Gall Symptoms Research Articles

Hypoxic Conditions in Crown Galls Induce Plant Anaerobic Responses That Support Tumor Proliferation.

Agrobacterium tumefaciens infection of wounded plant tissues causes the formation of crown gall tumors. Upon infection, genes encoded on the A. tumefaciens tumor inducing plasmid are integrated in the plant genome to induce the biosynthesis of auxin and cytokinin, leading to uncontrolled cell division. Additional sequences present on the bacterial T-DNA encode for opine biosynthesis genes, which induce the production of opines that act as a unique carbon and nitrogen source for Agrobacterium. Crown galls therefore become a very strong sink for photosynthate. Here we found that the increased metabolic demand in crown galls causes an increase in oxygen consumption rate, which leads to a steep drop in the internal oxygen concentration. Consistent with this, plant hypoxia-responsive genes were found to be significantly upregulated in crown galls compared to uninfected stem tissue. Following this observation, we aimed at understanding whether the low-oxygen response pathway, mediated by group VII ethylene response factor (ERF-VII) transcription factors, plays a role in the development of crown galls. We found that quintuple knock-out mutants of all ERF-VII members, which are incapable of inducing the hypoxic response, show reduced crown gall symptoms. Conversely, mutant genotypes characterized by constitutively high levels of hypoxia-associated transcripts, displayed more severe crown gall symptoms. Based on these results, we concluded that uncontrolled cell proliferation of crown galls established hypoxic conditions, thereby requiring adequate anaerobic responses of the plant tissue to support tumor growth.

First Report of the Root-Knot Nematode, Meloidogyne floridensis Infecting Guardian® Peach Rootstock in South Carolina, USA.

In 2018 to 2019, soil and root samples from some declining peach orchards were collected in Edgefield County, South Carolina, USA. Excavated roots of Guardian® peach (Prunus persica) rootstock showed strong gall symptoms. Extracted root-knot nematodes (RKN) were identified by both morphological and molecular methods as M. floridensis. This is the first detection of the peach RKN in South Carolina and the third state in the USA after Florida and California.

Pulai tree (Alstonia scholaris) pest in hedge orchard of the Nagrak Research Station, Bogor, West Java

Suharti T, Siregar N.2018. Pulai tree (Alstonia scholaris)pest in hedge orchard of the Nagrak Research Station, Bogor, West Java.Pros Sem Nas Masy Biodiv Indon 4: 284-290.Pulai(Alstonia scholaris(L.) R. Br.)is one of the most useful plants for light construction, blackboard, pulp and paper, medicinal plants and rehabilitation of ex-mining land. Well-managed hedge orchard will produce quality shots as a source of cutting material, but shoots in this hedge orchard are often attacked by pests which threaten the plants. Therefore it is necessary toidentify the pest species so that control measures can be determined. The purpose of this research is to know the pests species that attack the pulai hedge orchard in Nagrak Research Station, Bogor, West Java. The observation of symptoms and percentage ofpest attack was done in the Nagrak Research Station from June to August 2017. The number of plants observed was 350 plants. The results showed that there are two typical symptoms of pulai leaf, i.e. folded leaves and gall. The folded leaves pest was Parotissp. whereas the gall pest was Pauropsylla tuberculata. In August, the percentage of the folded leaves decreased by 23% while the gall increased by 11.1%. Observations showed rarely found gall symptoms in plants of height 3 meters, while at coppice of height 1 meter found many galls. It assumed that the folded leaves pest populations could be controlled by simple hand-picking or pruning branches of pest-infested plants whereas for gall pest, it is necessary to take preventive measures by giving environmentally friendly insecticides, especially towards August.

Antibacterial activity of the bioactive compounds identified in three woody plants against some pathogenic bacteria

Three bacterial isolates were identified from infected potato tubers showing soft and blackleg like symptoms as well as one isolate from infected pear tree showing crown gall symptom. Conventional and molecular identification proved that bacterial isolates belonging to Pectobacterium carotovorum subsp. carotovorum, Pectobacterium atrosepticum, Dickeya solani and Agrobacterium tumefaciens. The above plant bacterial isolates and human pathogenic bacteria Escherichia coli, Sarcina lutea, and Staphylococcus aureus were used for the bioassay. The chloroform leaf extracts from Duranta plumieri variegata, Lantana camara, and Citharexylum spinosum were assayed for their antibacterial activity by measuring the inhibition zones and minimum inhibitory concentrations (MICs). The suggested chemical compositions of extracts were analyzed using GC/MS apparatus. The main compounds in leaf extract of L. camara were 5,8-diethyl-dodecane, pyrimidin-2-one, 4-[N-methylureido]-1-[4-methylaminocarbonyloxymethyl, oleic acid,3-(octadecyloxy)propyl ester; in D. plumieri were 4,7-dimethoxy-2-methylindan-1-one and 5-(hexadecyloxy)-2-pentadecyl-,trans-1,3-dioxane; and in C. spinosum were N-[5-(3-hydroxy-2-methylpropenyl)-1,3,4,5-tetrahydrobenzo[cd]indol-3-yl]-N-methylacetamide. Promising activity was found against A. tumefaciens, E. coli, P. carotovorum, Sar. lutea, and Staph. aureus with MIC values of 8, 128, 64, 500 and 500 μg/mL, respectively, as L. camara leaf extract was applied. D. plumieri leaf extract showed good activity against D. solani and P. atrosepticum with MIC values of 16 μg/mL and 128 μg/mL, respectively. On the other hand, weak bioactivity was found with leaf extract from C. spinosum. It could be concluded that leaf extracts from D. plumieri and L. camara have a promising antibacterial agents.

Laurobasidiaceae fam. nov. (Exobasidiales, Basidiomycota), a new family for fungi causing galls with aerial root-like outgrowths, with a new record from Thailand of Laurobasidium hachijoense on a new host, Cinnamomum subavenium

A fungal disease with aerial-root-liked gall symptoms on Cinnamomum subavenium in Khao Yai National Park, Northeastern Thailand is reported, and the causative agent identified as Laurobasidium hachijoense. Cultures from the Thai specimens, as well as the type culture from Japan, were sequenced for LSU and ITS genes. Analysis of these gene sequences showed that the Thai isolates clustered with the type strain of Laurobasidium hachijoense. This is the first report of this fungus on a new host and in Thailand. Morphology of this fungus from the Thai specimens as well as the seasonal symptom in the natural forest are described and illustrated. Laurobasidiaceae is proposed as a new family for Laurobasidium. It was nested in a highly supported clade with the Cryptobasidiaceae and a sister clade to the Branchybasidiaceae, Graphoilaceae and Exobasidiaceae clades within the order Exobasidiales. Laurobasidiaceae morphologically possesses basidial sterigmata, thin-walled basidiospores with an abaxial hilum, and sporulating on the surface of the host tissues. It is unique from other families in the Exobasidiales in causing aerial-root-like galls on the host plant. The phylogenetic analysis revealed that strains of Acaromyces ingoldii grouped together with Laurobasidium hachijoense indicating they are conspecific. Morphological examination also confirmed that these two taxa are the same fungus. Laurobasidium hachijoense is proposed as the valid name based on its occupation of the initial type material of this organism, and the monotypic genus Acaromyces becomes a synonym of Laurobasidium. Exobasidium cinnamomi is also considered a Laurobasidium species based on its morphology and the stag-horn-like galls on a lauraceous host. The taxonomy of the Laurobasidiaceae is discussed.

Rizhospheric competence, plant growth promotion and biocontrol efficacy of Bacillus amyloliquefaciens subsp. plantarum strain 32a

Bacillus strains are increasingly used to control plant diseases. However, their efficacy is often inconsistent in the field. The use of strains perfectly adapted to the plant rhizosphere could enhance the efficiency of biocontrol. Among the members of the B. subtilis group, the plant associated Bacillus amyloliquefaciens subsp. plantarum was recently identified as the best adapted in the colonization of the rhizosphere. This study aimed to further define the taxonomic position of strain 32a, previously identified as a B. amyloliquefaciens, to evaluate its rhizosphere competence and its persistence in the rhizoplane of tomato and to assess its potential as growth promoting and biocontrol agent towards crown gall disease. The gyrB gene sequencing of strain 32a classified it as subsp. plantarum. This strain harbored genes related to the production of the dipeptide bacilysin and the polyketides macrolactin, bacillaene and difficidin. When tested in vitro, it was also able to produce siderophore, hydrolytic enzymes and indole-3-acetic acid and to solubilize inorganic phosphate. When applied to the soil, strain 32a successfully colonized the rhizoplane of tomato plants and survived at high level up to 60 days (105–107 CFU/g root fresh weight). Tomato plants treated with strain 32a displayed significantly higher levels of germination and growth compared to untreated ones. Moreover, crown gall symptoms were markedly reduced in the roots of plants colonised by 32a strain. Due to its multiple beneficial traits, strain 32a may be developed as plant growth promoting and biocontrol agent, for its integrated use in disease and nutrient management strategies.

First Report of Meloidogyne enterolobii on Ginger (Zingiber officinale) in China

Ginger (Zingiber officinale) is a widely grown commercial crop in China. Extensive root galling was observed on ginger plants from one commercial field in Longhai county (24°27′58.01″S, 117°39′21.68″W), Zhangzhou region, Fujian Province in July 2016. Examination of symptomatic roots revealed one or several females of Meloidogyne sp. within each gall with egg masses protruding through the root surface. The nematode population densities in the samples ranged from 382 to 853 eggs and second stage juveniles (J2) per 5 g of fresh roots. Females and egg masses were collected from the roots, and egg masses were incubated in water at 25°C to obtain J2. The J2 tail is thin with a broad, bluntly pointed tip and a clearly defined hyaline tail terminus. Measurements of J2 (n = 20) included L = 443 ± 22.6 (417 to 478) μm, BW = 17.2 ± 2.21 (14.5 to 19.6) μm, stylet = 14.2 ± 0.7 (13.3 to 15.2) μm, DGO = 3.56 ± 0.52 (2.92 to 4.34) μm, tail = 53.7 ± 3.50 (48.6 to 60.2) μm, and hyaline tail terminus = 13.3 ± 2.45 (10.2 to 18.8) μm. For females (n = 20), stylet = 15.2 ± 1.06 (13.1 to 16.5) μm. Stylet knobs in females are divided longitudinally by a groove so that each knob appears as two. The perineal patterns are round to ovoid, with moderate to high dorsal arch and mostly lacking obvious lateral lines. Phasmids are large. Morphological characteristics from J2s and perineal patterns from adult females matched the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). Species identity was further explored by sequencing the mitochondrial DNA region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/​AATTTCTAAAGACTTTTCTTAGT) (Xu et al. 2004), rDNA-internal transcribed spacer (ITS1_5.8S_ITS2) region using primers V5367/26S (TTGATTACGTCCCTGCCCTTT/​TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992), and the D2–D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (GTACCGTGAGGGAAAGTTG/​TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999). The sequences for the target genes were 841 bp (GenBank accession no. MF467278), 765 bp (MF467277), and 759 bp (MF467276), respectively. Sequence homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Species identification was further confirmed with M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/​TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). A 200-bp amplification product was produced, which was previously reported only for M. enterolobii, whereas no product was amplified from control populations of M. incognita or M. javanica. In a glasshouse test, seedlings of ginger cultivar Hongya maintained in 20-cm-diameter pots were inoculated with 3,000 eggs plus J2s of the population of M. enterolobii with six replicates; noninoculated controls were included. After 10 weeks, all inoculated plants were chlorotic, galling symptoms on roots were similar to those in the field, and the nematode reproduction factor (final population/initial population) was 13.8. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first record of M. enterolobii parasitizing a plant (i.e., ginger) in the family Zingiberaceae in China.

Essential oils of Origanum compactum and Thymus vulgaris exert a protective effect against the phytopathogen Allorhizobium vitis.

Allorhizobium (Agrobacterium) vitis is a host-specific pathogenic bacterium that causes grapevine crown gall disease, affecting vine growth and production worldwide. The antibacterial activities of different aromatic plant essential oils were tested in vitro and in planta against A. vitis. Among the essential oils tested, those of Origanum compactum and Thymus vulgaris showed the most significant in vitro antibacterial activities, with a MIC of 0.156 and 0.312mg/mL, respectively. A synergistic effect of these two essential oils (1:1) was observed and confirmed by the checkerboard test. Carvacrol (61.8%) and thymol (47.8%) are, respectively, the major compounds in the essential oils of O. compactum and T. vulgaris and they have been shown to be largely responsible for the antibacterial activities of their corresponding essential oils. Results obtained in vitro were reinforced by an in planta pathogenicity test. A mixture of O. compactum and T. vulgaris essential oils (1:1), inoculated into the injured stem of a tomato plant and a grapevine at 0.312mg/mL as a preventive treatment, reduced both the number of plants developing gall symptoms and the size of the tumors.

Host Associations of Gall-InducingProdiplosis longifila(Diptera: Cecidomyiidae) from Bolivia: Implications for Its Use as a Biological Control Agent forJatropha gossypiifolia(Euphorbiaceae)

Based on field host range and damage potential, we explored the prospects of exploiting a gall midge from Jatropha clavuligera Mull. Arg. (Euphorbiaceae) in Bolivia as a “new-association” biological control agent for Jatropha gossypiifolia L. (Euphorbiaceae), a major rangeland weed in Australia. The gall midge, determined morphologically as Prodiplosis longifila Gagne (Diptera: Cecidomyiidae), induces rosette galls, resulting in shoot tip dieback in J. clavuligera in Bolivia. Although P. longifila is reported to occur on a range of crops in the Neotropics, its feeding on J. clavuligera in Bolivia is strikingly different in that it induces rosette galls on its shoots. In other countries, P. longifila larvae feed on leaves, buds, flowers and fruits, with no gall symptoms. There was no evidence of P. longifila-induced galls on crop plants (reported hosts in other countries), other species of Jatropha, or other species of Euphorbiaceae in Bolivia, and in choice tests conducted in the quarantine facility in South Africa. Bolivian entomological records do not report any damage to crops by P. longifila. We propose that P. longifila in Bolivia is possibly a new species restricted to a few closely related species of Jatropha and a part of a cryptic species complex. Based on the susceptibility of J. gossypiifolia to the gall-inducing P. longifila in the field in Bolivia and in quarantine tests in South Africa, we propose that the gall-inducing P. longifila sourced from J. clavuligera in Bolivia is a potential “new-association” biological control agent for J. gossypiifolia in Australia.

Draft Genome Sequence of Agrobacterium tumefaciens Biovar 1 Strain 186, Isolated from Walnut.

ABSTRACTAgrobacterium tumefaciens biovar 1 strain 186 was isolated from a walnut tree expressing crown gall symptoms. The draft genome sequence of this strain harbored genes for crown gall formation and will be useful for understanding its virulence on Paradox, the predominant hybrid rootstock used for the cultivation of English walnut in California.

Antibacterial activities of the phytochemicals-characterized extracts of Callistemon viminalis, Eucalyptus camaldulensis and Conyza dioscoridis against the growth of some phytopathogenic bacteria

Three bacterial isolates were isolated from infected potato tubers showing soft and brown rots like symptoms as well as one isolate from infected peach tree showing crown gall symptom. The morphological, biochemical and molecular assays proved that bacterial isolates belonging to Pectobacterium carotovorum subsp. carotovorum, Ralstonia solanacearum, Dickeya spp. and Agrobacterium tumefaciens. The acetone (AcE) and n-butanol (ButE) extracts of Callistemon viminalis flowers and essential oil from aerial parts of Conyza dioscoridis as well as ButE of Eucalyptus camaldulensis bark are evaluated at different concentrations against the growth of the isolated bacteria. The diameter of inhibition zone (IZ) and the minimum inhibitory concentrations (MICs) are compared. Results indicated that the highest IZ values were 20.0 mm and 18.3 mm for E. camaldulensis bark ButE and C. viminalis flower ButE, respectively, against P. carotovorum; 16.3 mm and 16.0 mm for E. camaldulensis bark ButE and C. viminalis flower ButE, respectively, against R. solanacearum; 18.5 mm for C. viminalis flower AcE and C. dioscoridis aerial parts EO against Dickeya spp.; and 15.0 mm for C. viminalis flower AcE against A. tumefaciens. MICs ranged from <16 μg/mL for D. solani to >4000 μg/mL for A. tumefaciens. It was proved that C. viminalis flowers AcE contains mainly 5-hydroxymethylfurfural (20.6%), palmitic acid (18.5%), and pyrogallol (16.4%); while C. viminalis flower ButE contains palmitic acid (36.3%), 2-hydroxymyristic acid (9.4%), 5-hydroxymethylfurfural (7.2%), and shikimic acid (6.6%); whereas E. camaldulensis bark ButE contains 8-nonynoic acid methyl ester (45.6), camphor (30.9%), menthol (8.8%), and 1,8-cineole (eucalyptol) (8.2%), whilst the EO of C. dioscoridis aerial parts comprises Z-(13,14-epoxy)tetradec-11-en-1-ol acetate (11.6%), γ-elemene (10.2%), tau.-muurolol (7.1%), and cadina-3,9-diene (4.7%). It can be concluded that phytochemical extracts of C. viminalis, E. camaldulensis and C. dioscoridis demonstrated strong to moderate antibacterial effects against the studied plant bacterial pathogens.

Biophysical control of the growth of Agrobacterium tumefaciens using extremely low frequency electromagnetic waves at resonance frequency

Isolated Agrobacterium tumefaciens was exposed to different extremely low frequencies of square amplitude modulated waves (QAMW) from two generators to determine the resonance frequency that causes growth inhibition. The carrier was 10 MHz sine wave with amplitude ±10 Vpp which was modulated by a second wave generator with a modulation depth of ± 2Vpp and constant field strength of 200 V/m at 28 °C. The exposure of A. tumefaciens to 1.0 Hz QAMW for 90 min inhibited the bacterial growth by 49.2%. In addition, the tested antibiotics became more effective against A. tumefaciens after the exposure. Furthermore, results of DNA, dielectric relaxation and TEM showed highly significant molecular and morphological changes due to the exposure to 1.0 Hz QAMW for 90 min. An in-vivo study has been carried out on healthy tomato plants to test the pathogenicity of A. tumefaciens before and after the exposure to QAMW at the inhibiting frequency. Symptoms of crown gall and all pathological symptoms were more aggressive in tomato plants treated with non-exposed bacteria, comparing with those treated with exposed bacteria. We concluded that, the exposure of A. tumefaciens to 1.0 Hz QAMW for 90 min modified its cellular activity and DNA structure, which inhibited the growth and affected the microbe pathogenicity.

Histopathology of Dryas octopetala leaves co-infected by Subanguina radicicola and Aphelenchoides sp. and molecular caracterization of the nematodes

During a survey, in the Perthshire hills, Scotland, altitude 800–900 m a.s.l., samples of Dryas octopetala leaves showing concomitantly symptoms of galls and discolored spots, were collected. Several nematodes, juveniles and adults, were isolated by dissecting foliar tissues. Two species of nematodes, recovered and identified at morphological and molecular level as Aphelenchoides sp. and Subanguina radicicola, are herein reported. The most significant diagnostic characters for species identification of nematode specimens extracted from Dryas leaf galls fitted well with those previously reported for S. radicicola. Concerning the Aphelenchoides sp., the diagnostic characters were very similar to those reported for A. ritzemabosi.The ITS and the D2-D3 expansion domain analyses confirmed the presence of S. radicicola from galls, while Aphelenchoides specimens from discoloured leaf areas), despite the morphological similarity with A. ritzemabosi, were genetically distinct from A. ritzemabosi based on two genomic regions (LSU and ITS). The 18S rRNA gene (SSU) was only amplified in S. radicicola. Phylogenetic analyses using ITS and LSU sequences placed S. radicicola with other populations of the same species and Aphelenchoides sp. with species of the same genus. The histopathology, caused by both endoparasites in naturally infected leaves, was examined via serial sections mounted on glass slides. Green Dryas leaves infected by Aphelenchoides sp. appeared discolored (yellowish spots), slightly deformed with a population density of four specimens/cm2 per single leaf blade. Dryas octopetala leaves infected by S. radicicola showed an average of three galls/leaf, located randomly, mainly at the upper leaf edge. Dissected galls contained a central cavity with a variable number of adult females (3–6)/gall and males, together with several immature females, juvenile stages and eggs. The present study reports on a new host plant and an undescribed type of sedentary parasitism of the root-gall nematode, S. radicicola on D. octopetala leaves with the concomitant infection of specimens of Aphelenchoides sp.

Biological control for grapevine crown gall using nonpathogenic &lt;i&gt;Rhizobium vitis&lt;/i&gt; strain ARK-1

Crown gall of grapevine, which is caused by tumorigenic Rhizobium vitis, is the most important bacterial disease of grapevine throughout the world. Screening tests of biological control agents resulted in the discovery of a nonpathogenic R. vitis strain ARK-1. By soaking grapevine roots with a cell suspension of strain ARK-1 prior to planting in the field, ARK-1 treatment significantly reduced the number of plants with crown gall symptoms. Several field trials result indicated that ARK-1 was very useful in the field, not only for grapevine but also for various other plant species. In experiments where a mixture of ARK-1 and a tumorigenic strain at a 1 : 1 cell ratio was examined in vitro and in planta, expression levels of the virulence genes virD2 and virE2 of the tumorigenic strain were significantly lower. The suppression of virulence genes, which can result in a reduction of gall formation and the pathogen population, seems to be a unique mechanism of ARK-1. These results indicated that ARK-1 is a promising new agent to control grapevine crown gall.

Selection of aggressive pathogenic and solopathogenic strains of Ustilago maydis to improve Huitlacoche production

Ustilago maydis is a basidiomycete known as the causative agent of 'common smut', worldwide disease of maize that is recognized by the galls it forms, which have considerable potential as a gourmet food. Results of infection are quite variable, even under optimal greenhouse conditions. In order to find pathogenic strains able to be used as a highly infective and stable inoculum for the successful production of galls either in greenhouses or in the field, ears with gall symptoms containing teliospores were recovered from maize plants. The teliospores were suspended in water and plated on nutrient-rich medium. Twenty-six colonies developed, containing three types of yeast-like colonies: saprotrophic, pathogenic, and solopathogenic. DAPI staining confirmed the presence of solopathogenic strains with diploid sporidia. Groups of different mating types were found when pairs of the 26 strains were arranged resembling partial-diallel combinations. Amplification of the partial b locus revealed that the strains found harbor the alleles b3 and b4, allowing the formation in dikaryotic strains of heterodimeric regulatory proteins associated with fungal development and pathogenicity. In this study, we isolated compatible haploid and solopathogenic diploid strains for their high capacity for inducing smut.

Hypoxia response in Arabidopsis roots infected by Plasmodiophora brassicae supports the development of clubroot.

BackgroundThe induction of alcohol fermentation in roots is a plant adaptive response to flooding stress and oxygen deprivation. Available transcriptomic data suggest that fermentation-related genes are also frequently induced in roots infected with gall forming pathogens, but the biological significance of this induction is unclear. In this study, we addressed the role of hypoxia responses in Arabidopsis roots during infection by the clubroot agent Plasmodiophora brassicae.ResultsThe hypoxia-related gene markers PYRUVATE DECARBOXYLASE 1 (PDC1), PYRUVATE DECARBOXYLASE 2 (PDC2) and ALCOHOL DEHYDROGENASE 1 (ADH1) were induced during secondary infection by two isolates of P. brassicae, eH and e2. PDC2 was highly induced as soon as 7 days post inoculation (dpi), i.e., before the development of gall symptoms, and GUS staining revealed that ADH1 induction was localised in infected cortical cells of root galls at 21 dpi. Clubroot symptoms were significantly milder in the pdc1 and pdc2 mutants compared with Col-0, but a null T-DNA insertional mutation of ADH1 did not affect clubroot susceptibility. The Arg/N-end rule pathway of ubiquitin-mediated proteolysis controls oxygen sensing in plants. Mutants of components of this pathway, ate1 ate2 and prt6, that both exhibit constitutive hypoxia responses, showed enhanced clubroot symptoms. In contrast, gall development was reduced in quintuple and sextuple mutants where the activity of all oxygen-sensing Group VII Ethylene Response Factor transcription factors (ERFVIIs) is absent (erfVII and prt6 erfVII).ConclusionsOur data demonstrate that the induction of PDC1 and PDC2 during the secondary infection of roots by P. brassicae contributes positively to clubroot development, and that this is controlled by oxygen-sensing through ERFVIIs. The absence of any major role of ADH1 in symptom development may also suggest that PDC activity could contribute to the formation of galls through the activation of a PDH bypass.Electronic supplementary materialThe online version of this article (doi:10.1186/s12870-016-0941-y) contains supplementary material, which is available to authorized users.

Co-occurrence of pathogenic and non-pathogenic Fusarium decemcellulare and Lasiodiplodia theobromae isolates in cushion galls disease of cacao (Theobroma cacao L.)

AbstractFlowery cushion gall of cacao is a disease complex with six types. Fusarium decemcellulare have been isolated from both flowery and green point galls and recognized as the etiological agent of the disease. In the present work we: i) identified by ITS-rDNA sequencing and/or taxonomy the cultivable fungal species or Operative Taxonomic Units (OTUs) associated with the five symptoms of cushion galls in cacao from Venezuela, and ii) determined the gall inducing capacity on cacao peeled seeds after 45 days of inoculation with suspensions of mycelia/ spores from distinct isolate types. The whole isolate collection rendered an abundance of 113 isolates with a richness of 39 OTUs (27) and eight identified at the species or genera levels, respectively, and in unidentified fungi. The dominant recovered species (≈36%) were F. decemcellulare and Lasiodiplodia theobromae. Some isolates of F. decemcellulare, L. theobromae, F. equiseti, Fusarium spp., F. solani, F. incarnatum, Rhizocthonia solani and Penicillium sp. were pathogenic. Some other isolates of the first six mentioned taxa behave as non-pathogenic. Furthermore, pathogenic and non-pathogenic isolates can also co-occur within a single plant and gall type. Moreover, 2-5 species within a single gall symptom in a single tree were identified (not necessarily at the same point in the tree), indicating a broad diversity of co-occurring taxa.

MOLECULAR BIOTECHNOLOGY OF HOP CROWN GALL DIAGNOSTIC

Aim. The development of molecular biotechnology for crown gall diagnosis in hop. Methods. Isolation of pure culture cells, extraction of DNA, polymerase chain reaction (PCR), gel electrophoresis. Results. For the total DNA extraction from the tissue there were used the buffer, which recorded the presence in hop tissue such specific compounds as humulone, lupulon, xanthohumol and others. There were performed PCRs with primers for genes of virulence and pathogenicity of the Ti-plasmid and DNAs extracted from the pure culture of the crown gall causative Agrobacterium tumefaciens, healthy samples of hop, hop samples with visual crown gall symptoms and agrobacterium and hop DNA mixtures at the ratio of 1:1 1:5, 1:10. PCR products were obtained with the primers to virulence and pathogenic genes of Ti-plasmid and DNA extracted from a pure culture of A. tumefaciens, the hop tissue samples with visual symptoms of crown gall and the mixtures of DNA from hop. According to the results of PCRs with total DNA from healthy samples of hops and controls (PCR-mix without DNA) the amplification products were not observed. Infected by crown gall were considered those samples of hop in which the total DNA virulence and pathogenicity genes of Ti-plasmid were identified. Conclusion. The diagnosis of hops should include the detection of pathogenes and virulence genes ipt and virD2.

Methylated Cytokinins from the Phytopathogen Rhodococcus fascians Mimic Plant Hormone Activity.

Cytokinins (CKs), a class of phytohormones that regulate plant growth and development, are also synthesized by some phytopathogens to disrupt the hormonal balance and to facilitate niche establishment in their hosts. Rhodococcus fascians harbors the fasciation (fas) locus, an operon encoding several genes homologous to CK biosynthesis and metabolism. This pathogen causes unique leafy gall symptoms reminiscent of CK overproduction; however, bacterial CKs have not been clearly correlated with the severe symptoms, and no virulence-associated unique CKs or analogs have been identified. Here, we report the identification of monomethylated N(6)-(∆(2)-isopentenyl)adenine and dimethylated N(6)-(∆(2)-isopentenyl)adenine (collectively, methylated cytokinins [MeCKs]) from R. fascians. MeCKs were recognized by a CK receptor and up-regulated type-A ARABIDOPSIS THALIANA RESPONSE REGULATOR genes. Treatment with MeCKs inhibited root growth, a hallmark of CK action, whereas the receptor mutant was insensitive. MeCKs were retained longer in planta than canonical CKs and were poor substrates for a CK oxidase/dehydrogenase, suggesting enhanced biological stability. MeCKs were synthesized by S-adenosyl methionine-dependent methyltransferases (MT1 and MT2) that are present upstream of the fas genes. The best substrate for methylation was isopentenyl diphosphate. MT1 and MT2 catalyzed distinct methylation reactions; only the MT2 product was used by FAS4 to synthesize monomethylated N(6)-(∆(2)-isopentenyl)adenine. The MT1 product was dimethylated by MT2 and used as a substrate by FAS4 to produce dimethylated N(6)-(∆(2)-isopentenyl)adenine. Chemically synthesized MeCKs were comparable in activity. Our results strongly suggest that MeCKs function as CK mimics and play a role in this plant-pathogen interaction.

Camalexin contributes to the partial resistance of Arabidopsis thaliana to the biotrophic soilborne protist Plasmodiophora brassicae.

Camalexin has been reported to play defensive functions against several pathogens in Arabidopsis. In this study, we investigated the possible role of camalexin accumulation in two Arabidopsis genotypes with different levels of basal resistance to the compatible eH strain of the clubroot agent Plasmodiophora brassicae. Camalexin biosynthesis was induced in infected roots of both Col-0 (susceptible) and Bur-0 (partially resistant) accessions during the secondary phase of infection. However, the level of accumulation was four-to-seven times higher in Bur-0 than Col-0. This was associated with the enhanced transcription of a set of camalexin biosynthetic P450 genes in Bur-0: CYP71A13, CYP71A12, and CYP79B2. This induction correlated with slower P. brassicae growth in Bur-0 compared to Col-0, thus suggesting a relationship between the levels of camalexin biosynthesis and the different levels of resistance. Clubroot-triggered biosynthesis of camalexin may also participate in basal defense in Col-0, as gall symptoms and pathogen development were enhanced in the pad3 mutant (Col-0 genetic background), which is defective in camalexin biosynthesis. Clubroot and camalexin responses were then studied in Heterogeneous Inbred Families (HIF) lines derived from a cross between Bur-0 and Col-0. The Bur/Col allelic substitution in the region of the previously identified clubroot resistance QTL PbAt5.2 (Chromosome 5) was associated with both the enhanced clubroot-triggered induction of camalexin biosynthesis and the reduced P. brassicae development. Altogether, our results suggest that high levels of clubroot-triggered camalexin biosynthesis play a role in the quantitative control of partial resistance of Arabidopsis to clubroot.