase complex, is tolerated by cultured procyclic forms. Using a conditional knockout, we show TbGPI8 is required for social motility (SoMo). This collective migration by cultured early procyclic forms has been linked to colonization of the tsetse fly digestive tract. The SoMo‐negative phenotype was observed after a lag phase with respect to loss of TbGPI8 and correlated with an unexpectedly slow loss of procyclins, the major GPI‐anchored proteins. Procyclins are not essential for SoMo, however, suggesting a requirement for at least one other GPI‐anchored protein. Loss of TbGPI8 initiates the transition from early to late procyclic forms; this effect was observed in a subpopulation in suspension culture, and was more pronounced when cells were cultured on SoMo plates. Our results indicate two, potentially interlinked, scenarios that may explain the previously reported failure of TbGPI8 deletion mutants to establish a midgut infection in the tsetse fly: interference with stage‐specific gene expression and absence of SoMo.

Functional Analysis of the GPI Transamidase Complex by Screening for Amino Acid Mutations in Each Subunit.

Glycosylphosphatidylinositol (GPI) anchor modification is a posttranslational modification of proteins that has been conserved in eukaryotes. The biosynthesis and transfer of GPI to proteins are carried out in the endoplasmic reticulum. Attachment of GPI to proteins is mediated by the GPI-transamidase (GPI-TA) complex, which recognizes and cleaves the C-terminal GPI attachment signal of precursor proteins. Then, GPI is transferred to the newly exposed C-terminus of the proteins. GPI-TA consists of five subunits: PIGK, GPAA1, PIGT, PIGS, and PIGU, and the absence of any subunit leads to the loss of activity. Here, we analyzed functionally important residues of the five subunits of GPI-TA by comparing conserved sequences among homologous proteins. In addition, we optimized the purification method for analyzing the structure of GPI-TA. Using purified GPI-TA, preliminary single particle images were obtained. Our results provide guidance for the structural and functional analysis of GPI-TA.

The consensus Nglyco -X-S/T motif and a previously unknown Nglyco -N-linked glycosylation are necessary for growth and pathogenicity of Phytophthora.

Asparagine (Asn, N)-linked glycosylation within Nglyco -X-S/T; X≠P motif is a ubiquitously distributed post-translational modification that participates in diverse cellular processes. In this work, N-glycosylation inhibitor was shown to prevent Phytophthora sojae growth, suggesting that N-glycosylation is necessary for oomycete development. We conducted a glycoproteomic analysis of P. sojae to identify and map N-glycosylated proteins and to quantify differentially expressed glycoproteins associated with mycelia, asexual cyst, and sexual oospore developmental stages. A total of 355 N-glycosylated proteins was found, containing 496 glycosites, potentially involved in glycan degradation, carbon metabolism, glycolysis, or other metabolic pathways. Through PNGase F deglycosylation assays and site-directed mutagenesis of a GPI transamidase protein (GPI16) upregulated in cysts and a heat shock protein 70 (HSP70) upregulated in oospores, we demonstrated that both proteins were N-glycosylated and that the Nglyco -N motif is a target site for asparagine - oligosaccharide linkage. Glycosite mutations of Asn 94 Nglyco -X-S/T in the GPI16 led to impaired cyst germination and pathogenicity, while mutation of the previously unknown Asn 270 Nglyco -N motif in HSP70 led to decreased oospore production. In addition to providing a map of the oomycete N-glycoproteome, this work confirms that P. sojae has evolved multiple N-glycosylation motifs essential for growth.

Subunits of the GPI transamidase complex localize to the endoplasmic reticulum and nuclear envelope in Drosophila.

A total of 10-20% of plasma membrane proteins are anchored by glycosylphosphatidylinositol (GPI). GPI is attached to proteins by GPI transamidase (GPI-T), which contains five subunits named PIGK, PIGS, PIGT, PIGU, and GPAA1. We previously reported that PIGT localizes near the nucleus in Drosophila. However, localizations of the other four subunits remain unknown. Here, we show that a catalytic subunit of GPI-T, PIGK, mainly localizes to the endoplasmic reticulum (ER), while the other four subunits localize to the nuclear envelope (NE) and ER. The NE/ER localization ratio of PIGS differs between cell types and developmental stages. Our results suggest that GPI-T catalyzes GPI attachment in the ER and the other four subunits may have other unknown functions in the NE.

Loss of PIGK function causes severe infantile encephalopathy and extensive neuronal apoptosis.

PIGK gene, encoding a key component of glycosylphosphatidylinositol (GPI) transamidase, was recently reported to be associated with inherited GPI deficiency disorders (IGDs). However, little is known about the specific downstream effects of PIGK on neurodevelopment due to the rarity of the disease and the lack of in vivo study. Here, we described 2 patients in a Chinese family presented with profound global developmental delay, severe hypotonia, seizures, and postnatal progressive global brain atrophy including hemisphere, cerebellar and corpus callosum atrophy. Two novel compound heterozygous variants in PIGK were identified via genetic analysis, which was proved to cause significant decrease of PIGK protein and reduced cell surface presence of GPI-APs in the patients. To explore the role of Pigk on embryonic and neuronal development, we constructed Pigk knock-down zebrafish and knock-in mouse models. Zebrafish injected with a small dose of morpholino oligonucleotides displayed severe developmental defects including small eyes, deformed head, curly spinal cord, and unconsumed yolk sac. Primary motor neuronal dysplasia and extensive neural cell apoptosis were further observed. Meanwhile, the mouse models, carrying the two variants respectively homologous with the patients, both resulted in complete embryonic lethality of the homozygotes, which suggested the intolerable effect caused by amino acid substitution of Asp204 as well as the truncated mutation. Our findings provide the in vivo evidence for the essential role of PIGK during the embryonic and neuronal development. Based on these data, we propose a basis for further study of pathological and molecular mechanisms of PIGK-related neurodevelopmental defects.

Hrd1-dependent Degradation of the Unassembled PIGK Subunit of the GPI Transamidase Complex.

Glycosylphosphatidylinositol (GPI)-anchored proteins are post-transcriptionally modified with GPI and anchored to the plasma membrane. GPI is attached to nascent proteins in the endoplasmic reticulum by the GPI transamidase complex, which consists of PIGT, PIGK, GPAA1, PIGU, and PIGS. Of these, PIGK is a catalytic subunit that is unstable without PIGT. This study investigated the pathway by which unassembled PIGK not incorporated into the complex is degraded. We showed that unassembled PIGK was degraded via the proteasome-dependent pathway and that Hrd1 (also known as SYVN1), a ubiquitin ligase involved in the endoplasmic reticulum-associated degradation pathway, was responsible for degradation of unassembled PIGK.Key words: Glycosylphosphatidylinositol, GPI transamidase complex, protein stability, transamidation, ERAD.

AtPIG-S, a predicted Glycosylphosphatidylinositol Transamidase subunit, is critical for pollen tube growth in Arabidopsis

BackgroundGlycosylphosphatidylinositol (GPI) addition is one of the several post-translational modifications to proteins that increase their affinity for membranes. In eukaryotes, the GPI transamidase complex (GPI-T) catalyzes the attachment of pre-assembled GPI anchors to GPI-anchored proteins (GAPs) through a transamidation reaction. A mutation in AtGPI8 (gpi8–2), the putative catalytic subunit of GPI-T in Arabidopsis, is transmitted normally through the female gametophyte (FG), indicating the FG tolerates loss of GPI transamidation. In contrast, gpi8–2 almost completely abolishes male gametophyte (MG) function. Still, the unexpected finding that gpi8–2 FGs function normally requires further investigation. Additionally, specific developmental defects in the MG caused by loss of GPI transamidation remain poorly characterized.ResultsHere we investigated the effect of loss of AtPIG-S, another GPI-T subunit, in both gametophytes. Like gpi8–2, we showed that a mutation in AtPIG-S (pigs-1) disrupted synergid localization of LORELEI (LRE), a putative GAP critical for pollen tube reception by the FG. Still, pigs-1 is transmitted normally through the FG. Conversely, pigs-1 severely impaired male gametophyte (MG) function during pollen tube emergence and growth in the pistil. A pPIGS:GFP-PIGS transgene complemented these MG defects and enabled generation of pigs-1/pigs-1 seedlings. However, the pPIGS:GFP-PIGS transgene seemingly failed to rescue the function of AtPIG-S in the sporophyte, as pigs-1/pigs-1, pPIGS:GFP-PIGS seedlings died soon after germination.ConclusionsCharacterization of pigs-1 provided further evidence that the FG tolerates loss of GPI transamidation more than the MG and that the MG compared to the FG may be a better haploid system to study the role of GPI-anchoring. Pigs-1 pollen develops normally and thus represent a tool in which GPI anchor biosynthesis and transamidation of GAPs have been uncoupled, offering a potential way to study free GPI in plant development. While previously reported male fertility defects of GPI biosynthesis mutants could have been due either to loss of GPI or GAPs lacking the GPI anchor, our results clarified that the loss of mature GAPs underlie male fertility defects of GPI-deficient pollen grains, as pigs-1 is defective only in the downstream transamidation step.

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

A novel variant in GPAA1, encoding a GPI transamidase complex protein, causes inherited vascular anomalies with various phenotypes.

Vascular anomalies (VAs), comprising wide subtypes of tumors and malformations, are often caused by variants in multiple tyrosine kinase (TK) receptor signaling pathways including TIE2, PIK3CA and GNAQ/11. Yet, a portion of individuals with clinical features of VA do not have variants in these genes, suggesting that there are undiscovered pathogenic factors underlying these patients and possibly with overlapping phenotypes. Here, we identified one rare non-synonymous variant (c.968A > G) in the seventh exon of GPAA1 (Glycosylphosphatidylinositol Anchor Attachment Protein 1), shared by the four affected members of a large pedigree with multiple types of VA using whole-exome sequencing. GPAA1 encodes a glycosylphosphatidylinositol (GPI) transamidase complex protein. This complex orchestrates the attachment of the GPI anchor to the C terminus of precursor proteins in the endoplasmic reticulum (ER). We showed such variant led to scarce expression of GPAA1 protein in vascular endothelium and induced a localization change from ER membrane to cytoplasm and nucleus. In addition, expressing wild-type GPAA1 in endothelial cells had an effect to inhibit cell proliferation and migration, while expressing variant GPAA1 led to overgrowth and overmigration, indicating a loss of the quiescent status. Finally, a gpaa1-deficient zebrafish model displayed several types of developmental defects as well as vascular dysplasia, demonstrating that GPAA1 is involved in angiogenesis and vascular remodeling. Altogether, our results indicate that the rare coding variant in GPAA1 (c.968A > G) is causally related to familial forms of VAs.