Gene Nucleotide Research Articles

Genotype Shift of Malaysian Porcine Circovirus 2 (PCV2) from PCV2b to PCV2d within a Decade.

Simple SummaryThis study aims to provide an updated Malaysian porcine circovirus 2 (PCV2) situation after a knowledge gap of one decade. Molecular detection rates of 83.78% and 83.54% at farm and sample population level were reported, close to previous publication. However, an obvious genotype shift from genotype PCV2b to PCV2d was revealed. Substitution rate for PCV2 cap gene sequences in this study was estimated at 1.102 × 10−3 substitutions/site/year, in agreement with the high substitution rate expected from PCV2 strains. Phylogenetic clustering pattern according to the year of sample origin was observed, suggesting possible nucleotide mutation occurring over time. Concurrent circulation of different PCV2 strains within one farm and within a single individual were also observed. This study also reports detection of PCV2 antigen across all production age groups from fetuses to sows; in abattoir lung samples from clinically healthy finishers; and in the wild boar population roaming Peninsular Malaysia. These observations of high molecular detection rates in farms, clinically healthy abattoir samples and in the wild boar population; and most importantly, a new wave of genotype shift from PCV2b to PCV2d—warrant further attention on the Malaysian PCV2 situation pertinent to the control and management strategy applicable to local swine farming.This paper aims to update the molecular status of porcine circovirus 2 (PCV2) in Malaysia. Firstly, the molecular detection rate of PCV2 in farm and sampled pig population were reported to be 83.78% (31/37 farms) and 83.54% (66/79 pigs) positive for PCV2, respectively. PCV2 was detected across all age groups, from fetuses, porkers to sows. Co-detection of PCV2 and PCV3 antigens was also reported at a rate of 28.77% (21/73). Secondly, PCV2 antigen was also detected in Malaysian abattoir lung samples: 18 out of 19 (94.74%) samples originating from clinically healthy finishers were tested positive. Further, this is the first study to confirm the circulation of PCV2 in the wild boar population roaming Peninsular Malaysia, where 28 out of 28 (100%) wild boar lung samples were found positive. One decade earlier, only genotype PCV2b was reported in Malaysia. This most recent update revealed that genotypes PCV2a, PCV2b and PCV2d were present, with PCV2d being the predominant circulating genotype. PCV2 cap gene nucleotide sequences in this study were found to be under negative selection pressure, with an estimated substitution rate of 1.102 × 10−3 substitutions/site/year (ssy).

Molecular characterization and association of lactoferrin gene to subclinical mastitis in goats (Capra hircus)

The study characterized the lactoferrin (Lf) mRNA gene in different goat breeds in the Philippines and determined its association with subclinical mastitis (SCM). The study involved collection of milk at second week of lactation (n=75) and blood samples (n=5) to obtain extracted RNA and using cDNA to amplify Lf gene through polymerase chain reaction. The nucleotide and amino acid sequences were determined and used as reference in the evaluation of phylogenetic relationship. Amplified products were utilized for RFLP analysis before determining the association of the gene with SCM. Results of the study demonstrated that Lf gene in goats registered a molecular weight of 2135. Nucleotide and amino acid sequence of Lf gene revealed high similarity (99%) in Saanen, Anglo-Nubian and Philippine native goats with that of Capra hircus (U53857) Lf gene submitted to GenBank. Phylogenetic studies showed that Lf gene of Anglo-Nubian, Saanen and Native goats clade together with Lf gene of C. hircus (U53857). Three genotypes in goats were documented using the restriction enzymes AluI and HaeIII. Based on the Statistical analysis, association (comp 5.65, p = 0.0308) has been established between the Lf genes of goats with genotype BB to SCM using HaeIII restriction enzyme.

A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia

A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.

The emergence of a disease caused by a mosquito origin Cluster 3.2 Tembusu virus in chickens in China

In 2021, a chicken Tembusu virus (TMUV) caused outbreaks of a disease characterized by retarded growth and egg production decline in chickens in China. Two TMUV strains SD2021 and GX2021 were isolated from the diseased chickens and phylogenetic analysis of the E gene nucleotide sequence revealed that the chicken TMUV SD2021 and GX2021 were most close to mosquito origin TMUV in Cluster 3.2, which was distinct from the prevalent duck TMUVs in Cluster 2. The TMUV SD2021 caused growth retardation and neurological symptoms in chickens through both intranasal and intramuscular infection routes, but has no direct-contact transmissibility among chickens. The findings of this study highlight the pathogenicity of a chicken adapted mosquito-origin TMUV in chickens in China.

Genomic architecture and functional effects of potential human inversion supergenes.

Supergenes are involved in adaptation in multiple organisms, but they are little known in humans. Genomic inversions are the most common mechanism of supergene generation and maintenance. Here, we review the information about two large inversions that are the best examples of potential human supergenes. In addition, we do an integrative analysis of the newest data to understand better their functional effects and underlying genetic changes. We have found that the highly divergent haplotypes of the 17q21.31 inversion of approximately 1.5 Mb have multiple phenotypic associations, with consistent effects in brain-related traits, red and white blood cells, lung function, male and female characteristics and disease risk. By combining gene expression and nucleotide variation data, we also analysed the molecular differences between haplotypes, including gene duplications, amino acid substitutions and regulatory changes, and identify CRHR1, KANLS1 and MAPT as good candidates to be responsible for these phenotypes. The situation is more complex for the 8p23.1 inversion, where there is no clear genetic differentiation. However, the inversion is associated with several related phenotypes and gene expression differences that could be linked to haplotypes specific of one orientation. Our work, therefore, contributes to the characterization of both exceptional variants and illustrates the important role of inversions.This article is part of the theme issue ‘Genomic architecture of supergenes: causes and evolutionary consequences’.

Morphomolecular characterization of Strongylus vulgaris isolated from donkeys with special references to histopathological study on the affected organs.

Equine gastrointestinal tract is infected with Strongylus vulgaris (S. vulgaris) which is highly pathogenic parasite for its harmful effect on cranial mesenteric artery during its migration. So, this study was applied for identification of S. vulgaris in donkeys ultramorphologically and molecularly. In addition to, detection of the pathological effect of larval stage of S. vulgaris on the mesenteric arterial system using histopathology and immunohistochemistry. During the period from September to December; 2019, 60 male and 20 female donkeys at the Giza Zoo was postmortem examined. S. vulgaris adults and larvae were collected from the large intestine and cranial mesenteric arteries (CMAs), respectively. Ultramorphological examination of the collected adults was done using scanning electron microscope (SEM). DNA was extracted from 5 larvae and 6 adults for further conventional PCR studies and sequencing of the internal transcriped spacer 2 (ITS2) gene. The ITS2 gene were amplified and showed bands at 148 base pair (bp). The ITS2 gene nucleotide sequences of all isolates were aligned using Basic Local Alignment Search Tool (BLAST). Histological sections of S. vulgaris affected mesenteric arteries exhibited the presence of the parasite larvae either in the lumen with thrombus formation or attached to the intima. Most of the detected inflammatory cell populations were CD68-positive cells. From these results, it can be concluded that the ribosomal spacers genes could be used as markers for Strongylus species identification in eggs collected from equine feces as a beneficial method of diagnosis. Also, it could be important in disease surveillance, improving preventive measures and developing an effective control strategy.

Genomic Sequence Data of Bacterial Isolates from Pistachio Trees and Other Woody Plants in California Are Inconsistent with the Role of Rhodococcus as the Causative Agent of Pistachio Bushy Top Syndrome

Pistachio bushy top syndrome (PBTS) is a serious problem for pistachio growers in the western United States, but the cause of this disorder remains controversial. Recently, it was proposed that the Rhodococcus species R. fascians and R. corynebacterioides caused PBTS outbreaks in 2011 and 2015. To investigate the association of Rhodococcus spp. with PBTS in California's pistachio-growing region, Rhodococcus-like isolates were collected from diverse hosts and environments, including pistachio nurseries and orchards. Whole genome sequence analysis of 231 isolates revealed their evolutionary relationships and identified six Rhodococcus species. Combined with data on geography and host of origin, the data reveal that Rhodococcus generally, and R. fascians specifically, is ubiquitous in nature, frequently occurring in both symptomatic and asymptomatic pistachio trees and on other woody and native species. Core gene and single nucleotide polymorphism-based phylogenies and pangenome analyses differentiate R. fascians into distinct genotypes. Although we found examples of common genotypes shared between nurseries and orchards, the observed patterns are most consistent with an environmental source of strains and do not support a scenario in which individual nurseries are point sources of Rhodococcus. Moreover, none of the collected strains harbored known virulence genes, calling into question the role of these common environmental bacteria in causing PBTS. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Prime Editing Permits the Introduction of Specific Mutations in the Gene Responsible for Duchenne Muscular Dystrophy.

The Prime editing technique derived from the CRISPR/Cas9 discovery permits the modification of selected nucleotides in a specific gene. We used it to insert specific point mutations in exons 9, 20, 35, 43, 55 and 61 of the Duchenne Muscular Dystrophy (DMD) gene coding for the dystrophin protein, which is absent in DMD patients. Up to 11% and 21% desired mutations of the DMD gene in HEK293T cells were obtained with the PRIME Editor 2 (PE2) and PE3, respectively. Three repeated treatments increased the percentage of specific mutations with PE2 to 16%. An additional mutation in the protospacer adjacent motif (PAM) sequence improved the PE3 result to 38% after a single treatment. We also carried out the correction of c.428 G>A point mutation in exon 6 of the DMD gene in a patient myoblast. Myoblast electroporation showed up to 8% and 28% modifications, respectively, for one and three repeated treatments using the PE3 system. The myoblast correction led to dystrophin expression in myotubes detected by Western blot. Thus, prime editing can be used for the correction of point mutations in the DMD gene.

Molecular identification, whole-cell protein profiling, antibiotics sensitivity and pathogenicity of Chryseobacterium gleum recovered from diseased fishes of freshwater wetlands in India

Globally, bacterial gill disease is one of the most prominent bacterial diseases affecting both marine and freshwater fishes. This study aimed to investigate diseased Labeo rohita, Labeo catla and Oreochromis niloticus with gill discoloration, tail rot and skin ulcer that resembles the typical sign of bacterial gill disease from East Kolkata Wetlands, India. The results revealed that four isolates of Chryseobacterium gleum were the responsible pathogens. The isolates CIFRI-RRM3, CIFRI-BFG2, CIFRI-SRM4 and CIFRI-TRM5 were identified using bacterial colony morphology, biochemical test, whole-cell protein profiling, 16S rRNA gene amplification and nucleotide sequence analysis. The antibiotic susceptibility assay showed that all the isolates were completely resistant to ampicillin, amoxyclav, cefalexin, cephalothin, ceftriaxone, ceftazidime, cefotaxime, cefuroxime, cefadroxil, chloramphenicol, kanamycin, netilmicin, penicillin-G, ticarcillin, tobramycin, erythromycin and tetracycline. A challenge experiment was also conducted for four isolates with intraperitoneal injection at a dose of 2.5 × 1010 CFU mL−1 to 4.2 × 1010 CFU mL−1in respective fish hosts. Only three isolates (CIFRI-BFG2, CIFRI-RRM3 and CIFRI-TRM5) proved their virulence by producing diseases with mild symptoms of skin lesions, gill disease and cumulative mortality of 10–20%. To the best of our knowledge, this is the first description of the phenotypic, molecular and whole-cell protein profiling of C. gleum derived from freshwater fishes in India.

Bovine Coronavirus Co-infection and Molecular Characterization in Dairy Calves With or Without Clinical Respiratory Disease.

Bovine respiratory disease (BRD) is considered a major cause of morbidity and mortality in young calves and is caused by a range of infectious agents, including viruses and bacteria. This study aimed to determine the frequency of viral and bacterial pathogens detected in calves with BRD from high-production dairy cattle herds and to perform the molecular characterization of N and S1 genes in identified bovine coronavirus (BCoV) strains. Nasal swabs were collected from 166 heifer calves, namely, 85 symptomatic and 81 asymptomatic calves aged between 5 and 90 days, from 10 dairy cattle herds. Nasal swabs were evaluated using molecular techniques for the identification of viruses (BCoV, bovine alphaherpesvirus 1, bovine viral diarrhea virus, bovine parainfluenza virus 3, and bovine respiratory syncytial virus) and bacteria (Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, and Mycoplasma bovis). In addition, five and two BCoV-positive samples were submitted to N and S1 gene amplification and nucleotide sequencing, respectively. The frequency of diagnosis of BCoV was higher (56%, 93/166) than the frequency of P. multocida (39.8%, 66/166) and M. haemolytica (33.1%, 55/166). The three microorganisms were identified in the calves of symptomatic and asymptomatic heifer calve groups. All other pathogens included in the analyses were negative. In the phylogenetic analysis of the S1 gene, the Brazilian strains formed a new branch, suggesting a new genotype, called # 15; from the N gene, the strains identified here belonged to cluster II. This study describes high rates of BCoV, P. multocida, and M. haemolytica in heifer calves from high-production dairy cattle herds with BRD. Additionally, the molecular characterization provides evidence that the circulating BCoV strains are ancestrally different from the prototype vaccine strains and even different BCoV strains previously described in Brazil.

Two complete mitochondrial genomes of the subfamily Chloroperlinae (Plecoptera: Chloroperlidae) and their phylogenetic implications

Two new complete mitochondrial genomes (mitogenomes) of the subfamily Chloroperlinae, Haploperla japonica Kohno, 1946 and Sweltsa sp., were sequenced. The two species showed similar gene order, nucleotide composition, and codon usage. The Sweltsa sp. and H. japonica mitogenomes were typical circular DNA molecules, with lengths of 15,893 bp and 16,012 bp, respectively. Standard ATN start and TAN stop codons were present in most PCGs. All tRNA genes exhibited the cloverleaf secondary structure typical for metazoans except the tRNASer(AGN), which lacked the dihydrouridine arm. In both species, the secondary structure of lrRNA contained five structural domains, while the srRNA included three domains. The A+T-rich regions contained different repeat regions in each species. Phylogenetic analyses using Bayesian inference (BI) and maximum likelihood methods (ML) showed identical results. The family Chloroperlidae was sister to the Perlodidae. Our analyses inferred relationships between six of the seven Systellognatha families: (((Chloroperlidae + Perlodidae) + Perlidae) + (Styloperlidae + Pteronarcyidae)) + Peltoperlidae.

Association of SIRT1 single gene nucleotide polymorphisms and serum SIRT1 levels with laryngeal squamous cell carcinoma patient survival rate.

BACKGROUND:SIRT1 is a multifunctional protein, possibly essential in tumorigenesis pathways, which can act both as a tumor promoter and tumor suppressor depending on the oncogenes, specific to particular tumors. Pathogenesis of laryngeal cancer is multifactorial and the association of SIRT1 expression with the clinical characteristics and prognosis of LSCC has not been fully identified.OBJECTIVES: The study aimed to evaluate associations between single gene nucleotide polymorphisms (SNPs) of SIRT1 (rs3818292, rs3758391, and rs7895833), serum SIRT1 levels, and 5-year survival rate in patients with laryngeal squamous cell carcinoma (LSCC).METHODS: The study involved 302 patients with LSCC and 409 healthy control subjects. The genotyping of SNPs was performed using RT-PCR, and serum SIRT1 levels were determined by the ELISA method.RESULTS: Our study found significant differences in genotype distributions of SIRT1 rs3758391 polymorphisms between the study groups. SIRT1 rs3758391 T/T genotype was associated with the increased LSCC development odds (OR 1.960 95% CI 1.028–3.737; 0.041). Carriers of SIRT1 rs3758391 T/T genotype had statistically significantly increased odds of LSCC development into advanced stages under the codominant and recessive genetic models (OR 2.387 95% CI 1.091–5.222; 0.029 and OR 2.287 95% CI 1.070–4.888; 0.033, respectively). There were no statistically significant differences in serum SIRT1 levels between the LSCC and control groups. However, LSCC patients with SIRT1 rs3818292 AG genotype demonstrated a tendency to significantly lower SIRT1 serum levels than controls ( 0.034). No statistically significant associations between SIRT1 (rs3818292, rs3758391, and rs7895833) SNPs and the 5-year survival rate of LSCC patients were found.CONCLUSION: The present study indicated a statistically significant association between the SIRT1 rs3758391 T/T genotype and increased LSCC development odds. LSCC patients with SIRT1 rs3818292 AG genotype showed a tendency to manifest with lower SIRT1 serum levels. No associations between SIRT1 SNPs and the 5-year survival rate of LSCC patients were detected.

In silico Comparisons of the Ethylene Response Factor 1 (ERF1) Gene Between Malaysian Wild Banana (Musa acuminata ssp. malaccensis) and Pisang Klutuk Wulung (Musa balbisiana)

Musa balbisiana (B genome) has been observed to have a higher tolerance of biotic and abiotic stresses than Musa acuminata (A genome). Ethylene Response Factor 1 (ERF1) is a gene activator for pathogenesis-related proteins (PR proteins) such as basic chitinases and beta-1,3-glucanase. There are numerous ERF1 gene studies about Oryza sativa, but information about the banana ERF1 gene, especially in the B genome (Musa balbisiana “Pisang Klutuk Wulung”), has still not been explored thoroughly. Using annotated genomic data in an A genome (Musa acuminata ssp. malaccensis) and genomic data in a B genome (Musa balbisiana “Pisang Klutuk Wulung”), research on the ERF1 gene can be conducted at the gene sequences and amino acid sequences levels. The Musa acuminata (A genome) ERF1 gene nucleotide sequence was retrieved from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The Musa balbisiana (B genome) ERF1 gene nucleotide sequence was identified with the nucleotide Basic Local Alignment Search Tool (BLASTn) using an A genome ERF1 gene sequence as a query. Both ERF1 gene nucleotide sequences and amino acid sequences in the A and B genomes were annotated and compared. Seven annotated genome ERF1 gene sequences from the A and B genomes were identified with the probability that these genes were actively transcribed in cell activity. ERF1 gene comparisons between the A and B genomes showed that nucleotide composition, gene structure, gene position in each respective chromosome, ERF clusterization, identified motif, and amino acid composition in each of the identified motifs have similar characteristics.

Complete mitochondrial genome of Phyllonorycter ringoniella (Lepidoptera: Gracillariidae)

The complete mitochondrial genome of Phyllonorycter ringoniella (Matsumura, 1931) is characterized by a circular with 15,729 bp in size, containing 37 encoded genes and a control region. The gene order and nucleotide composition are similar to the known gracillariid mitogenomes. All protein-coding genes (PCGs) initiate with ATN and terminate with TAN, while cox1 starts with CGA, cox1, cox2, nad3, and nad5 terminate with an incomplete codon TA– or T–. All transfer RNA genes (tRNAs) can fold into typical clover-leaf structure, except for trnS1 (AGN), in which dihydrouridine stem is simplified to form a loop structure. The control region is located between 12S rRNA and trnM with relatively strong AT bias. The phylogenetic trees reveal that two subfamilies Oecophyllembiinae and Acrocercopinae were clustered together, and that clade was sister to the subfamily Lithocolletinae. All species of the genus Phyllonorycter grouped into a monophyletic clade and the P. ringoniella was closely related to P. platani.

The Escherichia coli serS gene promoter region overlaps with the rarA gene.

Deletion of the entire gene encoding the RarA protein of Escherichia coli results in a growth defect and additional deficiencies that were initially ascribed to a lack of RarA function. Further work revealed that most of the effects reflected the presence of sequences in the rarA gene that affect expression of the downstream gene, serS. The serS gene encodes the seryl aminoacyl-tRNA synthetase. Decreases in the expression of serS can trigger the stringent response. The sequences that affect serS expression are located in the last 15 nucleotides of the rarA gene.

Mitogenomes Provide Insights Into the Evolution of Thoracotremata (Brachyura: Eubrachyura)

Thoracotremata is a group of Brachyura, with 1,248 extant species. To date, parts of the thoracotreme phylogeny are not yet resolved and require further investigation. In this study, 12 new mitogenomes from the four thoracotreme superfamilies were sequenced. They contain a standard set of 37 genes, and vary in size from 15,422 (Hapalocarcinus marsupialis Stimpson, 1858 sensu lato) to 16,490 bp [Arcotheres sinensis (Shen, 1932)]. Combined with 58 thoracotreme mitochondrial genomes (mitogenomes) from GenBank, we described the evolution of gene rearrangement and the internal phylogenetic relationships of Thoracotremata, and evaluated the phylogenetic position of Cryptochiroidea and Pinnotheroidea. Nine distinct patterns of mitochondrial gene order (MGO) among thoracotreme mitogenomes are identified, with four MGOs newly found in Thoracotremata. All other gene orders are the result of transformational pathways originating from brachyuran gene order (BraGO). The different gene orders have variable levels of gene rearrangements, which involve both tRNAs and protein-coding genes. No link between variable gene arrangements (breakpoint distances) and nucleotide substitution rates (branch lengths) is found in thoracotreme crabs. The symbiotic groups, the cryptochiroid and pinnotheroid crabs, display variable MGOs (CryGO, Pin1GO, and Pin2GO), providing evidence for possible correlations of rearranged MGOs to the adaptations to specialized lifestyles. In our phylogenetic analyses, Cryptochiridae (Cryptochiroidea) show close relationship with an Ocypodoidea lineage (Camptandriidae/Xenophthalmidae/Dotillidae). Pinnotheridae (Pinnotheroidea) form the basal monophyletic clade.

Comparison of mitogenomes of three Petalocephala species (Hemiptera: Cicadellidae: Ledrinae) and their phylogenetic analysis.

Ledrinae is a unique group of leafhoppers with a distinct appearance. Petalocephala is the largest Ledrinae genus that is difficult to identify except by dissecting the male genitals. To date, research on Ledrinae is relatively less compared with other leafhoppers. Therefore, to better understand this group, we sequenced and analyzed three complete Petalocephala mitochondrial genomes. We comparatively analyzed these general Petalocephala genomic features (including size, AT content, AT/GC skew, 13 protein-coding gene nucleotide compositions, etc.), and predicted 22 transferRNA secondary structures. We obtained highly consistent phylogenetic results within Cicadellidae based on mitogenomic data using the maximum likelihood and Bayesian methods. Our results showed that all subfamilies were monophyletic and had a high node support rate, and there was a sister group relationship between Ledrinae and all other leafhopper groups. Furthermore, treehoppers were found to originate from leafhoppers and showed sister group relationships with Megophthalminae. Within Ledrinae, all phylogenetic trees supporting phylogenetic relationships were as follows: ([P. dicondylica + P. gongshanensis] + [Tituria pyramidata + [Ledra auditura + P. gongshanensis]]) Based on the complete mitogenome phylogenetic analysis and the comparison of morphological characteristics, we propose that Petalocephala is not monophyletic.

Detection and Characterization of Quinone Outside Inhibitor-Resistant Phytophthora cactorum and P. nicotianae Causing Leather Rot in Florida Strawberry.

Phytophthora cactorum and P. nicotianae cause leather rot (LR) of fruit and Phytophthora crown rot (PhCR) in strawberry. LR occurs sporadically but can cause up to 70% fruit loss when weather is conducive. In Florida's annual strawberry winter production system, PhCR can be severe, resulting in plant stunting, mortality, and severe yield loss. Azoxystrobin is labeled for control of LR but not for PhCR. The aims of this research were to determine the sensitivity of P. cactorum and P. nicotianae isolates from strawberry to azoxystrobin and to investigate mechanisms of quinone-outside-inhibitor resistance present in P. cactorum and P. nicotianae based on the known point mutations within the cytochrome b (cytb) gene. Isolates of both Phytophthora spp. causing LR and PhCR were collected from multiple strawberry fields in Florida between 1997 and 2020. Isolates were tested for sensitivity to azoxystrobin at 0, 0.01, 0.1, 1.0, 10, and 50 μg/ml on potato dextrose agar amended with salicylhydroxamic acid (100 μg/ml). Isolates were separated into two groups - sensitive isolates with the 50% effective concentration (EC50) values <1.0 μg/ml, and resistant isolates having EC50 values >50 μg/ml. P. cactorum and P. nicotianae resistance to azoxystrobin was found for isolates collected after 2010. The first 450 nucleotides of the mitochondrial cytb gene were sequenced from a selection of resistant and sensitive isolates of both species. The G143A mutation reported to confer resistance to azoxystrobin was found in all resistant P. cactorum isolates. However, in P. nicotianae, qualitative resistance was observed, but the isolates lacked all the known mutations in the cytb gene. This is the first report of resistance to azoxystrobin in P. cactorum and P. nicotianae.

Profile of vitamin D receptor gene polymorphism TaqI in patients with periodontitis.

The present study aimed to assess the incidence of the vitamin D receptor (VDR) gene polymorphism TaqI in patients with periodontitis, and the potential association of this polymorphism with the severity of the disease. This was a case-controlled study, which included 162 adults divided into two groups as follows: Case group (81 patients diagnosed with periodontitis) and control group (81 patients without periodontitis). Venous blood was obtained from each sample from which DNA was extracted. The gene polymorphism was determined using restricted fragment length polymorphism-PCR and DNA sequencing to identify endonuclease restrictions in exon 9 (TaqI). The data were analyzed using an independent samples t-test. VDR gene polymorphisms were detected in periodontitis cases with TT (86.4%), Tt (12.4%) and tt (1.2%) genotypes. DNA sequencing confirmed a change in the sequence of the VDR gene nucleotides in patients with periodontitis. The data indicated that the severity of periodontal tissue damage may be influenced by changes in the nucleotide sequence.

Pango lineage designation and assignment using SARS-CoV-2 spike gene nucleotide sequences

BackgroundMore than 2 million SARS-CoV-2 genome sequences have been generated and shared since the start of the COVID-19 pandemic and constitute a vital information source that informs outbreak control, disease surveillance, and public health policy. The Pango dynamic nomenclature is a popular system for classifying and naming genetically-distinct lineages of SARS-CoV-2, including variants of concern, and is based on the analysis of complete or near-complete virus genomes. However, for several reasons, nucleotide sequences may be generated that cover only the spike gene of SARS-CoV-2. It is therefore important to understand how much information about Pango lineage status is contained in spike-only nucleotide sequences. Here we explore how Pango lineages might be reliably designated and assigned to spike-only nucleotide sequences. We survey the genetic diversity of such sequences, and investigate the information they contain about Pango lineage status.ResultsAlthough many lineages, including the main variants of concern, can be identified clearly using spike-only sequences, some spike-only sequences are shared among tens or hundreds of Pango lineages. To facilitate the classification of SARS-CoV-2 lineages using subgenomic sequences we introduce the notion of designating such sequences to a “lineage set”, which represents the range of Pango lineages that are consistent with the observed mutations in a given spike sequence.ConclusionsWe find that many lineages, including the main variants-of-concern, can be reliably identified by spike alone and we define lineage-sets to represent the lineage precision that can be achieved using spike-only nucleotide sequences. These data provide a foundation for the development of software tools that can assign newly-generated spike nucleotide sequences to Pango lineage sets.