GC-rich Elements Research Articles

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Sp3 is involved in the regulation of SOCS3 gene expression

Cytokine-induced expression of SOCS (suppressor of cytokine signalling) molecules is important for the negative regulatory control of STAT (signal transduction and activators of transcription)-dependent cytokine signalling, e.g. for the signal transduction of IL-6 (interleukin-6)-type cytokines through the JAK (Janus kinase)/STAT cascade. STAT activation itself represents an important step in the transcriptional activation of SOCS3 gene expression. However, downstream of the STAT-responsive element, the SOCS3 gene contains a GC-rich element in its 5'-upstream region. The aim of the present study was to investigate the implications of this GC-rich element in the transcriptional control of SOCS3 gene expression. In the present study, we show that mutation of this GC-rich element abolishes IL-6-dependent transcriptional activation of the SOCS3 promoter and that Sp3 (specificity protein 3), a ubiquitously expressed transcription factor, but not Sp1 binds to this GC-rich motif, suggesting that Sp3 is involved in the regulation of SOCS3 expression. The results suggest that Sp3 is important for IL-6-induced transcriptional activation of the SOCS3 (gene) promoter and acts as an enhancer of basal as well as induced transcriptional activity, resulting in enhanced SOCS3 mRNA and protein expression. Mutation of Lys-483, a potential target for Sp3 acetylation, inhibited Sp3-mediated enhancement of SOCS3 mRNA expression and SOCS3 promoter activation, indicating that the acetylation of this lysine residue of Sp3 is important for the enhancing effect of Sp3 on SOCS3 expression.

Phylogenetic footprinting and genome scanning identify vertebrate BMP response elements and new target genes

The complex gene regulatory networks governed by growth factor signaling are still poorly understood. In order to accelerate the rate of progress in uncovering these networks, we explored the usefulness of interspecies sequence comparison (phylogenetic footprinting) to identify conserved growth factor response elements. The promoter regions of two direct target genes of Bone Morphogenetic Protein (BMP) signaling in Xenopus, Xvent2 and XId3, were compared with the corresponding human and/or mouse counterparts to identify conserved sequences. A comparison between the Xenopus and human Vent2 promoter sequences revealed a highly conserved 21 bp sequence that overlaps the previously reported Xvent2 BMP response element (BRE). Reporter gene assays using Xenopus animal pole ectodermal explants (animal caps) revealed that this conserved 21 bp BRE is both necessary and sufficient for BMP responsiveness. We combine the same phylogenetic footprinting approach with luciferase assays to identify a highly conserved 49 bp BMP responsive region in the Xenopus Id3 promoter. GFP reporters containing multimers of either the Xvent2 or XId3 BREs appear to recapitulate endogenous BMP signaling activity in transgenic Xenopus embryos. Comparison of the Xvent2 and the XId3 BRE revealed core sequence features that are both necessary and sufficient for BMP responsiveness: a Smad binding element (SBE) and a GC-rich element resembling an OAZ binding site. Based on these findings, we have implemented genome scanning to identify over 100 additional putative target genes containing 2 or more BRE-like sequences which are conserved between human and mouse. RT-PCR and in situ analyses revealed that this in silico approach can effectively be used to identify potential BMP target genes.

Molecular Mechanism of Inhibition of Survivin Transcription by the GC-rich Sequence-selective DNA Binding Antitumor Agent, Hedamycin: EVIDENCE OF SURVIVIN DOWN-REGULATION ASSOCIATED WITH DRUG SENSITIVITY

Expression of the antiapoptotic protein survivin is associated with cancer cell viability and drug resistance. Thus, control of its expression in cancer cells has significant consequences for cancer therapeutics. Here we have shown that hedamycin, a GC-rich DNA binding drug, down-regulated survivin expression. Using a series of survivin promoter-luciferase constructs, we have identified an 86-bp GC-rich DNA element (-124 to -39) that mediates the ability of hedamycin to down-regulate survivin expression. Furthermore, both in vivo foot-printing and in vitro gel mobility shift experiments revealed that hedamycin bound to a 21-bp GC-rich DNA element (-115 to -95) in the survivin promoter. This drug-DNA interaction abrogated the binding of Sp-1 or Sp1-like proteins to the 21-bp cis-acting DNA element, and mutagenesis of this region consistently diminished survivin promoter activity. Finally, down-regulation of survivin transcription by hedamycin modulated the viability of cancer cells. These data suggest that abrogation of Sp-1 or Sp1-like protein binding to the 21-bp DNA element in the survivin promoter contributes at least in part to the inhibitory effect of hedamycin on survivin gene transcription. Drug-induced modulation of survivin gene expression may provide novel approaches for cancer therapeutics.

Analysis of Estrogen Receptor α-Sp1 Interactions in Breast Cancer Cells by Fluorescence Resonance Energy Transfer

Estrogen-dependent regulation of several genes associated with cell cycle progression, proliferation, and nucleotide metabolism in breast cancer cells is associated with interactions of estrogen receptor (ER)alpha/Sp1 with GC-rich promoter elements. This study investigates ligand-dependent interactions of ERalpha and Sp1 in MCF-7 breast cancer cells using fluorescence resonance energy transfer (FRET). Chimeric ERalpha and Sp1 proteins fused to cyan fluorescent protein or yellow fluorescent protein were transfected into MCF-7 cells, and a FRET signal was induced after treatment with 17beta-estradiol, 4'-hydroxytamoxifen, or ICI 182,780. Induction of FRET by these ERalpha agonists/antagonists was paralleled by their activation of gene expression in cells transfected with a construct (pSp1(3)) containing three tandem Sp1 binding sites linked to a luciferase reporter gene. In contrast, interactions between ERalpha and Sp1DeltaDBD [a DNA binding domain (DBD) deletion mutant of Sp1] are not observed, and this is consistent with the critical role of the C-terminal DBD of Sp1 for interaction with ERalpha. Results of the FRET assay are consistent with in vitro studies on ERalpha/Sp1 interactions and transactivation, and confirm that ERalpha and Sp1 interact in living breast cancer cells.

Sp3 Proteins Negatively Regulate β Myosin Heavy Chain Gene Expression during Skeletal Muscle Inactivity

In adult skeletal muscle, beta myosin heavy chain (betaMyHC) gene expression is primarily restricted to slow type I fibers; however, its expression is down-regulated in response to muscle inactivity. Little is known about the signaling pathways and transcription factors that mediate this important functional response. This study demonstrates that increased binding of Sp3 to GC-rich elements in the betaMyHC promoter is a critical event in down-regulation of betaMyHC gene expression under non-weight-bearing conditions. Conversely, binding of Sp3 to these elements decreased while Sp1 binding increased with nuclear extracts from plantaris muscle exposed to mechanical overload, a stimulus that increases betaMyHC gene expression. In addition, these experiments revealed the existence of an Sp4-DNA binding complex when using adult skeletal muscle nuclear extract was used but not when nuclear extracts from cultured myotubes were used. Sp3 proteins are competitive inhibitors of Sp1-mediated betaMyHC reporter gene transactivation in both Drosophila SL-2 and mouse C2C12 myotubes. Sp4 is a weak activator of betaMyHC gene expression in SL-2 cells, which lack endogenous Sp1 activity, but does not activate betaMyHC gene expression in C2C12 myotubes, which have high levels of Sp1. These results suggest that competitive binding of Sp family proteins regulate betaMyHC gene transcription in response to altered neuromuscular activity.

Requirement of Krüppel-like Factor 4 in Preventing Entry into Mitosis following DNA Damage

Previous studies indicate that Krüppel-like factor 4 (KLF4 or GKLF) controls the G1/S cell cycle checkpoint upon DNA damage. We present evidence for an equally important role of KLF4 in maintaining the integrity of the G2/M checkpoint following DNA damage. HCT116, a colon cancer cell line with wild type p53 alleles, underwent sustained G2 arrest up to 4 days after gamma-irradiation. In contrast, HCT116 cells null for p53 were able to enter mitosis following irradiation. Western blot analyses of irradiated HCT116 cells showed increased levels of p53, KLF4, and p21WAF1/CIP1 and decreased levels of cyclin B1 when compared with unirradiated controls. In contrast, the levels of cyclin B1 increased in irradiated HCT116 p53-/- cells, in which KLF4 failed to increase due to the absence of p53. When KLF4 was inhibited by small interfering RNA, irradiated HCT116 cells exhibited increased mitotic indices and a rise in cyclin B1 levels. Conversely, irradiated HCT116 p53-/- cells that were infected with KLF4-expressing adenoviruses demonstrated a concurrent reduction in mitotic indices and cyclin B1 levels. In each case, Cdc2 kinase measurements showed an inverse correlation between Cdc2 kinase activities and KLF4 levels. Co-transfection experiments showed that KLF4 repressed the cyclin B1 promoter through a specific GC-rich element. Moreover, chromatin immunoprecipitation experiments demonstrated that both KLF4 and HDAC were associated with the cyclin B1 promoter in irradiated HCT116 cells. We conclude that KLF4 is essential in preventing mitotic entry following gamma-irradiation and does so by inhibiting cyclin B1 expression.

Helicobacter pylori stimulates host vascular endothelial growth factor-A (vegf-A) gene expression via MEK/ERK-dependent activation of Sp1 and Sp3.

VEGF-A is a key regulator of inflammatory and tumor-associated angiogenesis. H. pylori plays a critical role in the pathogenesis of benign and malignant gastric diseases. It has been suggested that H. pylori infection is associated with activation of host angiogenesis, however, underlying mechanisms as well as angiogenic growth factors activated by the bacterium have not yet been identified. Therefore, we investigated the influence of the bacterium on VEGF-A as a candidate host target gene in vivo and in vitro. We show that H. pylori potently up-regulates production and release of VEGF-A protein as well as vegf-A mRNA levels, and we provide strong evidence that enhanced recruitment of Sp1 and Sp3 transcription factors to two proximal GC-rich vegf-A promoter elements mediates H. pylori-triggered vegf-A gene expression. In addition, H. pylori infection increased the transactivating capacity of both Sp1 and Sp3, which suggests additional mechanism(s) of vegf-A gene regulation by the bacterium. Signaling studies identified the MEK>ERK1/-2 kinase cascade as principal host signaling pathway mediating H. pylori-stimulated vegf-A transcription. By identifying H. pylori as potent activator of vegf-A gene expression and characterization of underlying molecular mechanisms, our results provide novel insights into pathways linking the bacterium to host angiogenesis and may help to develop strategies to influence vegf-A gene expression in the setting of H. pylori infection.

Involvement of the Histone Deacetylase SIRT1 in Chicken Ovalbumin Upstream Promoter Transcription Factor (COUP-TF)-interacting Protein 2-mediated Transcriptional Repression

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 (CTIP1 and CTIP2) enhance transcriptional repression mediated by COUP-TF II and have been implicated in hematopoietic cell development and malignancies. CTIP1 and CTIP2 are also sequence-specific DNA-binding proteins that repress transcription through direct, COUP-TF-in-dependent binding to a GC-rich response element. CTIP1- and CTIP2-mediated transcriptional repression is insensitive to trichostatin A, an inhibitor of known class I and II histone deacetylases. However, chromatin immunoprecipitation assays revealed that expression of CTIP2 in mammalian cells resulted in deacetylation of histones H3 and/or H4 that were associated with the promoter region of a reporter gene. CTIP2-mediated transcriptional repression, as well as deacetylation of promoter-associated histones H3/H4 in CTIP2-transfected cells, was reversed by nicotinamide, an inhibitor of class III histone deacetylases such as the mammalian homologs of yeast Silent Information Regulator 2 (Sir2). The human homolog of yeast Sir2, SIRT1, was found to interact directly with CTIP2 and was recruited to the promoter template in a CTIP2-dependent manner. Moreover, SIRT1 enhanced the deacetylation of template-associated histones H3/H4 in CTIP2-transfected cells, and stimulated CTIP2-dependent transcriptional repression. Finally, endogenous SIRT1 and CTIP2 co-purified from Jurkat cell nuclear extracts in the context of a large (1-2 mDa) complex. These findings implicate SIRT1 as a histone H3/H4 deacetylase in mammalian cells and in transcriptional repression mediated by CTIP2.

Modulation of DNA topoisomerase IIα promoter activity by members of the Sp (specificity protein) and NF-Y (nuclear factor Y) families of transcription factors

Topo IIalpha (topoisomerase IIalpha) is a major target of several commonly used anticancer drugs and is subject to down-regulation at the transcriptional level in some drug-resistant cell lines and tumours in response to chemotherapy. Clinical resistance to such drugs has been correlated with down-regulation of topo IIalpha at transcription in some drug-resistant cell lines and tumours. Putative binding sites for a variety of transcription factors, including Sp1 (specificity protein 1) and NF-Y (nuclear factor Y) have previously been identified in the topo IIalpha promoter, but their functional significance and interactions have not been described following exposure to anti-cancer drugs. The binding of these factors to specific putative regulatory elements in the topo IIalpha promoter was studied using electrophoretic-mobility-shift assays. Sp1 was found to bind strongly to both distal and proximal GC-rich elements and NF-Y to ICB1 (the first inverted CCAAT box). The functional significance of transcription-factor binding was studied using transient transfection of HeLa cells using a luciferase reporter driven by a 617-bp minimal promoter containing point mutations in putative regulatory elements. Sp1 and NF-Y were both found to be transcriptional modulators with activator or repressor functions depending on protein/DNA context. Moreover, a functional interaction between Sp1 and NF-Y bound at proximal elements was observed.

Cyclic adenosine monophosphate (cAMP) stimulation of the kit ligand promoter in sertoli cells requires an Sp1-binding region, a canonical TATA box, and a cAMP-induced factor binding to an immediately downstream GC-rich element.

Expression of Kit ligand (KL) mRNA is induced in primary prepuberal Sertoli cells by FSH and by other agents that increase cAMP levels. The cAMP effect is exerted at the transcriptional level and appears to be cell type specific, since it is not observed in other KL-expressing primary cells or cell lines. Deletion analysis of the 5'-flanking region of the mouse KL gene shows that the proximal promoter sequence between -88 and +8 from the transcriptional start site is necessary and sufficient to obtain the full cAMP responsiveness of the promoter in primary mouse Sertoli cells. In the -88/+8 promoter region, several cis-acting elements play a role in cAMP response. The -88/-56 sequence is necessary for full induction of the gene, since its removal causes a drastic decrease in cAMP responsiveness; however, cAMP-stimulated expression is still observed with the minimal promoter region between -55 and +8. A more detailed mutational analysis of the minimal promoter region shows that mutations in the canonical TATA box sequence and in an immediately downstream GC-rich element completely abolish cAMP responsiveness. DNA-binding experiments show that transcription factor Sp1 binds to the -88/-56 fragment of the KL proximal promoter in both control and cAMP-stimulated cells, whereas a new cAMP-induced complex is observed when the -55/+8 minimal promoter region is used as probe. The canonical TATA box sequence is essential for formation of the latter complex. We also show that the binding of an unknown nuclear factor (different from Sp1, Egr-1, Rnf6, and AP-2) to a GC-rich element between -19 and +8 increases after cAMP treatment, and this effect seems to be specific of primary Sertoli cells. Thus, cAMP-induced transcription from the KL gene promoter in primary mouse Sertoli cells is mediated by a complex interaction among a Sp1-binding region, factors recognizing the canonical TATA box sequence, and a not yet identified cAMP-induced factor binding a GC-rich sequence just downstream from it.

17Beta-estradiol inhibits MCP-1 production in human keratinocytes.

A chemokine, monocyte chemoattractant protein 1 (MCP-1), attracts macrophages. The production of MCP-1 is enhanced in keratinocytes of psoriatic lesions, which may contribute to macrophage infiltration into the lesions. It is known that estrogen regulates the course of psoriasis. We examined in vitro effects of 17beta-estradiol (E2) on MCP-1 production by human keratinocytes. E2 inhibited constitutive and 12-O-tetradecanoylphorbol-13-acetate-induced MCP-1 secretion, mRNA expression, and promoter activity in keratinocytes, and these effects of E2 were counteracted by estrogen receptor antagonist ICI 182 780. GC-rich Sp1 element and activator protein 1 (AP-1) element on MCP-1 promoter were required for constitutive and 12-O-tetradecanoylphorbol-13-acetate-induced transcription, respectively, and involved in transrepression by E2. E2 inhibited constitutive Sp1 and 12-O-tetradecanoylphorbol-13-acetate-induced AP-1 transcriptional activities whereas it did not inhibit DNA binding of Sp1 or AP-1 c-Fos/c-Jun. E2 inhibited Sp1 and AP-1 transcriptional activities and MCP-1 promoter activity in estrogen receptor beta (ERbeta) transfected SKBR3 cells. Deletion of the A/B region or mutation of activation function 2 in ERbeta abrogated E2-dependent transcriptional inhibition by ERbeta whereas mutation of DNA-binding domain retained the inhibitory effects. Transfection of ERbeta enhanced the inhibitory effects of E2 on Sp1 and AP-1 transcriptional activities and MCP-1 promoter activities in nontransfected keratinocytes. Coimmunoprecipitation studies showed an E2-dependent association of ERbeta with Sp1 or AP-1 in ERbeta-transfected keratinocytes. These results suggest that E2-bound ERbeta may inhibit MCP-1 gene expression by inhibiting Sp1 and AP-1 transcriptional activities in keratinocytes. A/B region and intact activation function 2 of ERbeta may be responsible for the effects of E2.

17β-Estradiol Inhibits MCP-1 Production in Human Keratinocytes

A chemokine, monocyte chemoattractant protein 1 (MCP-1), attracts macrophages. The production of MCP-1 is enhanced in keratinocytes of psoriatic lesions, which may contribute to macrophage infiltration into the lesions. It is known that estrogen regulates the course of psoriasis. We examined in vitro effects of 17β-estradiol (E2) on MCP-1 production by human keratinocytes. E2 inhibited constitutive and 12-O-tetradecanoylphorbol-13-acetate-induced MCP-1 secretion, mRNA expression, and promoter activity in keratinocytes, and these effects of E2 were counteracted by estrogen receptor antagonist ICI 182 780. GC-rich Spl element and activator protein 1 (AP-1) element on MCP-1 promoter were required for constitutive and 12-O-tetradecanoylphorbol-13-acetate-induced transcription, respectively, and involved in transrepression by E2. E2 inhibited constitutive Spl and 12-O-tetradecanoylphorbol-13-acetate-induced AP-1 transcriptional activities whereas it did not inhibit DNA binding of Sp1 or AP-1 c-Fos/c-Jun. E2 inhibited Sp1 and AP-1 transcriptional activities and MCP-1 promoter activity in estrogen receptor P (ERβ) transfected SKBR3 cells. Deletion of the A/B region or mutation of activation function 2 in ERβ abrogated E2-dependent transcriptional inhibition by ERβ whereas mutation of DNA-binding domain retained the inhibitory effects. Transfection of ERβ enhanced the inhibitory effects of E2 on Sp1 and AP-1 transcriptional activities and MCP-1 promoter activities in nontransfected keratinocytes. Coimmunoprecipitation studies showed an E2-dependent association of ERβ with Sp1 or AP-1 in ERβ-transfected keratinocytes. These results suggest that E2-bound ERβ may inhibit MCP-1 gene expression by inhibiting Sp1 and AP-1 transcriptional activities in keratinocytes. A/B region and intact activation function 2 of ERβ may be responsible for the effects of E2.

Phosphorylation of Kruppel-like factor 5 (KLF5/IKLF) at the CBP interaction region enhances its transactivation function.

The Kruppel-like factor 5 (KLF5/IKLF) belongs to the Kruppel family of genes which bind GC-rich DNA elements and activate or repress their target genes in a promoter context and/or cellular environment-dependent manner. In the present study, we used the Gal4 fusion assay system to characterize the mechanism of transactivation by KLF5. We demonstrated that the transactivation function of KLF5 was enhanced by CREB-binding protein (CBP) and blocked by wild-type but not mutant E1A. Over expression of CBP reversed the inhibition effect of E1A. With various lengths of KLF5 fusion protein, the transactivation functions were localized to 156 amino acid residues at the N-terminal region and 133 amino acid residues adjacent to the Zn finger motif. We mapped the CBP and KLF5 interaction domain to the N-terminal region of CBP (amino acids 1-232) and the N-terminal region of KLF5 (amino acids 1-238) where one of the activation functions resides. The histone acetyltransferase (HAT) activity of CBP does not play a role in the transactivation function of KLF5 nor does it acetylate KLF5 in vitro. However, phosphorylation is important in KLF5 transactivation activity. Inhibition of protein kinase activity by H7 or calphostin C blocked both full-length and N-terminal fragment (amino acids 1-238) KLF5 activities. Mutation at a potential protein kinase C phosphorylation site within the CBP interaction domain of KLF5 reduces its transactivation function. Furthermore, using the GST pull-down approach, we showed that phosphorylation of KLF5 enhances its interaction with CBP. The results of the present study provide a mechanism for KLF5 transactivation function.

Expression of α-ENaC2 is dependent on an upstream Sp1 binding motif and is modulated by protein phosphatase 1 in lung epithelial cells

The amiloride-sensitive Na + channel ENaC is expressed in lung epithelium and plays a pivotal role in lung fluid clearance in the newborn. Multiple splice variants of the ENaC α-subunit have been reported. Among them, α-ENaC2 accounts for a considerable portion of α-ENaC transcripts in human lung and kidney, possesses channel functions similar to α-ENaC1, and is driven by a downstream promoter. In the current study, we examine the regulation of α-ENaC2 transcription in lung epithelial cells. We found that transcription factors Sp1 and Sp3 activate α-ENaC2 transcription through a GC-rich element (Sp1-binding site) in the promoter. Because α-ENaC expression and Sp1 phosphorylation are both significantly up-regulated in the perinatal lung, we then examined the possible connection between Sp1/Sp3 phosphorylation and α-ENaC2 expression. We found that protein phosphatase 1 (PP1) dephosphorylates Sp1 and Sp3 in lung epithelial cells, reduces their binding to the α-ENaC2 promoter, and decreases Sp1/Sp3-mediated promoter activity. Our results suggest that Sp1 and Sp3 are essential for α-ENaC2 transcription in lung epithelial cells and that dephosphorylation of the Sp transcription factors by PP1 suppresses α-ENaC2 expression. The significance of these findings in the regulation of gene expression in perinatal lung is discussed.

Oxidative Stress Regulates Vascular Endothelial Growth Factor-A Gene Transcription through Sp1- and Sp3-dependent Activation of Two Proximal GC-rich Promoter Elements

Enhanced VEGF-A (vascular endothelial growth factor A) gene expression is associated with increased tumor growth and metastatic spread of solid malignancies including gastric cancer. Oxidative stress has been linked to tumor-associated neoangiogenesis; underlying mechanisms, however, remained poorly understood. Therefore, we studied the effect of oxidative stress on VEGF-A gene expression in gastric cancer cells. Oxidative stress generated by H(2)O(2) application potently stimulated VEGF-A protein and mRNA levels as determined by enzyme-linked immunosorbent assay and real-time PCR techniques, respectively, and elevated the activity of a transfected (-2018) VEGF-A promoter reporter gene construct in a time- and dose-dependent manner (4-8-fold). These effects were abolished by the antioxidant N-acetylcysteine, demonstrating specificity of oxidative stress responses. Functional 5' deletion analysis mapped the oxidative stress response element of the human VEGF-A promoter to the sequence -88/-50, and a single copy of this element was sufficient to confer basal promoter activity as well as oxidative stress responsiveness to a heterologous promoter system. Combination of EMSA studies, Sp1/Sp3 overexpression experiments in Drosophila SL-2 cells, and systematic promoter mutagenesis identified enhanced Sp1 and Sp3 binding to two GC-boxes at -73/-66 and -58/-52 as the core mechanism of oxidative stress-triggered VEGF-A transactivation. Additionally, in Gal4-Sp1/-Sp3-Gal4-luciferase assays, oxidative stress increased Sp1 but not Sp3 transactivating capacity, indicating additional mechanism(s) of VEGF-A gene regulation. Signaling studies identified a cascade comprising Ras --> Raf --> MEK1 --> ERK1/2 as the main pathway mediating oxidative stress-stimulated VEGF-A transcription. This study for the first time delineates the mechanisms underlying regulation of VEGF-A gene transcription by oxidative stress and thereby further elucidates potential pathways underlying redox control of neoangiogenesis.

ERK1/2-dependent contractile protein expression in vascular smooth muscle cells.

In vivo, vascular smooth muscle (VSM) cells change their contractile phenotype toward a more proliferative phenotype during the pathogenesis of vascular diseases. Because these dedifferentiated VSM cells may gradually regain contractile functions, we aimed to identify signaling pathways that result in an increased expression of contractile proteins in VSM cells. In vitro, serum and thrombin induced a reversible upregulation of smooth muscle myosin heavy-chain (SM-MHC) in cultured neonatal rat VSM cells. Cotransfection of a SM-MHC-promoter chloramphenicol acetyltransferase-construct with dominant-negative N17Ras or N17Raf or treatment with the mitogen-activated/ERK-activating kinase (MEK) inhibitor PD 98059 concentration dependently decreased the serum- or thrombin-induced SM-MHC promoter activity. Consistently, the serum- or thrombin-induced phosphorylation of MEK and extracellular signal-regulated kinase 1/2 (ERK1/2) coincided with a MEK-dependent nuclear accumulation of phosphorylated ERK1/2 and subsequent nuclear phosphorylation of the transcription factors c-myc and Elk-1. A 5'-deletion analysis of cis-elements within the SM-MHC promoter demonstrated that a conserved region (nucleotide -1346 to -1102) was required for both cell type-specific expression and serum- or thrombin-induced upregulation of the SM-MHC promoter in VSM cells. Within this region, 2 CArG-boxes, a GC-rich element, and a CTF/NF-1 site are critical positively acting cis-elements for the serum- or thrombin-induced upregulation of SM-MHC. We conclude that the serum- or thrombin-induced differentiation requires an intact Ras/Raf/MEK/ERK signaling cascade, nuclear translocation of activated ERK1/2, phosphorylation of transcription factors, and several cis-elements within the SM-MHC promoter.

The zinc finger transcription factor ZBP-89 is a repressor of the human β2-integrin CD11bgene

AbstractIntegrin CD11b is a differentiation marker of the myelomonocytic lineage and an important mediator of inflammation. Expression of theCD11bgene is transcriptionally induced as myeloid precursors differentiate into mature cells, then drops as monocytes further differentiate into macrophages. Previous studies have identified elements and factors involved in the transcriptional activation of the CD11bgene during myeloid differentiation, but no data exist regarding potential down-regulatory factors, especially in the later stages of differentiation. Using 2 copies of a GC-rich element (−141 to −110) in the CD11bpromoter, we probed a cDNA expression library for interacting proteins. Three clones were identified among 9.1 million screened, all encoding the DNA-binding domain of the zinc finger factor ZBP-89. Overexpression of ZBP-89 in the monocyte precursor cell line U937 reducedCD11b promoter-driven luciferase activity when U937 cells were induced to differentiate into monocytelike cells using phorbol esters. To identify the differentiation stage at which ZBP-89 repression of the CD11bgene is exerted, the protein level of ZBP-89 was correlated with that of CD11b mRNA in differentiating U937 as well as in normal human monocytes undergoing in vitro differentiation into macrophages. A clear inverse relationship was observed in the latter but not the former state, suggesting that ZBP-89 represses CD11bgene expression during the further differentiation of monocytes into macrophages.

Five-member gene family of Bartonella quintana.

Bartonella quintana, the agent of trench fever and an etiologic agent of bacillary angiomatosis, has an extraordinarily high hemin requirement for growth compared to other bacterial pathogens. We previously identified the major hemin receptor of the pathogen as a 30-kDa surface protein, termed HbpA. This report describes four additional homologues that share approximately 48% amino acid sequence identity with hbpA. Three of the genes form a paralagous cluster, termed hbpCAB, whereas the other members, hbpD and hbpE, are unlinked. Secondary structure predictions and other evidence suggest that Hbp family members are beta-barrels located in the outer membrane and contain eight transmembrane domains plus four extracellular loops. Homologs from a variety of gram-negative pathogens were identified, including Bartonella henselae Pap31, Brucella Omp31, Agrobacterium tumefaciens Omp25, and neisserial opacity proteins (Opa). Family members expressed in vitro-synthesized proteins ranging from ca. 26.5 to 35.1 kDa, with the exception of HbpB, an approximately 55.9-kDa protein whose respective gene has been disrupted by a approximately 510 GC-rich element containing variable-number tandem repeats. Transcription analysis by quantitative reverse transcriptase-PCR (RT-PCR) indicates that all family members are expressed under normal culture conditions, with hbpD and hbpB transcripts being the most abundant and the rarest, respectively. Mutagenesis of hbpA by allelic exchange produced a strain that exhibited an enhanced hemin-binding phenotype relative to the parental strain, and analysis by quantitative RT-PCR showed elevated transcript levels for the other hbp family members, suggesting that compensatory expression occurs.

Egr-1 induction in rat granulosa cells by follicle-stimulating hormone and luteinizing hormone: combinatorial regulation by transcription factors cyclic adenosine 3',5'-monophosphate regulatory element binding protein, serum response factor, sp1, and early growth response factor-1.

Early growth response factor (Egr-1) is an inducible zinc finger transcription factor that binds specific GC-rich enhancer elements and impacts female reproduction. These studies document for the first time that FSH rapidly induces Egr-1 expression in granulosa cells of small growing follicles. This response is transient but is reinitiated in preovulatory follicles exposed to the LH analog, human chorionic gonadotropin. Immunohistochemical analysis also showed gonadotropin induced Egr-1 in theca cells. The Egr-1 gene regulatory region responsive to gonadotropin signaling was localized within -164 bp of the transcription initiation site. Binding of Sp1/Sp3 to a proximal GC-box at -64/-46 bp was enhanced by FSH in immature granulosa cells but reduced after human chorionic gonadotropin stimulation of preovulatory follicles despite constant protein expression. This dynamic regulation of Sp1 binding was dependent on gonadotropin-regulated mechanisms that modulate Sp1/3-DNA binding activity. Serum response factor was active in granulosa cells and bound a consensus CArG-box/serum response element site, whereas two putative cAMP response elements within the -164-bp region bound cAMP regulatory element (CRE) binding protein (CREB) and a second cAMP-inducible protein immunologically related to CREB. Transient transfection analyses using Egr-1 promoter-luciferase constructs and site-specific mutations show that the serum response element, GC-box, and CRE-131 are involved in gonadotropin regulation of Egr-1 expression in granulosa cells. Specific kinase inhibitors of Erk or protein kinase A antagonized this induction while exogenously expressed Egr-1 enhanced reporter expression. These observations indicate that the Egr-1 gene is a target of both FSH and LH action that may mediate molecular programs of proliferation and/or differentiation during follicle growth, ovulation, and luteinization.