Transgenic Soybean Research Articles

Molecular Characterization and Drought Resistance of GmNAC3 Transcription Factor in Glycine max (L.) Merr.

Soybean transcription factor GmNAC plays important roles in plant resistance to environmental stresses. In this study, GmNAC3 was cloned in the drought tolerant soybean variety “Jiyu47”, with the molecular properties of GmNAC3 characterized to establish its candidacy as a NAC transcription factor. The yeast self-activation experiments revealed the transcriptional activation activity of GmNAC3, which was localized in the nucleus by the subcellular localization analysis. The highest expression of GmNAC3 was detected in roots in the podding stage of soybean, and in roots of soybean seedlings treated with 20% PEG6000 for 12 h, which was 16 times higher compared with the control. In the transgenic soybean hairy roots obtained by the Agrobacterium-mediated method treated with 20% PEG6000 for 12 h, the activities of superoxide dismutase, peroxidase, and catalase and the content of proline were increased, the malondialdehyde content was decreased, and the expressions of stress resistance-related genes (i.e., APX2, LEA14, 6PGDH, and P5CS) were up-regulated. These expression patterns were confirmed by transgenic Arabidopsis thaliana with the overexpression of GmNAC3. This study provided strong scientific evidence to support further investigation of the regulatory function of GmNAC3 in plant drought resistance and the molecular mechanisms regulating the plant response to environmental stresses.

Engineering crop Phytophthora resistance by targeting pathogen-derived PI3P for enhanced catabolism

Phytophthora pathogens lead to numerous economically damaging plant diseases worldwide, including potato late blight caused by P. infestans and soybean root rot caused by P. sojae. Our previous work showed that Phytophthora pathogens may generate abundant phosphatidylinositol 3-phosphate (PI3P) to promote infection via direct association with RxLR effectors. Here, we designed a disease control strategy for metabolizing pathogen-derived PI3P by expressing secreted Arabidopsis thaliana phosphatidylinositol-4-phosphate 5-kinase 1 (AtPIP5K1), which can phosphorylate PI3P to PI(3,4)P2. We fused AtPIP5K1 with the soybean PR1a signal peptide (SP-PIP5K1) to enable its secretion into the plant apoplast. Transgenic soybean and potato plants expressing SP-PIP5K1 showed substantially enhanced resistance to various P. sojae and P. infestans isolates, respectively. SP-PIP5K1 significantly reduced PI3P accumulation during P. sojae and soybean interaction. Knockout or inhibition of PI3 kinases (PI3Ks) in P. sojae compromised the resistance mediated by SP-PIP5K1, indicating that SP-PIP5K1 action requires a supply of pathogen-derived PI3P. Furthermore, we revealed that SP-PIP5K1 can interfere with the action of P. sojae mediated by the RxLR effector Avr1k. This novel disease control strategy has the potential to confer durable broad-spectrum Phytophthora resistance in plants through a clear mechanism in which catabolism of PI3P interferes with RxLR effector actions.

Resistance of Cabbage Loopers to Bacillus thuringiensis (Bt) Toxin Cry1F and to Dual-Bt Toxin WideStrike Cotton Plants.

The Cry proteins from Bacillus thuringiensis (Bt) are major insecticidal toxins in formulated Bt sprays and are expressed in genetically engineered Bt crops for insect pest control. However, the widespread application of Bt toxins in the field imposes strong selection pressure on target insects, leading to the evolution of insect resistance to the Bt toxins. Identification and understanding of mechanisms of insect resistance to Bt toxins are an important approach for dissecting the modes of action of Bt toxins and providing knowledge necessary for the development of resistance management technologies. In this study, cabbage looper (Trichoplusia ni) strains resistant to the transgenic dual-Bt toxin WideStrike cotton plants, which express Bt toxins Cry1Ac and Cry1F, were selected from T. ni strains resistant to the Bt formulation Bt-DiPel. The WideStrike-resistant T. ni larvae were confirmed to be resistant to both Bt toxins Cry1Ac and Cry1F. From the WideStrike-resistant T. ni, the Cry1F resistance trait was further isolated to establish a T. ni strain resistant to Cry1F only. The levels of Cry1F resistance in the WideStrike-resistant and the Cry1F-resistant strains were determined, and the inheritance of the Cry1F-resistant trait in the two strains was characterized. Genetic association analysis of the Cry1F resistance trait indicated that the Cry1F resistance in T. ni isolated in this study is not shared with the Cry1Ac resistance mechanism nor is it associated with a mutation in the ABCC2 gene, as has so far been reported in Cry1F-resistant insects. IMPORTANCE Insecticidal toxins from Bacillus thuringiensis (Bt) are highly effective for insect control in agriculture. However, the widespread application of Bt toxins exerts strong selection for Bt resistance in insect populations. The continuing success of Bt biotechnology for pest control requires the identification of resistance and understanding of the mechanisms of resistance to Bt toxins. Cry1F is an important Bt toxin used in transgenic cotton, maize, and soybean varieties adopted widely for insect control. To understand the mode of action of Cry1F and mechanisms of Cry1F resistance in insects, it is important to identify Cry1F-specific resistance and the resistance mechanisms. In this study, Trichoplusia ni strains resistant to commercial "WideStrike" cotton plants that express Bt toxins Cry1Ac and Cry1F were selected, and a Cry1F-specific resistant strain was isolated. The isolation of the novel Cry1F-specific resistance in the T. ni provided an invaluable biological system to discover a Cry1F-specific novel resistance mechanism.

Herbicide control of Ambrosia artemisiifolia in sunflower, soybean and maize

Abstract Ambrosia artemisiifolia L. (Asteraceae) has become a major threat to agriculture in many parts of the world. Global agriculture relies on the use of herbicides against A. artemisiifolia in the crops most at risk – sunflower, maize and soybean. This paper aims to provide an overview of the chemical control of A. artemisiifolia and to summarize the latest knowledge in this field. The sunflower is the crop most threatened by A. artemisiifolia, as both plants belong to the same family. The best control level was achieved after the preemergence application of flurochloridone and the combination of dimethenamid-P + pendimethalin. The introduction of the non-GM Clearfield and ExpressSun technologies allowed effective control with postemergence herbicides in sunflower varieties tolerant to imidazolinone and tribenuron-methyl herbicides. In soybean, the highest efficacy was observed in trials with imazamox and bentazone alone and in combination. The combination of imazamox with bentazone had a positive effect on yield compared to untreated stands. The introduction of transgenic soybeans tolerant to glyphosate led to increased glyphosate use and the predictable emergence of weed resistance in America in 1996. Preplant followed by postemergence herbicides were critical for the effective control of glyphosate-resistant A. artemisiifolia in glufosinate tolerant soybean. In maize, the highest efficacy was obtained after the application of glufosinate, bromoxynil and mesotrione + atrazine. Of the above substances for the control of A. artemisiifolia in maize, only mesotrione is currently registered in the EU.

Development and Interlaboratory Validation of a Novel Reproducible Qualitative Method for GM Soybeans Using Comparative Cq-Based Analysis for the Revised Non-GMO Labeling System in Japan.

Many countries have implemented the labeling system of genetically modified organisms (GMO). In Japan, the regulatory threshold for non-GMO labeling will be revised and restricted to undetectable by April 2023. The practical criterion for the revised system is based on the limit of detection (LOD). However, determining whether the commingling of GMO levels exceeds the LOD is challenging because GM contents close to the LOD are usually below the limit of quantification. In this study, we developed a qualitative method based on comparative Cq-based analysis targeting cauliflower mosaic virus 35S promoter and GM soybean MON89788 event-specific sequences that could be applicable to the revised non-GMO labeling. ΔCq values between the target and endogenous sequences were calculated, and the ΔΔCq value obtained was used as a criterion to determine analytical samples with GM contents exceeding the threshold. To improve the reproducibility of the method, we used a standard plasmid that yields equivalent and stable ΔCq values comparable with those obtained from LOD samples. The developed method was validated with an interlaboratory study. The new qualitative detection concept would be useful for ensuring robust and reproducible results among laboratories, particularly for detecting low-copy-number DNA samples.

Conflicts Between Neighbors: Viticulturists and Soybean Farmers at the Pampa Biome – RS, Brazil

The Pampa Biome represented in last four centuries a specialization in cattle production, with high historical, socioeconomic, and cultural similarities between Argentina, Brazil, and Uruguay, the countries that share the same Biome. However, from the twentieth century onward the scenario changed. Agriculture and forestry, because of the higher and faster financial returns are now the most important in socio and economic levels. From 2000 onward, a movement of expansion in Brazilian viticulture has highlighted new potential borders, in this case, replacing natural pastures in the Pampa Biome. The significant growth of grapevine area can be illustrated by the doubled surface, reaching 1560 hectares, and the number of vineyards grew from 7 to more than a 100. In 2010 it was created the association “Vinhos da Campanha” to represent the region, to structure the geographical indication and to improve the visibility of this terroir and their physical and environmental conditions. However, viticulturists did not expect a huge threat to their vineyards. In the seven past years, the 2,4-D based herbicides spread over transgenic soybean plants cultivated nearby vineyards is causing the decrease of fruit production, presence of herbicide residue in harvested fruit, killing parts or even the entire vineyards: all damages representing monetary losses. Finally, due to the losses and the underway lawsuits, the community cohesion has been broken apart: viticulturists increased cohesion and union among themselves, but social cohesion between them and soybean growers no longer exist in several areas of Rio Grande do Sul state. Later on similar scenario reached other Brazilian States and other fruit species.

GmPAO-mediated polyamine catabolism enhances soybean Phytophthora resistance without growth penalty

Plant immunity is activated upon perception of pathogens and often affects growth when it is constitutively active. It is still a challenge to balance plant immunity and growth in disease resistance breeding. Here, we demonstrated that soybean (Glycine max) polyamine oxidase (GmPAO) confers resistance to multiple Phytophthora pathogens, but has no obvious adverse impact on agronomic traits. GmPAO produces H2O2 by oxidizing spermidine and spermine. Phytophthora sojae induces an increase in these two substrates, and thus promotes GmPAO-mediated polyamine catabolism specifically during infection. Interestingly, we found that the two substrates showed higher accumulation in transgenic soybean lines overexpressing GmPAO than in WT and CK after inoculation with P. sojae to ensure H2O2 production during infection, rather than directly inhibit P. sojae. In these transgenic soybean plants, the significantly enhanced resistance to different P. sojae isolates was achieved; PAMP-induced H2O2 accumulation was enhanced by GmPAO overexpression. Moreover, transient expression of GmPAO also significantly improved Nicotiana benthamiana resistance to Phytophthora capsici and Phytophthora parasitica in agroinfiltration assays. Our results provide a novel approach to allow rapid defense responses in plants upon pathogen infection while minimizing growth penalties under normal conditions, with a clear mechanism in which plant promotes H2O2 production via pathogen-activated substrates.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Impacts of soybean agriculture on the resistome of the Amazonian soil.

The soils of the Amazon are complex environments with different organisms cohabiting in continuous adaptation processes; this changes significantly when these environments are modified for the development of agricultural activities that alter the chemical, macro, and microbiological compositions. The metagenomic variations and the levels of the environmental impact of four different soil samples from the Amazon region were evaluated, emphasizing the resistome. Soil samples from the organic phase from the different forest, pasture, and transgenic soybean monocultures of 2–14 years old were collected in triplicate at each site. The samples were divided into two groups, and one group was pre-treated to obtain genetic material to perform sequencing for metagenomic analysis; another group carried out the chemical characterization of the soil, determining the pH, the content of cations, and heavy metals; these were carried out in addition to identifying with different databases the components of the microbiological communities, functional genes, antibiotic and biocide resistance genes. A greater diversity of antibiotic resistance genes was observed in the forest soil. In contrast, in monoculture soils, a large number of biocide resistance genes were evidenced, highlighting the diversity and abundance of crop soils, which showed better resistance to heavy metals than other compounds, with a possible dominance of resistance to iron due to the presence of the acn gene. For up to 600 different genes for resistance to antibiotics and 256 genes for biocides were identified, most of which were for heavy metals. The most prevalent was resistance to tetracycline, cephalosporin, penam, fluoroquinolone, chloramphenicol, carbapenem, macrolide, and aminoglycoside, providing evidence for the co-selection of these resistance genes in different soils. Furthermore, the influence of vegetation cover on the forest floor was notable as a protective factor against the impact of human contamination. Regarding chemical characterization, the presence of heavy metals, different stress response mechanisms in monoculture soils, and the abundance of mobile genetic elements in crop and pasture soils stand out. The elimination of the forest increases the diversity of genes for resistance to biocides, favoring the selection of genes for resistance to antibiotics in soils.

Functional characterization of the pUceS8.3 promoter and its potential use for ectopic gene overexpression.

The pUceS8.3 is a constitutive gene promoter with potential for ectopic and strong genes overexpression or active biomolecules in plant tissues attacked by pests, including nematode-induced giant cells or galls. Soybean (Glycine max) is one of the most important agricultural commodities worldwide and a major protein and oil source. Herein, we identified the soybean ubiquitin-conjugating (E2) enzyme gene (GmUBC4; Glyma.18G216000), which is significantly upregulated in response to Anticarsia gemmatalis attack and Meloidogyne incognita-induced galls during plant parasitism by plant nematode. The GmUBC4 promoter sequence and its different modules were functionally characterized in silico and in planta using transgenic Arabidopsis thaliana and G. max lines. Its full-length transcriptional regulatory region (promoter and 5´-UTR sequences, named pUceS8.3 promoter) was able to drive higher levels of uidA (β-glucuronidase) gene expression in different tissues of transgenic A. thaliana lines compared to its three shortened modules and the p35SdAMV promoter. Notably, higher β-glucuronidase (GUS) enzymatic activity was shown in M. incognita-induced giant cells when the full pUceS8.3 promoter drove the expression ofthis reporter gene. Furthermore, nematode-specific dsRNA molecules were successfully overexpressed under the control of the pUceS8.3 promoter in transgenic soybean lines. The RNAi gene construct used here was designed to post-transcriptionally downregulate the previously characterized pre-mRNA splicing factor genes from Heterodera glycines and M. incognita. A total of six transgenic soybean lines containing RNAi gene construct were selected for molecular characterization after infection with M. incognita pre-parasitic second-stage (ppJ2) nematodes. A strong reduction in the egg number produced by M. incognita after parasitism was observed in those transgenic soybean lines, ranging from 71 to 92% compared to wild-type control plants. The present data demonstrated that pUceS8.3 is a gene promoter capable of effectively driving dsRNA overexpression in nematode-induced giant cells of transgenic soybean lines and can be successfully applied as an important biotechnological asset to generate transgenic crops with improved resistance to root-knot nematodes as well as other pests.

The effect of adjacent double-strand DNA on the G-triplex-ThT complex fluorescence intensity enhancement and its application in TNOS and Hg2+ detection

In this paper, we have found that adjacent double-strand DNA (dsDNA) can enhance the fluorescence intensity of the G-triplex (G31)-thioflavin T (ThT) complex. By connecting the newly formed dsDNA with the G31 sequence, terminator nopaline synthase (TNOS) gene and Hg2+ were detected. The intermolecular duplex hybridization (e.g., TNOS gene and its complementary DNA), or the intramolecular mismatched thymine (T)-Hg2+-T pairs induced the formation of dsDNA with planar morphology, which resulted in the increased binding capacity of adjacent G31 to ThT, as well as the enhanced fluorescence intensity of G31-ThT complex. A versatile ‘turn-on’ fluorescence scaffold was developed for discriminating transgenic and non-transgenic soybeans and detecting Hg2+ in lake water.

Shoot-to-root translocated GmNN1/FT2a triggers nodulation and regulates soybean nitrogen nutrition.

Symbiotic nitrogen fixation (SNF) provides sufficient nitrogen (N) to meet most legume nutrition demands. In return, host plants feed symbionts carbohydrates produced in shoots. However, the molecular dialogue between shoots and symbionts remains largely mysterious. Here, we report the map-based cloning and characterization of a natural variation in GmNN1, the ortholog of Arabidopsis thaliana FLOWERING LOCUS T (FT2a) that simultaneously triggers nodulation in soybean and modulates leaf N nutrition. A 43-bp insertion in the promoter region of GmNN1/FT2a significantly decreased its transcription level and yielded N deficiency phenotypes. Manipulating GmNN1/GmFT2a significantly enhanced soybean nodulation, plant growth, and N nutrition. The near-isogenic lines (NILs) carrying low mRNA abundance alleles of GmNN1/FT2a, along with stable transgenic soybeans with CRISPR/Cas9 knockouts of GmNN1/FT2a, had yellower leaves, lower N concentrations, and fewer nodules than wild-type control plants. Grafting together with split-root experiments demonstrated that only shoot GmNN1/FT2a was responsible for regulating nodulation and thereby N nutrition through shoot-to-root translocation, and this process depends on rhizobial infection. After translocating into roots, shoot-derived GmNN1/FT2a was found to interact with GmNFYA-C (nuclear factor-Y subunit A-C) to activate symbiotic signaling through the previously reported GmNFYA-C-ENOD40 module. In short, the description of the critical soybean nodulation regulatory pathway outlined herein sheds novel insights into the shoot-to-root signaling required for communications between host plants and root nodulating symbionts.

See the color, see the seed: GmW1 as a visual reporter for transgene and genome editing in soybean

A fast and efficient recognition method of transgenic lines will greatly improve detection efficiency and reduce cost. In this study, we successfully identified the transgenic soybean plants by the color. We isolated a GmW1 gene encoding a flavonoid 3′5′-hydroxylase from a soybean cultivar ZH42 (purple flower). We found that purple flowers occurred in the overexpression lines in the Jack and Williams 82 backgrounds (white flower). All plants with purple flowers were positive, and this trait seems stably inherited in the offspring. We have also obtained the editing plants, which were classified into three types according to the different flower colors appeared. We analyzed the phenotype and the homozygous types of the T1 mutants. We also found that a correspondence between flower color and stem color. This study provides a visible color reporter on soybean transformation. It can be quickly and early to identify the transgenic soybean plants by stem color of seedlings, which substantially reduces the amount of labor and cost.

The AP2/ERF GmERF113 Positively Regulates the Drought Response by Activating GmPR10-1 in Soybean.

Ethylene response factors (ERFs) are involved in biotic and abiotic stress; however, the drought resistance mechanisms of many ERFs in soybeans have not been resolved. Previously, we proved that GmERF113 enhances resistance to the pathogen Phytophthora sojae in soybean. Here, we determined that GmERF113 is induced by 20% PEG-6000. Compared to the wild-type plants, soybean plants overexpressing GmERF113 (GmERF113-OE) displayed increased drought tolerance which was characterized by milder leaf wilting, less water loss from detached leaves, smaller stomatal aperture, lower Malondialdehyde (MDA) content, increased proline accumulation, and higher Superoxide dismutase (SOD) and Peroxidase (POD) activities under drought stress, whereas plants with GmERF113 silenced through RNA interference were the opposite. Chromatin immunoprecipitation and dual effector-reporter assays showed that GmERF113 binds to the GCC-box in the GmPR10-1 promoter, activating GmPR10-1 expression directly. Overexpressing GmPR10-1 improved drought resistance in the composite soybean plants with transgenic hairy roots. RNA-seq analysis revealed that GmERF113 downregulates abscisic acid 8′-hydroxylase 3 (GmABA8’-OH 3) and upregulates various drought-related genes. Overexpressing GmERF113 and GmPR10-1 increased the abscisic acid (ABA) content and reduced the expression of GmABA8’-OH3 in transgenic soybean plants and hairy roots, respectively. These results reveal that the GmERF113-GmPR10-1 pathway improves drought resistance and affects the ABA content in soybean, providing a theoretical basis for the molecular breeding of drought-tolerant soybean.

N7 -SSPP fusion gene improves salt stress tolerance in transgenic Arabidopsis and soybean through ROS scavenging.

Considerable signal crosstalk exists in the regulatory network of senescence and stress response. Numerous senescence-associated genes are also involved in plant stress tolerance. However, the underlying mechanisms and application potential of these genes in stress-tolerant crop breeding remain poorly explored. We found that overexpression of SENESCENCE-SUPPRESSED PROTEIN PHOSPHATASE (SSPP), a negative regulator of leaf senescence, significantly improved plant salt tolerance by increasing reactive oxygen species (ROS) scavenging in both Arabidopsis and soybean. However, overexpression of SSPP severely suppressed normal plant growth, limiting its direct use in agriculture. We previously revealed that the N-terminal 1-14 residues of ACS7 (termed 'N7 ') negatively regulated its protein stability through the ubiquitin/proteasome pathway, and the N7 -mediated protein degradation was suppressed by environmental and senescence signals. To avoid the adverse effects of SSPP, the N7 element was fused to the N-terminus of SSPP. We demonstrated that N7 -SSPP fusion gene effectively rescued SSPP-induced growth suppression but maintained enhanced salt tolerance in Arabidopsis and soybean. Particularly, N7 -SSPP enhanced tolerance to long-term salt stress and increased seed yield in soybean. These results suggest that N7 -SSPP overcomes the disadvantages of SSPP on plant growth inhibition and effectively improves salt tolerance through enhanced ROS scavenging, providing an effective strategy of using posttranslational regulatory element for salt-tolerant crop breeding.

Overexpression of GsCNGC20-f from Glycine soja confers submergence tolerance to hairy-root composite soybean plants and Arabidopsis seedlings by enhancing anaerobic respiration

Cyclic nucleotide-gated channels (CNGCs) in plants are nonselective Ca 2+ -permeable cationic channel proteins, that are part of the signal transduction cascade system and are involved in the physiological regulation of plant responses to adverse environments. This study firstly showed that the stronger submergence tolerance of G. soja P18B seedlings compared to the G. max cultivar KF1, might be related to the enhanced processes of Ca 2+ signal cascade (higher Ca 2+ content), anaerobic metabolism (higher activities of PDC and ADH), and energy reserves (higher ATP level) in the leaves during submergence. Then, the potential submergence-responsive differentially expressed genes (DEGs) enriched in voltage-gated potassium channel activity, such as GsCNGC20-f and GsCNGC20-g , and those enriched in calcium ion binding, i.e. GsCaML, GsCAM4, GsCML41, and GsCML45 were identified through leaf transcriptomic analysis of P18B and KF1 under submergence. The qRT-PCR, tobacco leaf transient expression and GUS staining displayed a more obviously induced upregulation of GsCNGC20-f and GsCNGC20-g by submergence stress. BiFC and Y2H assays showed that plasma membrane-located GsCNGC-f could interact with GsCaM4 or GsCaML. Finally, overexpression of GsCNGC20-f could alleviate submergence injury in hairy-root composite soybean plants or transgenic Arabidopsis seedlings by maintaining a higher content of Ca 2+ and activities of PDC and ADH (associated with upregulated gene expression of PDCs and ADHs ), and thereafter enhancing ATP levels in the leaves via improved anaerobic respiration under hypoxic conditions. The functions of GsCNGC20-f involving in the adaptation and survival of G. soja P18B seedlings under submergence stress can provide new perspectives for the molecular breeding of flooding-tolerant soybeans or other crops. • Two potential CNGC genes, GsCNGC20-f and GsCNGC20-g, were identified from the submergence-tolerant G. soja accession (P18B). • The plasma membrane-located GsCNGC-f could interact with GsCaM4 or GsCaML. • GsCNGC20-f could alleviate submergence stress on transgenic soybean or Arabidopsis plants by enhancing anaerobic respiration.

Transgenic Soybeans Expressing Phosphatidylinositol-3-Phosphate-Binding Proteins Show Enhanced Resistance Against the Oomycete Pathogen Phytophthora sojae

Oomycete and fungal pathogens cause billions of dollars of damage to crops worldwide annually. Therefore, there remains a need for broad-spectrum resistance genes, especially ones that target pathogens but do not interfere with colonization by beneficial microbes. Motivated by evidence suggesting that phosphatidylinositol-3-phosphate (PI3P) may be involved in the delivery of some oomycete and fungal virulence effector proteins, we created stable transgenic soybean plants that express and secrete two different PI3P-binding proteins, GmPH1 and VAM7, in an effort to interfere with effector delivery and confer resistance. Soybean plants expressing the two PI3P-binding proteins exhibited reduced infection by the oomycete pathogen Phytophthora sojae compared to control lines. Measurements of nodulation by nitrogen-fixing mutualistic bacterium Bradyrhizobium japonicum, which does not produce PI3P, revealed that the two lines with the highest levels of GmPH1 transcripts exhibited reductions in nodulation and in benefits from nodulation. Transcriptome and plant hormone measurements were made of soybean lines with the highest transcript levels of GmPH1 and VAM7, as well as controls, following P. sojae- or mock-inoculation. The results revealed increased levels of infection-associated transcripts in the transgenic lines, compared to controls, even prior to P. sojae infection, suggesting that the plants were primed for increased defense. The lines with reduced nodulation exhibited elevated levels of jasmonate-isoleucine and of transcripts of a JAR1 ortholog encoding jasmonate-isoleucine synthetase. However, lines expressing VAM7 transgenes exhibited normal nodulation and no increases in jasmonate-isoleucine. Overall, together with previously published data from cacao and from P. sojae transformants, the data suggest that secretion of PI3P-binding proteins may confer disease resistance through a variety of mechanisms.

Monitoring of Infant Formula and Baby Food for the Pat and NOS Terminator of Genetically Modified Maize and Soybean by Real-time PCR in Iran.

BackgroundSoybean and maize are the most cultivated genetically modified (GM) plants. Because of the increase in the imports of GM products to Iran, infant formula and baby food, which is consumed by babies during their first month of life, can also contain soybean and maize. It has become fundamental to screen these types of products.ObjectivesThe present study aimed to investigate the GM corn and soybean in baby food and infant formula using real-time polymerase chain reaction (PCR).MethodsA total of 60 baby food and infant formulas were collected randomly from the local drugstores in Tehran. Genomic DNA was extracted from all samples, then by real-time PCR detection, tested Pat/NOS. Internal control genes zein and lectin were used for maize and soybean, respectively.ResultsResults showed that 5% of infant formulas and 5% of baby food, two Iranian and one imported baby food, and two imported and one Iranian infant formula were positive for pat. However, NOS was detected in none of the samples. The results showed positive results for the presence of the pat gene in the products without an appropriate label.ConclusionsThis article provides evidence of GM maize and soybean presence in baby food and infant formula in Iran.

Fitness and Ecological Risk of Hybrid Progenies of Wild and Herbicide-Tolerant Soybeans With EPSPS Gene.

Exogenous genes of transgenic crops are usually transferred to their wild-type relatives through pollen-mediated gene flow, which may change the ecological fitness and ability to invade wild populations, resulting in the weeding of wild plants and other unpredictable environmental impacts. In this study, the F1 generation of herbicide-resistant soybeans and wild soybeans was obtained by artificial pollination, F2 generation seeds were obtained by self-crossing, and the fitness of the parents and their F1 and F2 generations were tested. The foreign protein EPSPS was expressed normally in the hybrid between transgenic and wild soybeans; however, the protein expression was significantly lower than that in transgenic soybeans. The fitness of the F1 hybrid between transgenic and wild soybeans was significantly lower than that of its parent. Compared with those of the wild soybeans, the F2 generation soybeans improved in some fitness indices, while the emergence rate, pollen germination rate, and number of full seeds per pod, pods per plant, and full seeds per plant did not significantly differ. The aboveground biomass and 100-seed weight of the F2 generation were higher than those of wild soybeans. Fitness among the F2-negative plants, homozygous, and heterozygous positive plants did not significantly vary. Improved fitness and presence of foreign genes in the F2 soybean were not significantly correlated. As the F2 generation of transgenic and wild soybeans had no fitness cost and the flowering stage were overlapped, the foreign gene might still spread in the wild soybean population.

Progress in Soybean Genetic Transformation Over the Last Decade.

Soybean is one of the important food, feed, and biofuel crops in the world. Soybean genome modification by genetic transformation has been carried out for trait improvement for more than 4 decades. However, compared to other major crops such as rice, soybean is still recalcitrant to genetic transformation, and transgenic soybean production has been hampered by limitations such as low transformation efficiency and genotype specificity, and prolonged and tedious protocols. The primary goal in soybean transformation over the last decade is to achieve high efficiency and genotype flexibility. Soybean transformation has been improved by modifying tissue culture conditions such as selection of explant types, adjustment of culture medium components and choice of selection reagents, as well as better understanding the transformation mechanisms of specific approaches such as Agrobacterium infection. Transgenesis-based breeding of soybean varieties with new traits is now possible by development of improved protocols. In this review, we summarize the developments in soybean genetic transformation to date, especially focusing on the progress made using Agrobacterium-mediated methods and biolistic methods over the past decade. We also discuss current challenges and future directions.