Control Region Genes Research Articles

The Genetic Diversity of Bali Sardinella (Sardinella lemuru) Caught at Bali Strait and Its Possible Relation to The Ocean Circulation

Graphical Abstract Highlight Research A low sequence divergence of lemuru between Bali Strait and the northern latitude. S. lemuru migration route through ITF will maintain its nucleotide variation. The high haplotype diversity of lemuru is a testament to its adaptability. S. lemuru's high haplotype diversity supports their stock recovery in the Bali Strait. Two sardine species are morphologically and genetically highly distinct, even though they prefer overlapping water mass conditions from each other. Abstract Sardinella lemuru is known as the native pelagic fish of the Bali Strait. However, its presence has become difficult to find recently. This study aimed to validate S. lemuru using molecular taxonomy and link it to water circulations for sustainable management. It is the first study of relatively complete sequence data on S. lemuru in the Bali Strait. A total of 47 sequences were amplified using the control region gene of mitochondrial DNA. Other S. lemuru (n = 4) and Amblygaster sirm (n = 12) sequences were retrieved from GenBank. Low sequence divergence is observed in clade-1 of S. lemuru across the Bali Strait, Manado-Sulawesi, and Kudat-Malaysia. This is probably due to its migration using the main Indonesian ThroughFlow (ITF). There is evolutionary divergence between two groups of S. lemurs, measuring 35.3%±4.1. The first signs of these cryptic groups were found at Canggu and Prigi, with 87 base-pair differences between the two groups. This study also presents strong evidence that A. sirm prefers overlapping water mass conditions with S. lemuru in the Bali Strait but is morphologically and genetically distinct. Notably, three samples of A. sirm in Kedonganan-Bali are clustered with other A. sirm locations passed by the primary and secondary South China Sea throughflow. The high genetic diversity of S. lemuru among Bali Strait sites demonstrates its adaptive ability, with scattered single-frequency haplotypes. The adaptive ability traits of S. lemuru support its stock recovery. The stock recovery recommendation is based on finding S. lemuru's adaptive traits within their populations in suitable habitats and climatic conditions.

Genetic Diversity of Bluefish Population in Türkiye Coastal

Bluefish (Pomatomus saltatrix) is a commercially important, highly migratory predatory fish species distributed along the coasts of Türkiye. Conservation and sustainability of bluefish populations requires knowledge of the genetic structure of the population, but There are no genetic studies on bluefish in Türkiye. In this study, the population structure of Bluefish in the coastal regions of Türkiye was investigated by sequence analysis of mitochondrial DNA gene regions (Cytochrome b and Displacement-loop) and nuclear gene region (Rhodopsin). We tried to identify bluefish samples collected from 14 regions in the coastal region of Türkiye by analyzing two mtDNA gene sequences (Cyt b and D-loop) and nuclear gene region (Rhodopsin). While a total of 35 haplotypes were found in the Cytb gene region, a total of 132 haplotypes were found in the D-loop (control region) gene region. A single haplotype was detected in all stations for Rhodopsin. Also, the maximum likelihood trees based on Cyt b and D-loop sequences suggested relationship of Bluefish populations from Türkiye and the world. Results showed a low level of genetic differentiation between Bluefish populations in the study area, but Aegean and Mediterranean populations are more diverse than other populations due to migratory trait of this species.

Are There Barriers Separating the Pink River Dolphin Populations (Inia boliviensis, Iniidae, Cetacea) within the Mamoré-Iténez River Basins (Bolivia)? An Analysis of Its Genetic Structure by Means of Mitochondrial and Nuclear DNA Markers.

The pink river dolphin, or bufeo, is one of the dolphins which lives in the rivers of the Orinoco and Amazon basins in South America. The Bolivian bufeo population is considered a differentiated species (Inia boliviensis) from the Amazon and Orinoco species (Inia geoffrensis). Until now, no study has completed an extensive population genetics analysis of the bufeo in Bolivian rivers. We analyzed 82 bufeos from different rivers from the Mamoré and Iténez (Guaporé) river basins for the mt control region (CR), nuclear microsatellites, and DQB-1 gene sequences to determine if the inner rapids of these Bolivian river basins have some influence on the genetic structure of this species. The first relevant result was that the genetic diversity for CR, and the microsatellites were substantially lower in the Bolivian bufeos than in the dolphins studied in other areas of the Amazon and Orinoco. However, the DQB-1 gene sequences yielded similar genetic diversity to those found in other areas. The second relevant result is the existence of some significant genetic heterogeneity among the bufeo populations within Bolivia, although in a small degree, but this differentiation is independent of the inner rapids of the Bolivian rivers we sampled. The third relevant result was the existence of significant isolation by distance for the CR, but not for microsatellites and DQB-1 gene sequences. This was related to differential gene flow capacity of females (philopatric) and males (less philopatric and more migrants) and, possibly, to different selective patterns affecting the molecular markers studied. The fourth relevant result was related to diverse demographic changes of these bufeos. At least two or three bottleneck events and one or two population expansions have occurred in the Bolivian bufeo population. The major part of these events occurred during the Pleistocene.

Mitochondrial and Nuclear DNA Variants in Amyotrophic Lateral Sclerosis: Enrichment in the Mitochondrial Control Region and Sirtuin Pathway Genes in Spinal Cord Tissue.

Amyotrophic Lateral Sclerosis (ALS) is a progressive disease with prevalent mitochondrial dysfunctions affecting both upper and lower motor neurons in the motor cortex, brainstem, and spinal cord. Despite mitochondria having their own genome (mtDNA), in humans, most mitochondrial genes are encoded by the nuclear genome (nDNA). Our study aimed to simultaneously screen for nDNA and mtDNA genomes to assess for specific variant enrichment in ALS compared to control tissues. Here, we analysed whole exome (WES) and whole genome (WGS) sequencing data from spinal cord tissues, respectively, of 6 and 12 human donors. A total of 31,257 and 301,241 variants in nuclear-encoded mitochondrial genes were identified from WES and WGS, respectively, while mtDNA reads accounted for 73 and 332 variants. Despite technical differences, both datasets consistently revealed a specific enrichment of variants in the mitochondrial Control Region (CR) and in several of these genes directly associated with mitochondrial dynamics or with Sirtuin pathway genes within ALS tissues. Overall, our data support the hypothesis of a variant burden in specific genes, highlighting potential actionable targets for therapeutic interventions in ALS.

Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity >98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.

High throughput sequencing data reveals the complete mitogenome, abundance, maternal phylogeny, and mitogenomic diversity of Alectoris chukar of Iraq

Alectoris chukar is a wild game bird found in the north of Iraq, near the center of domestication and diversity of species. The mitogenome is one of the most vital resources for comprehensive studies of genetic diversity and molecular evolutionary relationships among avian species. In this study, we used whole genome sequencing raw reads and bioinformatics analysis to sequence and assemble Alectoris chukar's complete mitogenome for the first time. We also studied the maternal lineage and phylogenetic position of Alectoris chukar, as well as some mitogenomic diversity parameters. As a result, the complete mitogenomes with a length ranging from 16686 bp to 16688 bp of four individuals of wild Alectoris chukar were sequenced and assembled. They have a typical avian mitogenome structure with 2 ribosomal RNA (rRNA), 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, and one non-coding control region. Our findings from bioinformatics analysis remarkably demonstrated that copies of the mitogenome are more abundant in liver tissues than in blood and in the liver tissues of females than in males. The results of phylogenetic analysis clustered the studied mitogenomes with Alectoris chukar as a monophyletic clade. Moreover, in comparison to the different genera, Alectoris chukar showed a high level of mitogenomic similarities to the snowcock species of the genus Tetraogallus within the Phasianidae family. However, they were more distant from other partridges. Additionally, a high percentage of mitogenomic pairwise identities within Iraqi Alectoris chukar and high mitogenomic variations compared to Chinese populations were discovered. The number and location of polymorphic sites indicated that the majority of the mitogenome sequences were conserved, with the control region, ND5, and CYTB genes having the most polymorphic sites. Analyses of phylogenetic and mitogenomic diversity revealed that samples of Alectoris chukar from Iraq have a unique maternal lineage and mitogenomic diversity specific to their geographic distribution, suggesting an Alectoris chukar kurdestanica subspecies. The molecular findings presented here provide valuable knowledge and mitogenomic resources into the evolutionary relationships of Alectoris chukar from the Middle East to avian species in the Phasianidae family.
 Key words: DNA sequencing; Mitochondrial genome; Partridges; Phasianidae; Phylogeny

Guidelines and quantitative standards for improved cetacean taxonomy using full mitochondrial genomes.

In many organisms, especially those of conservation concern, traditional lines of evidence for taxonomic delineation, such as morphological data, are often difficult to obtain. In these cases, genetic data are often the only source of information available for taxonomic studies. In particular, population surveys of mitochondrial genomes offer increased resolution and precision in support of taxonomic decisions relative to conventional use of the control region or other gene fragments of the mitochondrial genome. To improve quantitative guidelines for taxonomic decisions in cetaceans, we build on a previous effort targeting the control region and evaluate, for whole mitogenome sequences, a suite of divergence and diagnosability estimates for pairs of recognized cetacean populations, subspecies, and species. From this overview, we recommend new guidelines based on complete mitogenomes, combined with other types of evidence for isolation and divergence, which will improve resolution for taxonomic decisions, especially in the face of small sample sizes or low levels of genetic diversity. We further use simulated data to assist interpretations of divergence in the context of varying forms of historical demography, culture, and ecology.

Association of tyrosine hydroxylase 01 (TH01) microsatellite and insulin gene (INS) variable number of tandem repeat (VNTR) with type 2 diabetes and fasting insulin secretion in Mexican population

PurposeA variable number of tandem repeats (VNTR) in the insulin gene (INS) control region may be involved in type 2 diabetes (T2D). The TH01 microsatellite is near INS and may regulate it. We investigated whether the TH01 microsatellite and INS VNTR, assessed via the surrogate marker single nucleotide polymorphism rs689, are associated with T2D and serum insulin levels in a Mexican population.MethodsWe analyzed a main case–control study (n = 1986) that used univariate and multivariate logistic regression models to calculate the risk conferred by TH01 and rs689 loci for T2D development; rs689 results were replicated in other case–control (n = 1188) and cross-sectional (n = 1914) studies.ResultsTH01 alleles 6, 8, 9, and 9.3 and allele A of rs689 were independently associated with T2D, with differences between sex and age at diagnosis. TH01 alleles with ≥ 8 repeats conferred an increased risk for T2D in males compared with ≤ 7 repeats (odds ratio, ≥ 1.46; 95% confidence interval, 1.1–1.95). In females, larger alleles conferred a 1.5-fold higher risk for T2D when diagnosed ≥ 46 years but conferred protection when diagnosed ≤ 45 years. Similarly, rs689 allele A was associated with T2D in these groups. In males, larger TH01 alleles and the rs689 A allele were associated with a significant decrease in median fasting plasma insulin concentration with age in T2D cases; the reverse occurred in controls.ConclusionLarger TH01 alleles and rs689 A allele may potentiate insulin synthesis in males without T2D, a process disabled in those with T2D.

Conservation initiatives of Syngnathiformes species in the southern Philippines: What does the mitochondrial DNA signature tell us?

Abstract Mitochondrial DNA signatures based on the control region and 12S rRNA gene were used to assess the impact of conservation measures on the effective management of vulnerable Syngnathiformes (seahorses, pipefishes, and allies) species. Results from phylogenetic inference, polymorphism, neutrality indices, haplotype networks and microhabitat information may justify the establishment of distinct management units for different species. For smooth seahorses, Hippocampus kuda was identified as a species complex that formed three clusters with 20 haplotypes. Based on molecular data, these are the first records of Hippocampus capensis and Hippocampus casscsio in the Philippines. High haplotype diversity (h = 28; Hd = 0.943), yet low nucleotide diversity (Pi:0.18095) for polymorphism, suggests minor differences among haplotypes. Neutrality indices calculated using Tajima's D (−2.00774), with P < 0.05 and Fu's Fs (−11.645), were significant. However, both tests were negative, a signature of rapid population expansion from a small effective population size, which could be attributed to past heavy harvests and habitat destruction, as supported by local data. For pipefishes and their allies, there was high haplotype diversity (h = 22; Hd = 0.875) and low nucleotide diversity of Pi: 0.16671. However, neutrality indices calculated using Tajima's D (−1.68518) and Fu's Fs (11.549) were not significant, with P > 0.05, indicating a balancing selection for this population. Results reveal that the recent population expansion of seahorses proves that current conservation measures are effectively safeguarding populations, while balancing selection is maintaining genetic polymorphism in pipefishes and their relatives, making them resilient to changing environments. Moreover, as revealed by haplotype networks, intraspecific variation suggests distinct management for different species. In addition, underwater surveys show an essential association between microhabitats and species' survival, thus encouraging future initiatives regarding habitat protection, especially coral reefs, seagrass beds, sponge gardens, mangrove areas and estuaries.

Mitochondrial DNA diversity and genetic structure of striped dolphin Stenella coeruleoalba in the Northern Ionian Sea

In the framework of global and EU policies focused on stopping the loss of biodiversity process, deepening the genetic variability, especially of populations species identified as threatened, is crucial for defining conservation units and developing appropriate conservation strategies. This is more urgent for cetacean species in the Mediterranean because they assume a key ecological role in the marine food web and are severely affected by numerous and different anthropogenic pressures. This study aims to increase information on the genetic variability of striped dolphin in the Northern Ionian Sea by investigating the population structure, phylogenetic relationships and phylogeographic patterns using two mtDNA markers. From October 2020 to August 2021, a total of 88 skin tissue samples were collected from free-ranging dolphins in the Gulf of Taranto by applying the non-invasive technique of skin swabbing. An acceptable amount of DNA was extracted from 86 samples and used for subsequent genetic analysis conducted on the partial sequences of 421 and 704 bp in length of the cytb gene and D-loop control region, respectively. In addition, the sequences of the two mtDNA markers were joined together to compose a mtDNA concatenated sequence of 1125 bp for each sampled dolphin in order to investigate the genetic variability of the species population in the study area. Genetic analysis highlighted a low nucleotide diversity and high haplotypic diversity of the striped dolphin of the Gulf of Taranto, suggesting a population in rapid expansion after a period of reduction in size and diversity of the initial population. The phylogenetic analyses revealed the presence of at least two different lineages of Stenella coeruleoalba in the Mediterranean Sea, one specific to the Northern Ionian Sea and one shared with the Mediterranean population, confirming results already obtained for the local unit in the Gulf of Taranto. The results point out a potential problem of hybridization between striped and common dolphins which needs to be further investigated. Therefore, increasing the analysis of several markers may increase understanding of the genetic diversity of the population in the Ionian Sea and represent a useful tool to support the implementation of future effective conservation measures.

Comparative analysis of the mitochondrial genome of Dermacentor steini from different regions in China.

Ticks are a group of blood-sucking ectoparasites that play an important role in human health and livestock production development as vectors of zoonotic diseases. The phylogenetic tree of single genes cannot accurately reflect the true kinship between species. Based on the complete mitochondrial genome analysis one can help to elucidate the phylogenetic relationships among species. In this study, the complete mitochondrial genome of Dermacentor steini (isolate Longyan) was sequenced and compared with the mitochondrial genes of 3 other Chinese isolates (Nanchang, Jinhua and Yingtan). In Dermacentor steini 4 isolates had identical or similar mitochondrial genome lengths and an overall variation of 0.76% between sequences. All nucleotide compositions showed a distinct AT preference. The most common initiation and stop codons were ATG and TAA, respectively. Fewer base mismatches were found in the tRNA gene of D. steini (isolate Longyan), and the vicinity of the control region and tRNA gene was a hot rearrangement region of the genus Dermacentor. Maximum likelihood trees and Bayesian trees indicate that D. steini is most closely related to Dermacentor auratus. The results enrich the mitochondrial genomic data of species in the genus Dermacentor and provide novel insights for further studies on the phylogeographic classification and molecular evolution of ticks.

Phylogeography of the Fiddler Crab Tubuca arcuata (Crustacea: Brachyura: Ocypodidae) in East Asia and Northern Vietnam.

The fiddler crab Tubuca arcuata (Crustacea: Ocypodidae: Gelasiminae) is widely distributed across East Asia and northern Vietnam. Particularly, this species inhabits estuarine mangroves and mudflats of the East Asian continent, as well as the main islands of Japan and the Ryukyus. By comparing sequences of the mitochondrial 16S, cytochrome oxidase subunit I (COI), and control region genes, two main clades of this species were elucidated. The northern (N) clade was mostly restricted to the region north of the Taiwan Strait, whereas the wide (W) clade could be found throughout the entire range inhabited by this species. Based on the distribution of the ancestral haplotypes of COI and the divergence time of the two clades, our findings suggest that the land bridge barrier present in the Taiwan Strait during glaciations might have played an important role in their cladogenesis, approximately 0.93 million years ago. Here, we propose that the distribution of the ancestral haplotype of the W clade in the Ryukyus and the main islands of Japan was determined by the Paleo-Kuroshio Current, whereas the modern distribution pattern is shaped by the modern Kuroshio Current and other warm currents during the crab reproduction season in the summer.

Steroidogenic enzymes in the hippocampus: Transcriptional regulation aspects.

Neurosteroids are steroids synthesized de novo from cholesterol in brain regions, and regulate processes associated with the development and functioning of the nervous system. Enzymes and proteins involved in the synthesis of these steroids have been detected in several brain regions, including hippocampus, hypothalamus, and cerebral cortex. Hippocampus has long been associated with learning and memory functions, while the loss of its functionality has been linked to neurodegenerative pathologies. In this sense, neurosteroids are critical for the maintenance of hippocampal functions and neuroprotective effects. Moreover, several factors have been shown to deregulate expression of steroidogenic enzymes in the rodent brain, including aging, enrichment experiences, diet habits, drug/alcohol consumption, hormone fluctuations, neurodegenerative processes and other diseases. These transcriptional deregulations are mediated mainly by transcription factors and epigenetic mechanisms. An epigenetic modification of chromatin involves changes in bases and associated proteins in the absence of changes in the DNA sequence. One of the most well-studied mechanisms related to gene silencing is DNA methylation, which involves a reversible addition of methyl groups in a cytosine base. Importantly, these epigenetic marks could be maintained over time and could be transmitted transgenerationally. The aim of this chapter is to present the most relevant steroidogenic enzymes described in rodent hippocampus; to discuss about their transcriptional regulation under different conditions; to show the main gene control regions and to propose DNA methylation as an epigenetic mechanism through which the expression of these enzymes could be controlled.

Comparative rapid identification of Salmo salar, Oncorhynchus mykiss, and Oncorhynchus keta components based on loop-mediated isothermal amplification and quantitative polymerase chain reaction

Rapid and correct detection methods to identify Salmon fish species and adulteration is an crucial way to control fraud behavior in the fish market. To identify the three major Salmon fish species including Salmo salar and its usual adulteration species Oncorhynchus mykiss and Oncorhynchus keta, this study mainly applied a quick, operation simple, equipment independent and visual method of Loop-Mediated Isothermal Amplification (LAMP) using specific primer sets designed based on the mitochondrial DNA control region (mtDNA CR) or Cytb gene of the targeted species. Meanwhile, quantitative polymerase chain reaction (qPCR) was used as a comparative method by designing specific primers and probes based on the genes of COI, mtDNA CR or Cytb. A primer set with high specificity for each species was successfully screened out for LAMP reactions in control with other six fish species which are commonly found in fish market. Comparatively, all primer/probe groups for qPCR reactions resulted in typical amplification curves of the target sequences but with non-specific amplification in the reaction of control samples. The relative systematic primers and methods of LAMP explored in this study can be successfully applied against the serious mislabels and adulterations in Salmon fish market.

Novel Insights Into the Genetic Population Connectivity of Transient Whale Sharks (Rhincodon typus) in Pacific Panama Provide Crucial Data for Conservation Efforts

The whale shark (Rhincodon typus) is an endangered and highly migratory species, of which solitary individuals or aggregations are observed in oceans worldwide and for which conservation efforts are hindered by a lack of comprehensive data on genetic population connectivity. Tissue samples were collected from wandering whale sharks in Pacific Panama to determine genetic diversity, phylogeographic origin, and possible global and local connectivity patterns using a 700–800 bp fragment of the mitochondrial control region gene. Genetic diversity among samples was high, with five new haplotypes and nine polymorphic sites identified among the 15 sequences. Haplotype diversity (Hd= 0.83) and nucleotide diversity (π = 0.00516) were similar to those reported in other studies. Our sequences, in particular haplotypesPTY1andPTY2, were similar to those previously reported in the Arabian Gulf and the Western Indian Ocean populations (a novel occurrence in the latter case). HaplotypesPTY3,PTY4, andPTY5were similar to populations in Mexico and the Gulf of California. In contrast, the only populations to which our Panamanian sequences were genetically dissimilar were those from the Atlantic Ocean. The absence of reference sequences in GenBank from southern sites in the Eastern Tropical Pacific, such as Galapagos (Ecuador), Gorgona and Malpelo Islands (Colombia), and Coco Island (Costa Rica), reduced our capacity to genetically define regional patterns. Genetic differentiation and connectivity were also assessed using an analysis of molecular variance (AMOVA), which showed a similar population structure (five groups) to the neighbor-joining tree. Other population features based on neutrality tests, such as Tajima’s D and Fu’sFsstatistics, showed positive values for Panama of 0.79 and 1.61, respectively. Positive values of these statistics indicate a lack of evidence for population expansion among the sampled individuals. Our results agree with previous reports suggesting that whale sharks can travel over long distances and that transboundary conservation measures may be effective for species protection.

Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women

BackgroundThe data with regards to the regional variants of distinct HPV types is of great value. Accordance with this, this study aimed to investigate the sequence variations of E6 gene and long control region of HPV 39 among normal, premalignant and malignant cervical samples in order to characterize the frequent HPV 39 variants circulating in Tehran, Iran.MethodsIn total, 70 cervical samples (45 normal, 16 premalignant, and 9 malignant samples) infected with HPV 39 were analyzed by nested-PCR and sequencing.ResultsOur results revealed that all samples belonged to A lineage. Almost all sequences (98.6%) were classified in A1 sublineage and only one sample (1.4%) was A2 sub lineage.ConclusionsOur findings showed that lineages A, sublineage A1, is dominant in Tehran, Iran. However, the small sample size was the most important limitations of this study. Further studies with larger sample size from different geographical regions of Iran are necessary to estimate the pathogenicity risk of HPV 39 variants in this population.

Sequencing and analysis of the complete mitochondrial genome of the lesser bandicoot rat (Bandicota bengalensis) from China and its phylogenetic analysis

The complete mitogenome sequence of the lesser bandicoot rat (Bandicota bengalensis Gray and Hardwicke, 1833) was determined using long PCR. The genome was 16,327 bp in length and contained 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, 1 origin of L strand replication and 1 control region. The overall base composition of the heavy strand is A (34.2%), C (24.9%), T (28.5%) and G (12.4%). The base compositions present clearly the A–T skew, which is most obviously in the control region and protein-coding genes. Mitochondrial genome analyses based on MP, ML, NJ and Bayesian analyses yielded identical phylogenetic trees. This study verifies the evolutionary status of Bandicota bengalensis in Muridae at the molecular level. The mitochondrial genome would be a significant supplement for the Bandicota bengalensis genetic background. The two Bandicota species formed a monophyletic group with the high bootstrap value (100%) in all examinations.

Molekularna filogenija i genetička raznolikost domaćih jakova (Bos grunniens) u Pakistanu na temelju mitohondrijskih i mikrosatelitskih markera

The complete Cytchrome b gene and partial mtDNA control region were sequenced for the Pakistani domestic yak (Bos grunniens) within the Bovidae family. A total of 300 samples were genotyped using 27 bovine microsatellite markers from the Gilgit-Baltistan and Skardu regions of Pakistan. We identified a total of 35 mutations and 9 haplotypes based on D-loop sequences, with a haplotype and nucleotide diversity of 0.9640±0.051 and 0.02172±0.00224, respectively. For the Cyt b gene, a total of 23 variable sites and six different haplotypes were observed with 0.885±0.067 haplotype and 0.00989±0.003 nucleotide diversity. Phylogenetic analysis of D-loop and Cyt b gene suggested that domestic yak sequences cluster into two highly divergent maternal lineages (lineages I and II), while three haplogroups A, C, and D were identified of the six previously known haplogroups. Haplogroups A and C were dominant and widely distributed among all investigated yak samples. All microsatellites were polymorphic and a total of 138 alleles were observed, with average polymorphic information content (PIC) of 0.56 indicating their effectiveness. The average heterozygosity was observed at 0.6071 with allele diversity of 5.1111 and gene diversity of 0.4830. The implications of these findings can be applied for yak conservation.

Sequencing and analysis of the complete mitochondrial genome of Ochotona hyperborea from China and its phylogenetic analysis

The complete mitogenome sequence of Ochotona hyperborea was determined using long PCR. The genome was 17,063 bp in length and contained 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, one origin of L strand replication, and one control region. The overall base composition of the heavy strand is A (31.1%), C (28.7%), T (26.3%), and G (13.9%). The base compositions present clearly the A–T skew, which is most obvious in the control region and protein-coding genes. Mitochondrial genome analyses based on MP, ML, NJ, and Bayesian analyses yielded identical phylogenetic trees. This study verifies the evolutionary status of Ochotona hyperborea in Ochotonidae at the molecular level. The mitochondrial genome would be a significant supplement for the Ochotona hyperborea genetic background. The eight Ochotona species formed a monophyletic group with the high bootstrap value (100%) in all examinations.

Метилирование генов TLR2 и импринтинг-контролирующей области IGF2/H19 в плазме крови при задержке роста плода

Метилирование генов TLR2 и импринтинг-контролирующей области IGF2/H19 в плазме крови при задержке роста плода