Bromus Research Articles

Potential of productive longevity of legum-mint grass mixture in the south of Western Siberia

Perennial legume-bluegrass herbaceous stands stabilize forage production for highly productive livestock farming and make a significant contribution to the nitrogen balance of agroecosystems in Western Siberia. The studies were conducted to study the effect of mineral nutrition conditions on the growth, development and dry matter yield of a mixture of goat’s rue and brome grass in the forest-steppe of Western Siberia. The work was carried out in 2000…2021 in a stationary field experiment on meadow-chernozem medium-deep medium-humus heavy loamy soil in the Omsk region. The experiment was laid out in the hatchery field of the 8-field crop rotation (eastern galega, eastern galega + brome, spring barley, field pea, sweet sorghum, alfalfa + brome, forage beans, millet + rapeseed) according to the scheme providing for the study of the following options: potassium fertilizer (factor A) – K0, K60; nitrogen fertilizer (factor B) – N0, N30, N60; soil supply with mobile phosphorus (factor C) – average (70…80 mg/kg according to F. V. Chirikov, background 0), increased (background I – 120, background II – 140 mg/kg), high (150…160 mg/kg, background III). The most balanced ratio of legume and bluegrass components was on the backgrounds with increased and high content of mobile phosphorus in the soil. Without the application of nitrogen fertilizers against these backgrounds, the competitive ability of goat’s rue increases, which is ecologically and economically effective. Against the background of irrigation, the yield of the grass mixture reaches 8 … 9 t/ha of dry mass in variants with a sufficient level of phosphorus (increased and high content) at 6.35 t/ha without fertilizers. In subsequent years, in the absence of irrigation, the picture changed towards a general decrease in yield to 5 … 6 t/ha of dry mass in fertilized variants at 3.60 … 4.81 t/ha in the variant without fertilizers. In the second decade, a reliable manifestation of yield growth in variants without nitrogen fertilizers is by 0.49 in 2011 … 2015 and by 0.99 t/ha in 2016 … 2021 on average by factor, due to an increase in the share of goat’s rue in the botanical composition.

Intensive cropping influences the success of seed dormancy breaking methods in Australian collected Hordeum, Avena, and Bromus sp.

Seed dormancy is a critical evolutionary trait that enhances the persistence of plant populations under both natural and managed conditions. It is influenced by genetic and environmental factors, with crop management practices like tillage and herbicide use reportedly selecting for increased seed dormancy in weeds. This study aimed to compare the success of seed dormancy breaking methods between weed populations collected from intensively managed crop fields and unmanaged ruderal locations. Weeds from intensively managed fields, including Hordeum glaucum, H. leporinum, Avena fatua, Bromus diandrus, and B. rigidus exhibited significantly higher seed dormancy and didn't respond largely to seed dormancy breaking methods compared to those from unmanaged areas. Dormancy-breaking treatments such as sandpaper scarification were effective in barley grass, while endosperm excision followed by cold stratification alleviated dormancy in brome grass and wild oat. Dark incubation consistently improved germination across all species, enhancing the efficacy of treatments like cold stratification, sandpaper scarification, and gibberellic acid (GA3). Weeds in managed fields develop greater seed dormancy, likely as an adaptive response to agricultural practices. Techniques such as tillage, which incorporate seeds deeper into the soil, may help mitigate seed dormancy traits by reducing light exposure. These findings highlight the importance of dormancy management in controlling persistent weed populations. © 2024 Society of Chemical Industry.

Agroecological importance of smooth brome in managing wheat stem sawfly (Hymenoptera: Cephidae) via associated braconid parasitoids.

Wheat stem sawfly (WSS), Cephus cinctus Norton (Hymenoptera: Cephidae), is a major pest of cereal crops throughout the Northern Great Plains of North America. Native parasitoids, Bracon cephi (Gahan) and B. lissogaster Muesebeck (Hymenoptera: Braconidae), play a key role in suppressing WSS populations and limiting associated damage. Smooth brome grass (Bromus inermis Leyss.) serves as a potential trap reservoir for WSS when grown in areas surrounding wheat (Triticum aestivum L.) fields in Montana. Its unique biology allows it to support high WSS infestation while promoting significant larval mortality throughout the growing season. Late-season WSS survivors can then serve as hosts for WSS parasitoids. Our study investigated smooth brome as a host refuge for WSS parasitoids. We measured WSS larval infestation and survival rate inside smooth brome grown within WSS-inclusion cages, finding a maximum infestation of 66.5% and an end-of-year WSS survival of 5.7%. In addition, we collected stems from sites in central and north-central Montana to measure the WSS infestation and parasitoid prevalence in wheat and adjacent smooth brome. WSS infestation was high in both Big Sandy (64.5% smooth brome, 65.7% adjacent wheat) and Moccasin, MT (50.6%, 38.6%). Year-end WSS larval mortality was 43.6% greater in smooth brome compared to adjacent wheat at both field sites, but both hosted similar numbers of WSS parasitoids. This research underscores the importance of smooth brome in providing a sustainable host refuge for WSS parasitoids and highlights its significant role in supporting the economics of wheat cultivation.

(Bromus rigidus)من خلال معرفة كثافة الحشائش(Triticum aestivum L)استخدام تحليل امسار للتنبؤ بفقدان نباتات القمح

The research explores the use of path analysis to predict the effect of brome grass (Bromus rigidus Roth) density on wheat (Triticum aestivum L.) yield loss. It also studies the relationship between weed density and wheat productivity. The research was conducted during the fall 2020 and spring 2021 seasons. Data were collected from experiments conducted under different densities of weeds and wheat. The statistical analysis program SPSS was used to determine the effect of competition on the amount of loss in wheat and brome productivity, using the Cousens equation and to calculate the competition coefficient between species using the Steward equation. Then, path analysis was used to predict the effect of internal and external variables on plant traits, biomass, and productivity. The results showed that increasing grass density led to a decrease in wheat productivity. The study emphasizes the importance of taking physiological factors into account in crop productivity. Recommendations include implementing measures to control weed density, adjusting wheat planting density to compete effectively with weeds, using weed-resistant wheat varieties, adopting comprehensive farm management practices, and conducting further research to enhance understanding of the interaction between wheat and weeds.

Indaziflam Provides Long-Term Reduction of Annual Brome Grass (Bromus spp.) in Canada's Mixedgrass Prairie

Indaziflam Provides Long-Term Reduction of Annual Brome Grass (Bromus spp.) in Canada's Mixedgrass Prairie

61 Effects of botanical composition on grazing system management, forage quality, forage availability, and ewe performance

Abstract The objective was to compare the effects of two forage mixtures utilized in a rotational grazing system on ewe performance, forage quality, and forage availability. Dorset-Suffolk crossbred ewes [n = 48; body weight (BW) = 187 ± 20 kg] were stratified by BW, body condition score (BCS), and age, then allotted to six groups. Groups were randomly assigned to one of two treatments: forage mixture 1 (FM1; 47% orchard grass, 30% white clover, 14% brome grass, and 9% ryegrass) and forage mixture 2 (FM2; 44% ryegrass, 33% white clover, and 23% red clover). There were 18 paddocks (30.5 m x 22 m) for each treatment, each group was rotated between one of six paddocks; the rotation of each group was determined by the reduction of forage height to approximately 10 cm. Ewe BW and BCS were collected on d 0, 14, and 28. Forage heights were measured using meter sticks upon the groups entering and exiting each paddock. Forage heights were used to calculate forage availability, and the difference between pre-grazing and post-grazing forage availability was assumed to be forage disappearance. Five pre-grazing forage samples from each paddock were clipped at 10 cm using the forage square (0.0625 m²) to determine fiber content. Data were analyzed using the GLM procedure of SAS 9.4. No effects on ewe BW or BCS were observed (P = 0.4134) between treatments. Ewes grazing FM2 spent more time grazing each paddock (P < 0.01) compared with ewes grazing FM1. Pre-grazing forage ground cover (P < 0.01) was greater in FM2 compared with FM1; however, grazed forage mass disappearance was not different (P = 0.44) between treatments. The NDF and ADF values were greater for FM1 than FM2 (P < 0.01 and P = 0.02, respectively) indicating that more forage is needed to meet ewe energy requirements. Results suggest that neither forage mixture had a significant impact on ewe BW or BCS; however, ewes grazing FM2 maintained themselves on a smaller land area during growing season, making it a more feasible option for rotational grazing management.

Grazing increases the positive feedback of legumes while decreasing the negative feedback of grass

AbstractHerbivore grazing affects plant growth and community structure in grasslands. This effect could be directly through foraging and dung/urine return or indirectly through plant–soil feedbacks (PSFs). Addressing the grazing effect on the feedback of plants can explicate the causes of community changes in the grazing system. However, how grazing and PSF interact to affect plant growth remains unclear. Here, we conducted a classic PSF experiment. In the conditioning stage, two native plant species (a grass Bromus inermis and a legume Medicago sativa) were planted in the field with four simulated grazing treatments (ambient, mowing, dung/urine addition, and mowing + dung/urine addition) in a meadow grassland of northern China. In the feedback stage, B. inermis and M. sativa were planted in the soils (both unsterilized and sterilized) from each treatment in the field experiment. Plant biomass of M. sativa showed positive feedback while B. inermis showed negative feedback across all the simulated grazing treatments. Simulated grazing (mowing and dung/urine addition) increased the positive feedback of M. sativa, while decreasing the negative feedback of B. inermis. The addition of dung/urine to the soil was found to have a significantly stronger impact on plant growth feedback compared to the effect of mowing. Dung/urine addition enriches the soil with higher levels of available nitrogen and phosphorus. Our results suggested that legume plants should have positive PSFs while grass should have negative feedback, which might be amplified by grazing because of the dung/urine fertilization effect. Our study improves the understanding of PSF effects on plant growth and community change in grazed grassland.

Modeling net ecosystem exchange of CO2 with gated recurrent unit neural networks

The complex forcing mechanisms of biophysical drivers on ecosystem productivity, as well as some unknown relationships, stipulates the application of artificial intelligence techniques in modeling the ecosystem carbon cycle. In particular, various deep learning algorithms have been successfully applied to comprehend temporal relationships, though some issues regarding capturing temporal features for modeling CO2 fluxes across time scales remain unsolved. In this study, a gated recurrent unit (GRU) model was trained for simulating half-hourly net ecosystem exchange of CO2 (NEE) using 12-year continuous flux data (2009–2020) from seven experimental bioenergy crops in southwest Michigan, USA. The fields were historically managed either as corn-soybean rotation agricultural (AGR) or Conservation Reserve Program (CRP) lands and planted to no-till corn (AGR-C and CRP-C), restored-prairie (AGR-Pr and CPR-Pr), switchgrass (AGR-Sw and CRP-Sw) and smooth brome grass (CRP-Ref). We compared NEE simulations for the entire year, growing season, and non-growing season datasets, and analyzed relative importance of biophysical variables on variations of NEE. GRU performed well in simulating NEE at single site, with R2 of 0.89–0.93, 0.85–0.90, and 0.61–0.85 for the annual, growing season, and non-growing season datasets, respectively, which provided comparable accuracy and 6 % of run-time shorter than those of long short-term memory. R2 reached 0.70 and 0.80 across all sites and unique land-cover types. Radiation parameters contributed most to the variability of NEE. Contributions of individual variables appear more complex during the non-growing season and include incoming shortwave radiation, day of year, temperature, Monin-Obukhov stability, wind direction, and soil water content. The six most important forcing variables are consistent with our current understanding, although their ranked importance varied by ecosystem type and modeling scale. These results bring renewed insights in modeling observations at seasonal scales and provide guidance for variable selection to scale up measurements from one site to multiple land-cover types across the landscape.

К вопросу об использовании мелиоративных приемов в целях формирования биогеохимических барьеров

The amount of lands subject to contamination with heavy metal ions is increasing due to mining of minerals. Therefore, research on the use of various composite sorbents / ameliorants, which in combination with perennial plants can act as a biogeochemical barrier to the spread of heavy metal ions in the environment, is currently relevant. In the “soil–and-plant” system, use of the peat-and-diatomite ameliorant granulated on site in the direction of the man-made flow showed a high degree of survival of the awnless brome grass (Brōmus inērmis) compared with zero survival on the reference area. The dynamics of heavy metal accumulation in the plant biomass shows an increase in the content of copper and zinc, in comparison with the background values during the second year of research, while during the third year there is a decrease in the content of copper in the biomass from 235 to 40 mg / kg, with an increase in zinc content from 473 mg / kg to 510 mg / kg. The data obtained confirm the limits of metal fluctuations in the plant biomass established by previous researchers. At the peat-and-diatomite ameliorant sites, an increase in the concentration of Cu2+ and Zn2+ was also observed in comparison with the other survey locations, which indicates the possibility of using granular peat-and-diatomite ameliorant as a material to create a network of biogeochemical barriers perpendicular to the direction of the man-made flow.

Plant, insect, and soil microbial communities vary across brome invasion gradients in northern mixed‐grass prairies

Species interactions shape native plant communities, influencing both composition and ecosystem processes, with invasion by non‐native species threatening these dynamic relationships, native species, and function. The consequences of invasive plants in particular may stretch across taxa to impact plant, insect, and soil microbial communities directly and indirectly, with consequences for ecological functioning. In northern mixed‐grass prairies in the United States, invasion by two annual brome grasses, Bromus arvensis and B. tectorum, negatively impacts rangeland plants; however, the simultaneous effects on insects and soil microbes (bacteria and archaea), and the implications for ecological function, have received less attention. Here, using observational field studies conducted at two mixed‐grass prairie sites in Montana and Wyoming, we assessed the relationships between plants, insects, and soil microbes across gradients of invasion by B. arvensis and B. tectorum. Overall, we found differences in plant and insect communities and functional groups with increasing invasion abundance for both brome species. However, associations between invasion and the soil microbial community were species specific, as we only saw these relationships under B. tectorum invasion, implying B. tectorum may have more substantial consequences for rangeland management. While invasion by annual bromes may cause changes in certain plant and insect functional groups, such as C4 perennial grasses and certain insect herbivores, soil microbial functional groups may be less impacted, especially under B. arvensis invasion. This work sheds light on the need to explore changes in natural communities across taxa and to all invasive species, as ecosystem effects are likely to be contingent upon both.

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trębicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

Economic and energy efficiency of perennial agrophytocenoses with the jerusalem artichoke participation in the Karelia conditions

The article presents the results of the research of cultivation technology of topinambur with perennial legumes and grasses in the Republic of Karelia. The highest dry mass yield (9.3 t/ha) has been achieved by joint agrophytocenosis with Helianthustuberosus L. in comparison with the control of timothy grass + brome grass + clover (7.9 t/ha). Inclusion of topinambur has increased productivity of perennial stands of grass (7.99 thousand fodder units, 97.0 GJ of metabolizable energy, 1.34 t of crude protein per 1 ha). On the basis of economic and energy efficiency, it has been proved that agrophytocenoses of topinambur and perennial legumes and grasses are the most economically efficient. The maximum value of the agro-energy coefficient in terms of metabolizable energy has been obtained in the following variant: timothy grass + brome grass + clover + topinambur.

Distribution, frequency and molecular basis of clethodim and quizalofop resistance in brome grass (Bromus diandrus).

Brome grass (Bromus diandrus Roth) is prevalent in the southern and western cropping regions of Australia, where it causes significant economic damage. A targeted herbicide resistance survey was conducted in 2020 by collecting brome grass populations from 40 farms in Western Australia and subjecting these samples to comprehensive herbicide screening. One sample (population 172-20), from a field that had received 12 applications of clethodim over 20 years of continuous cropping, was found to be highly resistant to the acetyl-CoA carboxylase (ACCase)-inhibiting herbicides clethodim and quizalofop, and so the molecular basis of resistance was investigated. All 31 individuals examined from population 172-20 carried the same resistance-endowing point mutation causing an aspartate-to-glycine substitution at position 2078 in the translated ACCase protein sequence. A wild-type susceptible population and the resistant population had similar expression levels of plastidic ACCase genes. The level of resistance to quizalofop, either standalone or in mixture with clethodim, in population 172-20 was lower under cooler growing conditions. Target-site resistance to ACCase-inhibiting herbicides, conferred by one ACCase mutation, was selected in all tested brome plants infesting a field with a history of repeated clethodim use. This mutation appears to have been fixed in the infesting population. Notably, clethodim resistance in this population was not detected by the farmer, and a high future incidence of quizalofop resistance is anticipated. Herbicide resistance testing is essential for the detection of evolving weed resistance issues and to inform effective management strategies. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Influence of the sowing method and seeding rate on the formation of agrocenosis and seed yield of awnless brome

The development of science-based technologies of cultivation makes it possible to reveal the productive potential of new varieties of perennial grasses. In 2021-2022 in the conditions of the Penza region, there were studied the seeding rates and methods of sowing of a new variety of awnless brome Udalets when cultivated for seed. According to the hydrothermalcoefficient, the growing season of 2021 was characterized as dry (HTC = 0.8), 2022 – as normal in terms of moisture supply (HTC = 1.0). The best indicators of the development of brome plants (mass of plants and roots) by the end of the first year of life were obtained using a wide-row sowing method with row spacing of 30 cm at a seeding rate of 5.0 million viable seeds per 1 ha. In terms of the yield of green mass and the collection of dry matter from 1 m2 in the first year of life, the wide-row sowing method with a row spacing of 30 cm had an advantage. During the year of awnless brome grass use the best indicators of seed yield were obtained by wide-row sowing method with row spacing of 30 cm at a seeding rate of 5.0 million viable seeds per 1 ha. At the same time, the number of productive stems was 106 pcs/m2, the length of the inflorescence was 19.0 cm, the number of spikelets in the inflorescence was 182 pcs., the weight of seeds from a productive shoot was 0.78 g, the weight of 1000 seeds was 4.26 g, which was 8.2; 8.0; 11.0; 13.0; 0.9 %, respectively, higher than the control variant with a row sowing method with row spacing of 15 cm at a seeding rate of 6.0 million viable seeds per 1 ha. The highest seed yield of awnless brome in the first year of use was formed with a wide-row sowing method with row spacing of 30 cm at a seeding rate of 5.0 million viable seeds per 1 ha (824 kg/ha), the increase over the control was 146 kg/ha, or 21.5 %. By a row method of sowing with row spacing of 15 cm, a high yield was obtained in the control variant (6 million viable seeds/ha) – 678 kg/ha. With a seeding rate of 5.0 million germinating seeds per 1 ha, the seed yield decreased by 7.6 %.

Consequences of Rainfall Manipulations for Invasive Annual Grasses Vary Across Grazed Northern Mixed-Grass Prairie Sites

Northern mixed-grass prairie rangelands are threatened by increasing drought severity and invasion by annual grasses. However, it is unclear whether climate change will amplify or dampen this invasion. We tested separate and combined effects of livestock grazing and experimental rainfall manipulation on invasion by annual brome grasses—cheatgrass (Bromus tectorum L.) and field brome (Bromus arvensis L.)—in two mixed-grass prairie sites (Montana and Wyoming, United States). To provide management-relevant results, we manipulated precipitation at five levels representing a gradient of precipitation reduction and implemented grazing strategies selected by stakeholders to represent realistic management choices: destock, stable, and heavy grazing scenarios. We measured soil moisture and three plant properties of invasive annual bromes (aboveground primary production, percent greenness, and percent cover) during two water manipulation yr (2019, 2020) and one recovery yr of natural rainfall (2021).Imposed precipitation reduction generally decreased absolute annual brome biomass and induced earlier senescence. However, during the recovery year, we observed prolonged time to senescence in the formerly droughted plots. In Wyoming, summer grazing had little appreciable effect on annual bromes, perhaps because annual bromes mature early in the growing season (mid-June) and may therefore be less affected by summer grazing. However, in the first year after ending water treatments during a natural drought in Montana, under heavy grazing, annual brome production marginally increased from 32.4 ± 10.6 kg · ha−1 to 130.8 ± 111.8 kg · ha−1 (mean ± standard error) with prior severe precipitation reduction. The magnitude of responses tended to be site dependent, which may be due to inherent vegetation differences between our sites, as well as site-scale differences in natural precipitation patterns. Together, these results suggest that annual brome abundance may increase in the context of drought combined with heavy grazing, a more likely scenario with continuing climate change.

Short-term Effects of Indaziflam on Non-native Brome Grass (Bromus spp.), Biological Soil Crusts, and the Endangered Dwarf Bear Poppy (Arctomecon humilis)

Controlling invasive annual grasses is one of the top conservation priorities in the American West. Brome (Bromus spp.) has more recently invaded areas of White Dome Nature Preserve, a conservancy for endemic and endangered or threatened plants in Washington County, Utah, United States, where the use of herbicides could be effective in managing invasion. Ideal habitat for these plants is on gypsiferous soils that are largely associated with biological soil crusts. Intact biological soil crusts are important in a biological communities' ability to resist invasion by annual grasses and are critical for nutrient cycling. However, there is a lack of research on how herbicides affect biological soil crusts and specific rare plant species that are of high conservation priority. We found that indaziflam (Rejuvra, Bayer CropScience, Monheim am Rhein, Germany), applied as a preemergent, was effective at reducing brome density the first growing season after application. Indaziflam also did not initially injure the biological soil crusts. Indaziflam is reported to have multiyear effects of reducing annual grasses, which makes indaziflam a promising herbicide for conservation purposes in areas where the invasive species seed bank needs to be depleted with as little disturbance to biocrusts as possible.

Frequency of herbicide resistance in wild oats (Avena spp.), brome grass (Bromus spp.) and barley grass (Hordeum spp.) as determined by random surveys across south-eastern Australia

Context Wild oats (Avena spp.), brome grass (Bromus spp.) and barley grass (Hordeum spp.) are significant grass weeds of crop production in south-eastern Australia. The presence of herbicide resistance in these weed species is a major limiting factor on both productivity and profitability. Aims We aimed to determine the distribution of herbicide resistance in these weed species across south-eastern Australia. Methods Several surveys were conducted in randomly selected fields across four states in south-eastern Australia over a 5-year period, collecting 663 wild oats, 366 brome grass and 262 barley grass samples that were screened for resistance with up to five different herbicide groups or subgroups. Key results In wild oats, resistance was most common to clodinafop-propargyl (‘fop’ ACCase inhibitor), with 22% of samples resistant and resistance detected in all regions except Tasmania. Resistance to sulfonylurea herbicides (ALS inhibitors) was less common with 7% of samples resistant, but regionally more variable. For both brome grass and barley grass, a greater proportion of samples was resistant to the sulfonylurea mesosulfuron-methyl, at 24% and 19%, respectively, than to quizalofop-ethyl (‘fop’ ACCase inhibitor). Conclusions Resistance was recorded in all three species, with differences in the extent of resistance among herbicide groups and regions. Overall, a higher than average frequency of wild oats resistance to clodinafop-propargyl was found in regions of New South Wales and of brome grass and barley grass resistance to mesosulfuron-methyl in regions of South Australia. However, for all species some herbicides were still effective on all samples. Implications The presence of significant herbicide resistance in these weed species indicates that management decisions need to include consideration of resistance to enable successful control measures.

Evaluation of harvest time effects on the combustion quality of warm- and cool-season perennial grasses in two contrasting semi-arid environments

In order to achieve economically viable and sustainable solid biofuel production from perennial grasses, high biomass productivity must be complemented by good combustion quality. The aim of this research was to compare the combustion quality of 7 cool-season perennial grasses, comprising bulbous canary grass, reed canary grass, smooth brome grass, orchard grass, tall wheatgrass, tall fescue, and perennial ryegrass, and 3 warm-season perennial grasses, comprising switchgrass, miscanthus, and giant reed, over 2 harvest times (autumn, winter/early spring) in 2 contrasting semi-arid environments (Adana, and Cankiri, Turkey). Delaying the harvest from the autumn to the winter or the spring significantly increased the lignin contents of each of the 3 warm-season grasses and generally decreased the contents of all of the minerals, except for Al and Fe, in miscanthus and switchgrass, and K and Na in giant reed, at both locations. Similar trends were also generally observed for all of the cool-season grasses, except for the orchard grass that was grown in Cankiri. Additionally, delayed harvest resulted in lower slagging tendency and sintering risk in all of the perennial grass species, except for giant reed in Cankiri. However, the autumn harvest caused significantly higher lignin, but generally lower N, P, K, Ca, S, Si, Al, and Fe contents, slagging tendency, and sintering risk in most of the cool-season grasses that were grown in Adana. On the other hand, despite the autumn harvest in Adana, and the spring harvest in Cankiri provided a substantial improvement in combustion quality of the cool-season grasses, mainly due to the reduced mineral and increased lignin contents, they still exhibited relatively lower combustion quality than miscanthus and switchgrass, especially in Adana. These results showed that further effort is needed to improve the combustion quality of cool-season grasses in order for them to be primary biomass feedstock alternatives for dry marginal lands of semi-arid environments.

Brome grasses represent the primary source of Claviceps purpurea inoculum associated with barley fields in the San Luis Valley of Colorado

The fungal pathogen Claviceps purpurea can infect numerous grass species including important crops like barley, rye, and wheat, but the ecology of ergot disease is rarely studied in non-crop grass species. Recent outbreaks of ergot in barley production systems in the western U.S. have implicated nearby grass hosts as reservoirs for inoculum and spread of C. purpurea into the barley crop. We surveyed the prevalence of ergot infections among native, invasive, and weedy grass species near barley fields in the San Luis Valley of Colorado over three years. We found that barley fields with a history of ergot disease were surrounded by a grass community composed largely of smooth brome, that smooth brome was very susceptible to ergot infection and had the highest infection rates among grass species, and that disease severity among the grass community increased during the growing season. Over the study period there was a low incidence of barley infections and this precluded analyzing the effects unmanaged grass composition and disease incidence had on within field disease incidence. Our findings indicate that smooth brome represents a significant source of C. purpurea inoculum and inoculum levels increase as the composition of brome grass in the grass community increases. There is sufficient inoculum present in the brome grass population in the San Luis Valley to cause sporadic disease in barley fields when environmental conditions are optimal for infection. Future disease management strategies should take into account the large pool of inoculum in the grass population near barley production fields.