Generation Of Double-strand Breaks Research Articles

Gene conversion causing human inherited disease: Evidence for involvement of non-B-DNA-forming sequences and recombination-promoting motifs in DNA breakage and repair

A variety of DNA sequence motifs including inverted repeats, minisatellites, and the chi recombination hotspot, have been reported in association with gene conversion in human genes causing inherited disease. However, no methodical statistically based analysis has been performed to formalize these observations. We have performed an in silico analysis of the DNA sequence tracts involved in 27 nonoverlapping gene conversion events in 19 different genes reported in the context of inherited disease. We found that gene conversion events tend to occur within (C+G)- and CpG-rich regions and that sequences with the potential to form non-B-DNA structures, and which may be involved in the generation of double-strand breaks that could, in turn, serve to promote gene conversion, occur disproportionately within maximal converted tracts and/or short flanking regions. Maximal converted tracts were also found to be enriched (P<0.01) in a truncated version of the chi-element (a TGGTGG motif), immunoglobulin heavy chain class switch repeats, translin target sites and several novel motifs including (or overlapping) the classical meiotic recombination hotspot, CCTCCCCT. Finally, gene conversions tend to occur in genomic regions that have the potential to fold into stable hairpin conformations. These findings support the concept that recombination-inducing motifs, in association with alternative DNA conformations, can promote recombination in the human genome.

Activation of ATM depends on chromatin interactions occurring before induction of DNA damage

Efficient and correct responses to double stranded breaks (DSB) in chromosomal DNA are critical for maintaining genomic stability and preventing chromosomal alterations leading to cancer1. The generation of DSB is associated with structural changes in chromatin and the activation of the protein kinase ataxia-telangiectasia mutated (ATM), a key regulator of the signaling network of the cellular response to DSB 2,3. The interrelationship between DSB-induced changes in chromatin architecture and the activation of ATM is unclear 3. Here we show that the nucleosome-binding protein HMGN1 modulates the interaction of ATM with chromatin both prior to and after DSB formation thereby optimizing its activation. Loss of HMGN1, or ablation of its ability to bind to chromatin, reduces the levels of IR-induced ATM autophosphorylation and the activation of several ATM targets. IR treatments lead to a global increase in the acetylation of Lys14 of histone H3 (H3K14) in an HMGN1 dependent manner and treatment of cells with a histone deacetylase inhibitor bypasses the HMGN1 requirement for efficient ATM activation. Thus, by regulating the levels of histone modifications, HMGN1 affects ATM activation. Our studies identify a new mediator of ATM activation and demonstrate a direct link between the steady-state intranuclear organization of ATM and the kinetics of its activation following DNA damage.

Replication fork stalling in WRN-deficient cells is overcome by prompt activation of a MUS81-dependent pathway

Failure to stabilize and properly process stalled replication forks results in chromosome instability, which is a hallmark of cancer cells and several human genetic conditions that are characterized by cancer predisposition. Loss of WRN, a RecQ-like enzyme mutated in the cancer-prone disease Werner syndrome (WS), leads to rapid accumulation of double-strand breaks (DSBs) and proliferating cell nuclear antigen removal from chromatin upon DNA replication arrest. Knockdown of the MUS81 endonuclease in WRN-deficient cells completely prevents the accumulation of DSBs after fork stalling. Also, MUS81 knockdown in WS cells results in reduced chromatin recruitment of recombination enzymes, decreased yield of sister chromatid exchanges, and reduced survival after replication arrest. Thus, we provide novel evidence that WRN is required to avoid accumulation of DSBs and fork collapse after replication perturbation, and that prompt MUS81-dependent generation of DSBs is instrumental for recovery from hydroxyurea-mediated replication arrest under such pathological conditions.

DNA repair of clustered lesions in mammalian cells: involvement of non-homologous end-joining

Clustered lesions are defined as ≥two lesions within 20 bps and are generated in DNA by ionizing radiation. In vitro studies and work in bacteria have shown that attempted repair of two closely opposed lesions can result in the formation of double strand breaks (DSBs). Since mammalian cells can repair DSBs by non-homologous end-joining (NHEJ), we hypothesized that NHEJ would repair DSBs formed during the removal of clustered tetrahydrofurans (furans). However, two opposing furans situated 2, 5 or 12 bps apart in a firefly luciferase reporter plasmid caused a decrease in luciferase activity in wild-type, Ku80 or DNA-PKcs-deficient cells, indicating the generation of DSBs. Loss of luciferase activity was maximal at 5 bps apart and studies using siRNA implicate the major AP endonuclease in the initial cleavage. Since NHEJ-deficient cells had equivalent luciferase activity to their isogenic wild-type cells, NHEJ was not involved in accurate repair of clustered lesions. However, quantitation and examination of re-isolated DNA showed that damage-containing plasmids were inaccurately repaired by Ku80-dependent, as well as Ku80-independent mechanisms. This work indicates that not even NHEJ can completely prevent the conversion of clustered lesions to potentially lethal DSBs, so demonstrating the biological relevance of ionizing radiation-induced clustered damage.

Activation of the Salmonella Typhimurium Mrr protein

The Mrr protein of Escherichia coli K12 is a cryptic type IV restriction endonuclease with specificity for methylated DNA. Recently it was discovered that endogenous activation of E. coli Mrr could be triggered by high pressure stress, resulting in the generation of double strand breaks in the host chromosome and concomitant induction of the SOS response. In this report we focused on Mrr activity of Salmonella Typhimurium LT2, and although we surprisingly found no evidence of high pressure induced activation, a large number of constitutively activated Mrr mutants could be isolated when the mrr gene was routinely cloned in an expression vector. Analysis of several spontaneous mutants revealed different single mutations that rendered the Mrr protein constitutively active. Moreover, a spontaneous S. Typhimurium mutant could be isolated that displayed an increased basal SOS induction because of a point mutation in the chromosomal mrr gene. Based on these findings the physiological role of Mrr in the cell is discussed.

Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population.

Cellular defence mechanisms: modelling of the DSB generation and repair process under ion radiation

Cells can trigger self-defence mechanisms in response to acute perturbations from outside. To investigate the complicated mechanisms of cellular response to continuous Ion Radiation (IR) at the single-cell level, a model of the Double Strand Breaks (DSBs) generation and repair process is proposed. The model can be successfully used to simulate the investigation of the stochastic traces of DSBs generation, as well as the different kinetics of the complicated interactions among resulting DSBs, DSB-protein Complexes (DSBCs), Repair Protein (RP), and misrepair of DSBs (Fw) under different radiation dose domains.

APE1- and APE2-dependent DNA breaks in immunoglobulin class switch recombination

Antibody class switch recombination (CSR) occurs by an intrachromosomal deletion requiring generation of double-stranded breaks (DSBs) in switch-region DNA. The initial steps in DSB formation have been elucidated, involving cytosine deamination by activation-induced cytidine deaminase and generation of abasic sites by uracil DNA glycosylase. However, it is not known how abasic sites are converted into single-stranded breaks and, subsequently, DSBs. Apurinic/apyrimidinic endonuclease (APE) efficiently nicks DNA at abasic sites, but it is unknown whether APE participates in CSR. We address the roles of the two major mammalian APEs, APE1 and APE2, in CSR. APE1 deficiency causes embryonic lethality in mice; we therefore examined CSR and DSBs in mice deficient in APE2 and haploinsufficient for APE1. We show that both APE1 and APE2 function in CSR, resulting in the DSBs necessary for CSR and thereby describing a novel in vivo function for APE2.

γH2AX Foci Form Preferentially in Euchromatin after Ionising-Radiation

BackgroundThe histone variant histone H2A.X comprises up to 25% of the H2A complement in mammalian cells. It is rapidly phosphorylated following exposure of cells to double-strand break (DSB) inducing agents such as ionising radiation. Within minutes of DSB generation, H2AX molecules are phosphorylated in large chromatin domains flanking DNA double-strand breaks (DSBs); these domains can be observed by immunofluorescence microscopy and are termed γH2AX foci. H2AX phosphorylation is believed to have a role mounting an efficient cellular response to DNA damage. Theoretical considerations suggest an essentially random chromosomal distribution of X-ray induced DSBs, and experimental evidence does not consistently indicate otherwise. However, we observed an apparently uneven distribution of γH2AX foci following X-irradiation with regions of the nucleus devoid of foci.Methodology/Principle FindingsUsing immunofluorescence microscopy, we show that focal phosphorylation of histone H2AX occurs preferentially in euchromatic regions of the genome following X-irradiation. H2AX phosphorylation has also been demonstrated previously to occur at stalled replication forks induced by UV radiation or exposure to agents such as hydroxyurea. In this study, treatment of S-phase cells with hydroxyurea lead to efficient H2AX phosphorylation in both euchromatin and heterochromatin at times when these chromatin compartments were undergoing replication. This suggests a block to H2AX phosphorylation in heterochromatin that is at least partially relieved by ongoing DNA replication.Conclusions/SignificanceWe discus a number of possible mechanisms that could account for the observed pattern of H2AX phosphorylation. Since γH2AX is regarded as forming a platform for the recruitment or retention of other DNA repair and signaling molecules, these findings imply that the processing of DSBs in heterochromatin differs from that in euchromatic regions. The differential responses of heterochromatic and euchromatic compartments of the genome to DSBs will have implications for understanding the processes of DNA repair in relation to nuclear and chromatin organization.

Activation-Induced Cytidine Deaminase-Dependent DNA Breaks in Class Switch Recombination Occur during G1 Phase of the Cell Cycle and Depend upon Mismatch Repair

Ab class switching occurs by an intrachromosomal recombination and requires generation of double-strand breaks (DSBs) in Ig switch (S) regions. Activation-induced cytidine deaminase (AID) converts cytosines in S regions to uracils, which are excised by uracil DNA glycosylase (UNG). Repair of the resulting abasic sites would yield single-strand breaks (SSBs), but how these SSBs are converted to DSBs is unclear. In mouse splenic B cells, we find that AID-dependent DSBs occur in Smu mainly in the G(1) phase of the cell cycle, indicating they are not created by replication across SSBs. Also, G(1) phase cells express AID, UNG, and mismatch repair (MMR) proteins and possess UNG activity. We find fewer S region DSBs in MMR-deficient B cells than in wild-type B cells, and still fewer in MMR-deficient/SmuTR(-/-) B cells, where targets for AID are sparse. These DSBs occur predominantly at AID targets. We also show that nucleotide excision repair does not contribute to class switching. Our data support the hypothesis that MMR is required to convert SSBs into DSBs when SSBs on opposite strands are too distal to form DSBs spontaneously.

Association of Arabidopsis topoisomerase IIA cleavage sites with functional genomic elements and T‐DNA loci

Topoisomerase IIA (Topo IIA) is an essential ubiquitous enzyme involved in controlling DNA topology during multiple processes of genome function, and has been implicated in the generation of double-stranded breaks (DSB) in genomic DNA prior to DNA integration in plant genomes. Despite extensive characterization of type II topoisomerases from bacteria, viruses and animals, no studies on the specificity of plant Topo IIA-mediated DNA cleavage have been reported. We mapped and characterized Arabidopsis thaliana Topo IIA (AtTopoIIA) cleavage sites and demonstrated that they were cleaved in vivo. The consensus for the AtTopoIIA cleavage sites (ANNNRN downward arrowGTACNTNNNY) was significantly different from recognition sequences reported for Topo IIA from other organisms. The mapped cleavage sites were abundant in the Arabidopsis genome, exhibited a weak consensus, and were cleaved with relatively low efficiency. Use of the systematic evolution of ligands by exponential enrichment (SELEX) protocol identified a single, efficiently cleaved sequence TATATATATGTATATATATA that was over-represented in the genome. The mapped AtTopoIIA cleavage sites and the SELEX sites differed in their genomic distribution and associations with gene regulatory elements, matrix attachment regions, stress-induced DNA duplex destabilization sequences and T-DNA loci, suggesting different genome functions. Mapped AtTopoIIA sites but not SELEX sites were strongly associated with T-DNA integration sites, providing evidence for the involvement of AtTopoIIA-mediated DSB formation in T-DNA integration.

Chromosome translocations in cancer: computational evidence for the random generation of double-strand breaks

In this article, we show that introns harboring translocation breakpoints in tumors are significantly longer than non-translocated introns of the same genes but are not enriched significantly in sequence elements potentially involved in chromosomal rearrangements. Our findings provide evidence that double-strand breaks, the type of DNA damage that leads to translocations in tumors, are created at random points in the genome, and that sequence elements do not have a widespread role in the localization of these breaks.

Inhibition of Aurora A in response to DNA damage

Mitotic kinases are the ultimate target of pathways sensing genotoxic damage and impinging on the cell cycle machinery. Here, we provide evidence that Aurora A (AurA) was inhibited upon generation of double-strand breaks in DNA. We demonstrate that AurA was not downstream of CDK1 and that inhibition of AurA and CDK1 by DNA damage occurred independently. Using a cell line functionally deficient in Chk2, a selective Chk1 inhibitor and siRNA to Chk1, we show that DNA-damage signals were delivered to AurA through a Chk1-dependent pathway. With regard to the molecular mechanism of AurA inhibition, we found that the point mutation Ser(342)>Ala rendered AurA resistant to inhibition by DNA damage. By means of two distinct approaches we examined the impact of reconstitution of AurA activity in DNA-damaged cells: (i) transient expression of wild-type and Ser(342)>Ala mutant, but not kinase-dead, AurA led to bypass of the DNA damage block; (ii) direct transduction of highly active wt-AurA into G2 arrested cells precisely after induction of DNA damage resulted in mitotic entry. We show that the mechanism through which AurA allowed entry into mitosis was reactivation of CDK1, thus indicating that AurA plays a key role upstream of CDK1. A model depicting the possible role of AurA at the onset of mitosis and upon DNA damage is presented.

A proteomics approach for the identification of nucleophosmin and heterogeneous nuclear ribonucleoprotein C1/C2 as chromatin-binding proteins in response to DNA double-strand breaks

Double-strand breaks (DSBs) of chromosomal DNA trigger the cellular response that activates the pathways for DNA repair and cell-cycle checkpoints, and sometimes the pathways leading to cell death if the damage is too severe to be tolerated. Evidence indicates that, upon generation of DNA DSBs, many nuclear proteins that are involved in DNA repair and checkpoints are recruited to chromatin around the DNA lesions. In the present study we used a proteomics approach to identify DNA-damage-induced chromatin-binding proteins in a systematic way. Two-dimensional gel analysis for protein extracts of chromatin from DNA-damage-induced and control HeLa cells identified four proteins as the candidates for DNA-damage-induced chromatin-binding proteins. MALDI-TOF (matrix-assisted laser-desorption ionization-time-of-flight) MS analysis identified these proteins to be NPM (nucleophosmin), hnRNP (heterogeneous nuclear ribonucleoprotein) C1, hnRNP C2 and 37-kDa laminin-receptor precursor, and the identity of these proteins was further confirmed by immunoblot analysis with specific antibodies. We then demonstrated with chromatin-binding assays that NPM and hnRNP C1/C2, the abundant nuclear proteins with pleiotropic functions, indeed bind to chromatin in a DNA-damage-dependent manner, implicating these proteins in DNA repair and/or damage response. Immunofluorescence experiments showed that NPM, normally present in the nucleoli, is mobilized into the nucleoplasm after DNA damage, and that neither NPM nor hnRNP C1/C2 is actively recruited to the sites of DNA breaks. These results suggest that NPM and hnRNP C1/C2 may function at the levels of the global context of chromatin, rather than by specifically targeting the broken DNA.

Mismatch Repair Proteins Are Activators of Toxic Responses to Chromium-DNA Damage

Chromium(VI) is a toxic and carcinogenic metal that causes the formation of DNA phosphate-based adducts. Cr-DNA adducts are genotoxic in human cells, although they do not block replication in vitro. Here, we report that induction of cytotoxicity in Cr(VI)-treated human colon cells and mouse embryonic fibroblasts requires the presence of all major mismatch repair (MMR) proteins. Cr-DNA adducts lost their ability to block replication of Cr-modified plasmids in human colon cells lacking MLH1 protein. The presence of functional mismatch repair caused induction of p53-independent apoptosis associated with activation of caspases 2 and 7. Processing of Cr-DNA damage by mismatch repair resulted in the extensive formation of gamma-H2AX foci in G(2) phase, indicating generation of double-stranded breaks as secondary toxic lesions. Induction of gamma-H2AX foci was observed at 6 to 12 h postexposure, which was followed by activation of apoptosis in the absence of significant G(2) arrest. Our results demonstrate that mismatch repair system triggers toxic responses to Cr-DNA backbone modifications through stress mechanisms that are significantly different from those for other forms of DNA damage. Selection for Cr(VI) resistant, MMR-deficient cells may explain the very high frequency of lung cancers with microsatellite instability among chromate workers.

Mre11 assembles linear DNA fragments into DNA damage signaling complexes.

Mre11/Rad50/Nbs1 complex (MRN) is essential to suppress the generation of double-strand breaks (DSBs) during DNA replication. MRN also plays a role in the response to DSBs created by DNA damage. Hypomorphic mutations in Mre11 (which causes an ataxia-telangiectasia-like disease [ATLD]) and mutations in the ataxia-telangiectasia-mutated (ATM) gene lead to defects in handling damaged DNA and to similar clinical and cellular phenotypes. Using Xenopus egg extracts, we have designed a simple assay to define the biochemistry of Mre11. MRN is required for efficient activation of the DNA damage response induced by DSBs. We isolated a high molecular weight DNA damage signaling complex that includes MRN, damaged DNA molecules, and activated ATM. Complex formation is partially dependent upon Zn2+ and requires an intact Mre11 C-terminal domain that is deleted in some ATLD patients. The ATLD truncation can still perform the role of Mre11 during replication. Our work demonstrates the role of Mre11 in assembling DNA damage signaling centers that are reminiscent of irradiation-induced foci. It also provides a molecular explanation for the similarities between ataxia-telangiectasia (A-T) and ATLD.

The RuvAB Branch Migration Complex Can Displace Topoisomerase IV·Quinolone·DNA Ternary Complexes

Quinolone antimicrobial drugs target both DNA gyrase and topoisomerase IV (Topo IV) and convert these essential enzymes into cellular poisons. Topoisomerase poisoning results in the inhibition of DNA replication and the generation of double-strand breaks. Double-strand breaks are repaired by homologous recombination. Here, we have investigated the interaction between the RuvAB branch migration complex and the Topo IV.quinolone.DNA ternary complex. A strand-displacement assay is employed to assess the helicase activity of the RuvAB complex in vitro. RuvAB-catalyzed strand displacement requires both RuvA and RuvB proteins, and it is stimulated by a 3'-non-hybridized tail. Interestingly, Topo IV.quinolone.DNA ternary complexes do not inhibit the translocation of the RuvAB complex. In fact, Topo IV.quinolone.DNA ternary complexes are reversed and displaced from the DNA upon their collisions with the RuvAB complex. These results suggest that the RuvAB branch migration complex can actively remove quinolone-induced covalent topoisomerase.DNA complexes from DNA and complete the homologous recombination process in vivo.

HU Protein of Escherichia coli Has a Role in the Repair of Closely Opposed Lesions in DNA

Closely opposed lesions form a unique class of DNA damage that is generated by ionizing radiation. Improper repair of closely opposed lesions could lead to the formation of double strand breaks that can result in increased lethality and mutagenesis. In vitro processing of closely opposed lesions was studied using double-stranded DNA containing a nick in close proximity opposite to a dihydrouracil. In this study we showed that HU protein, an Escherichia coli DNA-binding protein, has a role in the repair of closely opposed lesions. The repair of dihydrouracil is initiated by E. coli endonuclease III and processed via the base excision repair pathway. HU protein was shown to inhibit the rate of removal of dihydrouracil by endonuclease III only when the DNA substrate contained a nick in close proximity opposite to the dihydrouracil. In contrast, HU protein did not inhibit the subsequent steps of the base excision repair pathway, namely the DNA synthesis and ligation reactions catalyzed by E. coli DNA polymerase and E. coli DNA ligase, respectively. The nick-dependent selective inhibition of endonuclease III activity by HU protein suggests that HU could play a role in reducing the formation of double strand breaks in E. coli.

Induction of DNA Replication-mediated Double Strand Breaks by Psoralen DNA Interstrand Cross-links

The effect of DNA interstrand cross-links (cross-links) on DNA replication was examined with a cell-free SV40 origin-dependent DNA replication system. A defined template DNA with a single psoralen cross-link and the SV40 origin of replication was replicated by HeLa cell-free extract in the presence of SV40 large T antigen. The psoralen cross-link inhibited DNA replication by terminating chain elongation at 1-50 nucleotides before the cross-linked sites. The termination of DNA replication by the cross-links mediated the generation of double strand breaks near the cross-linked sites. These results are the first biochemical evidence of the generation of double strand breaks by DNA replication.

Okazaki Fragment Maturation in Yeast: II. COOPERATION BETWEEN THE POLYMERASE AND 3′–5′-EXONUCLEASE ACTIVITIES OF POL δ IN THE CREATION OF A LIGATABLE NICK

To address the different functions of Pol delta and FEN1 (Rad27) in Okazaki fragment maturation, exonuclease-deficient polymerase Pol delta-01 and Pol delta-5DV (corresponding to alleles pol3-01-(D321A, E323A) and pol3-5DV-(D520V), respectively) were purified and characterized in this process. In the presence of the replication clamp PCNA, both wild-type and exo(-) Pol delta carried out strand displacement synthesis with similar rates; however, initiation of strand displacement synthesis was much more efficient with Pol delta-exo(-). When Pol delta-exo(-) encountered a downstream primer, it paused with 3-5 nucleotides of the primer displaced, whereas the wild type carried out precise gap filling. Consequently, in the absence of FEN1, Pol delta exonuclease activity was essential for closure of simple gaps by DNA ligase. Compared with wild type, Okazaki fragment maturation with Pol delta-exo(-) proceeded with an increased duration of nick translation prior to ligation. Maturation was efficient in the absence of Dna2 and required Dna2 only when FEN1 activity was compromised. In agreement with these results, the proposed generation of double strand breaks in pol3-exo(-) rad27 mutants was suppressed by the overexpression of DNA2. Further genetic studies showed that pol3-exo(-) rad27 double mutants were sensitive to alkylation damage consistent with an in vivo defect in gap filling by exonuclease-deficient Pol delta.