Abstract
Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.
Highlights
There are more than 150 different eukaryotic cell surface proteins attached to the plasma membrane by glycosylphosphatidylinositol (GPI)
Based on the clinical manifestations of the proband and the principle of familial co-segregation, other variants of the proband identified by whole-exome sequencing (WES) were considered as non-pathogenic
We identified novel Phosphatidylinositol glycan class S (PIGS) pathogenic variants [c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGT GCGAGTGATGGAGGTG (p.Asp381_Val388dup)] in a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment, hypotonia, and intellectual disability
Summary
There are more than 150 different eukaryotic cell surface proteins attached to the plasma membrane by glycosylphosphatidylinositol (GPI). GPI anchoring is critical for the expression of those proteins, including adhesion molecules, receptors, and enzymes, on the cell surface (Fujita and Kinoshita, 2012). The GPI transamidase replaces a protein’s C-terminal GPI attachment signal peptide with a preassembled GPI, which mediates GPI anchoring in the endoplasmic reticulum (Ohishi et al, 2001, 2003). Phosphatidylinositol glycan class S (PIGS) encodes an essential component of the GPI transamidase that mediates GPI anchoring in the endoplasmic reticulum (Ohishi et al, 2001). Neurological syndrome, including seizures, intellectual disability, muscular hypotonia, and multiple congenital malformations, was reported in the majority of individuals who had defects in the GPI–anchor–biosynthesis pathway.
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call