Γ-irradiated Cells Research Articles

POT1 involved in telomeric DNA damage repair and genomic stability of cervical cancer cells in response to radiation.

Though telomeres play a crucial role in maintaining genomic stability in cancer cells and have emerged as attractive therapeutic targets in anticancer therapy, the relationship between telomere dysfunction and genomic instability induced by irradiation is still unclear. In this study, we identified that protection of telomeres 1 (POT1), a single-stranded DNA (ssDNA)-binding protein, was upregulated in γ-irradiated HeLa cells and in cancer patients who exhibit radiation tolerance. Knockdown of POT1 delayed the repair of radiation-induced telomeric DNA damage which was associated with enhanced H3K9 trimethylation and enhanced the radiosensitivity of HeLa cells. The depletion of POT1 also resulted in significant genomic instability, by showing a significant increase in end-to-end chromosomal fusions, and the formation of anaphase bridges and micronuclei. Furthermore, knockdown of POT1 disturbed telomerase recruitment to telomere, and POT1 could interact with phosphorylated ATM (p-ATM) and POT1 depletion decreased the levels of p-ATM induced by irradiation, suggesting that POT1 could regulate the telomerase recruitment to telomeres to repair irradiation-induced telomeric DNA damage of HeLa cells through interactions with p-ATM. The enhancement of radiosensitivity in cancer cells can be achieved through the combination of POT1 and telomerase inhibitors, presenting a potential approach for radiotherapy in cancer treatment.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

The Role of Perforin

Some literature reviews have been carried out about the role of perforin in medicine. The first step involved a systematic search to identify relevant studies published between 2001 and 2019 in the following electronic databases - EBSCO host, Scopus, Science Direct, Web of Science, and Elsevier. By analyzing the available literature, it can be concluded that perforin plays an important role in cytoxical activity of natural killer cells (NK) and CD8+ T cell. NK and CD8+use the same mechanism for destroying target cells. This article cites the disease hemophagocytic lymphohistiocytosis (HLH) which is characterized by heavy abnormalities in the immune system. The point is that this disease is caused by perforin gene mutation. The key is the application of properly sensitized dendritic cells (DCs) because they are effective in immunotherapy against cancer. It may be effective in γ-irradiated colon cancer cell lines HT-29. Growth hormone inhibiting hormone (GIH) induces maturation and activation of DCs. In that way, GIH-Dcs shows increased cytotoxic activity and higher perforin and granzyme expression. So, this means that theoretical research has shown that efficient activity against cancer is induced when DCs are sensitized with γ-irradiated cancer cells. In that way, through a direct increase of cytotoxicity and indirect T cell activation,there can beanti-tumor activity. It is suggested to continue scientific research about the role of perforin in the future.

Dendrobine Inhibits γ-Irradiation-Induced Cancer Cell Migration, Invasion and Metastasis in Non-Small Cell Lung Cancer Cells.

The use of ionizing radiation (IR) during radiotherapy can induce malignant effects, such as metastasis, which contribute to poor prognoses in lung cancer patients. Here, we explored the ability of dendrobine, a plant-derived alkaloid from Dendrobium nobile, to improve the efficacy of radiotherapy in non-small cell lung cancer (NSCLC). We employed Western blotting, quantitative real-time (qRT)-PCR, transwell migration assays, and wound-healing assays to determine the effects of dendrobine on the migration and invasion of A549 lung cancer cells in vitro. Dendrobine (5 mm) inhibited γ-irradiation-induced migration and invasion of A549 cells by suppressing sulfatase2 (SULF2) expression, thus inhibiting IR-induced signaling. To investigate the inhibitory effects of dendrobine in vivo, we established a mouse model of IR-induced metastasis by injecting BALB/c nude mice with γ-irradiated A549 cells via the tail vein. As expected, injection with γ-irradiated cells increased the number of pulmonary metastatic nodules in mice (0 Gy/DPBS, 9.8 ± 1.77; 2 Gy/DPBS, 20.87 ± 1.42), which was significantly reduced with dendrobine treatment (2 Gy/Dendrobine, 10.87 ± 0.71), by prevention of IR-induced signaling. Together, these findings demonstrate that dendrobine exerts inhibitory effects against γ-irradiation-induced invasion and metastasis in NSCLC cells in vitro and in vivo at non cytotoxic concentrations. Thus, dendrobine could serve as a therapeutic enhancer to overcome the malignant effects of radiation therapy in patients with NSCLC.

PprA Protein Inhibits DNA Strand Exchange and ATP Hydrolysis of Deinococcus RecA and Regulates the Recombination in Gamma-Irradiated Cells.

DrRecA and PprA proteins function are crucial for the extraordinary resistance to γ-radiation and DNA strand break repair in Deinococcus radiodurans. DrRecA mediated homologous recombination help in DNA strand break repair and cell survival, while the PprA protein confers radio-resistance via its roles in DNA repair, genome maintenance, and cell division. Genetically recA and pprA genes interact and constitute an epistatic group however, the mechanism underlying their functional interaction is not clear. Here, we showed the physical and functional interaction of DrRecA and PprA protein both in solution and inside the cells. The absence of the pprA gene increases the recombination frequency in gamma-irradiated D. radiodurans cells and genomic instability in cells growing under normal conditions. PprA negatively regulates the DrRecA functions by inhibiting DrRecA mediated DNA strand exchange and ATPase function in vitro. Furthermore, it is shown that the inhibitory effect of PprA on DrRecA catalyzed DNA strand exchange was not due to sequestration of homologous dsDNA and was dependent on PprA oligomerization and DNA binding property. Together, results suggest that PprA is a new member of recombination mediator proteins (RMPs), and able to regulate the DrRecA function in γ-irradiated cells by protecting the D. radiodurans genome from hyper-recombination and associated negative effects.

Imatinib mesylate elicits extracellular signal-related kinase (ERK) activation and enhances the survival of γ-irradiated epithelial cells

Imatinib mesylate, commercially known as Gleevec/Glivec, is the first targeted anticancer drug that inhibits activity of the tyrosine kinases, c-ABL, c-KIT, and PDGFR. A number of studies have shown that treatment with imatinib mesylate elicits extracellular signal-related kinase (ERK) activation, which, in turn, has been shown to confer radioresistance. Here, we investigated whether treatment with imatinib mesylate protects skin-derived epithelial cells, including normal keratinocytes, immortalized HaCaT and A431 cancer cell lines, from the effects of γ-radiation. ERK activation was detected 30 min after imatinib mesylate treatment in all three cell lines. In cells exposed to γ-irradiation in the presence of imatinib mesylate, this activation of ERK was associated with a reduction in radiation-induced apoptosis and enhanced cell survival. Similar effects of imatinib mesylate treatment were observed following γ-irradiation of a three-dimensional human skin culture system that reproduces a fully differentiated epithelium. Collectively, our findings provide the evidence of a protective effect of imatinib mesylate against the effects of γ-irradiation on epithelial-derived cells, regardless of their malignancy status.

Change of cell growth and mitochondrial membrane polarization in the progeny of cells surviving low-dose high-LET irradiation from Ra-226

In order to test the delayed effect of radiation on the progeny of irradiated survivors, the human keratinocyte cell line HaCaT and the fish common bluegill embryonic cell line CHSE/F were exposed to low-dose high-LET α-radiation from Ra-226 or γ-rays. The clonogenic survival fraction, mitochondrial membrane polarization (MMP) and reproductive ability of the descendants of the surviving cells were measured. For progeny of irradiated HaCaT survivors, no delayed cell death occurred. On the contrary, progeny at about 47 cell doublings after Ra-226 irradiation and progeny at about 14 cell doublings after γ-irradiation showed increased clonogenic survival. However the total cell number was reduced for progeny of Ra-226-treated cells up to about 47 cell doublings after irradiation and for progeny of γ-irradiated cells up to about 28 doublings after irradiation, which means low reproductive ability had appeared. In addition, α-radiation from Ra-226 had greater impact on the MMP of the HaCaT progeny than γ-rays. MMP of progeny of Ra-226-treated cells decreased at 5 cell doublings after irradiation and increased dose-dependently at 19 cell doublings after treatment, and then decreased dose-dependently at 47 cell doublings, while there was no significant effect on MMP in progeny of γ irradiated cells. The progeny of Ra-226-irradiated CHSE/F survivors showed more serious damage than the offspring of γ-irradiated CHSE/F cells. Significant, dose-dependent delayed cell death occurred in progeny of surviving cells up to about 61 cell doublings after Ra-226 treatment, and the reproductive ability was also significantly reduced. But the MMP increased, which might be because of the increased removal of dead cells. For progeny of CHSE/F cells surviving γ-rays radiation, no significant change in clonogenic survival occurred, except for offspring of cells surviving low dose (0.1 Gy and 0.5 Gy) irradiation, which had higher survival than control up to about 28 cell doublings after irradiation. But the number of cells which were the progeny of γ-irradiated survivors decreased dose-dependently up to about 28 cell doublings after γ-irradiation.

A Novel Mechanism of γ-Irradiation-Induced IL-6 Production Mediated by P2Y11 Receptor in Epidermal Keratinocytes.

Skin inflammation is caused by excessive production of cytokines and chemokines in response to an external stimulus, such as radiation, but the mechanisms involved are not completely understood. Here, we report a novel mechanism of γ-irradiation-induced interleukin-6 (IL-6) production mediated by P2Y11 receptors in epidermal cells. After irradiation of HaCaT cells derived from human epidermal keratinocytes with 5 Gy of γ-rays (137Cs: 0.78 Gy/min), IL-6 production was unchanged at 24 h after γ-irradiation, but was increased at 48 h. IL-6 mRNA was increased at 30 h, and IL-6 production was increased at 33 h after irradiation. The production of IL-6 was sustained at least for 4 d after irradiation. P2Y11 receptor antagonist NF157 inhibited IL-6 production in irradiated cells. Treatment with ATP, a ligand of P2Y11 receptor caused IL-6 production within 24 h. ATP-induced IL-6 production was also suppressed by NF157. Extracellular ATP level was increased after irradiation. The p38 mitogen-activated protein kinase (MAPK) and nuclear factor-kappaB (NF-κB) signaling was involved in the production of IL-6 at the downstream of P2Y11 receptor activation. In addition, the cell cycle was arrested at the G2/M phase, and DNA repair foci were not disappeared at 48 h after γ-irradiation. The protein level of histone methylation enzyme G9a, which inhibits IL-6 production, was decreased after γ-irradiation. In conclusion, we suggest that γ-irradiation induces sustained IL-6 production in HaCaT cells from 33 h after irradiation, which is mediated through P2Y11 receptor-p38 MAPK-NF-κB signaling pathway and G9a degradation. This is a novel mechanism of cytokine production in γ-irradiated cells.

The Translationally Controlled Tumor Protein and the Cellular Response to Ionizing Radiation-Induced DNA Damage.

The absorption of ionizing radiation by living cells can directly disrupt atomic structures, producing chemical and biological changes. It can also act indirectly through radiolysis of water, thereby generating reactive chemical species that may damage nucleic acids, proteins, and lipids. Together, the direct and indirect effects of radiation initiate a series of biochemical and molecular signaling events that may repair the damage or culminate in permanent physiological changes or cell death. In efforts to gain insight into the mechanisms underlying these effects, we observed a prominent upregulation of the Translationally Controlled Tumor Protein (TCTP) in low dose/low dose rate 137Cs γ-irradiated cells that was associated with adaptive responses that reduced chromosomal damage to a level lower than what occurs spontaneously. Therefore, TCTP may support the survival and genomic integrity of irradiated cells through a role in the DNA damage response. Consistent with this postulate, TCTP was shown to physically interact with ATM, an early sensor of DNA damage, and to exist in a complex with γH2A.X, in agreement with its distinct localization with the foci of the DNA damage marker proteins γH2A.X, 53BP1, and P-ATM. Cells lacking TCTP failed to repair chromosomal damage induced by γ-rays. Further, TCTP was shown to interact with the DNA-binding subunits, Ku70 and Ku80, of DNA-PK, a major participant in nonhomologous end joining of DNA double strand breaks. Moreover, TCTP physically interacted with p53, and its knockdown attenuated the radiation-induced G1 delay, but prolonged the G2 delay. Here, we briefly review the biochemical events leading to DNA damage by ionizing radiation and to its sensing and repair, and highlight TCTP's critical role in maintaining genomic integrity in response to DNA-damaging agents.

Effect of combined long-term starvation and γ-irradiation on membrane fatty acids and cell surface hydrophobicity of Salmonella enterica serovar Typhimurium

This study was carried out to explore the adaptive mechanisms of Salmonella enterica serovar Typhimurium, in particular the implication of fatty acids (FA) in the remodeling of membrane lipid composition to overcome the combined effects of long-term starvation and γ-irradiation stresses. In addition, cell surface hydrophobicity was also evaluated. The bacterial strains (control and starved) were treated with a nonlethal γ-irradiation dose of 0.5 kGy and sublethal doses of 1 kGy. Gas chromatography analysis showed that the FA composition of starved and γ-irradiated cells was modified. However starvation combined with γ-irradiation induced more modifications in the FA composition than γ-irradiation or starvation alone. Indeed, the unsaturated FA-to-saturated FA ratio decreased significantly for both strains compared with γ-irradiated cells, as main consequence of the cyclic FA formation. Our results showed that starvation, irradiation, or combined stresses significantly influenced the hydrophobicity, and this may have affected the virulence state of Salmonella Typhimurium cells. This study represents one of the few to demonstrate the modifications on bacterial membrane as a cellular response to survive to the ionizing radiation combined with long-term starvation stress.

Distinct kinetics of DNA repair protein accumulation at DNA lesions and cell cycle‐dependent formation of γH2AX‐ and NBS1‐positive repair foci

The DNA damage response is a fundamental, well-regulated process that occurs in the genome to recognise DNA lesions. Here, we studied kinetics of proteins involved in DNA repair pathways and their recruitment to DNA lesions during the cell cycle. In non-irradiated and irradiated cells, we analysed the distribution pattern and spatiotemporal dynamics of γH2AX, 53BP1, BMI1, MDC1, NBS1, PCNA, coilin and BRCA1 proteins. We observed that spontaneous and irradiation-induced foci (IRIF) demonstrated a high abundance of phosphorylated H2AX, which was consistent with 53BP1 and BMI1 protein accumulation. However, NBS1 and MDC1 proteins were recruited to nuclear bodies (NBs) to a lesser extent. Irradiation by γ-rays significantly increased the number of 53BP1- and γH2AX-positive IRIF, but cell cycle-dependent differences were only observed for γH2AX-positive foci in both non-irradiated and γ-irradiated cells. In non-irradiated cells, the G2 phase was characterised by an increased number of spontaneous γH2AX-foci; this increase was more pronounced after γ-irradiation. Cells in G2 phase had the highest number of γH2AX-positive foci. Similarly, γ-irradiation increased the number of NBS1-positive NBs only in G2 phase. Moreover, NBS1 accumulated in nucleoli after γ-irradiation showed the slowest recovery after photobleaching. Analysis of protein accumulation kinetics at locally induced DNA lesions showed that in HeLa cells, BMI1, PCNA and coilin were rapidly recruited to the lesions, 10-15 s after UVA-irradiation, whereas among the other proteins studied, BRCA1 demonstrated the slowest recruitment: BRCA1 appeared at the lesion 20 min after local micro-irradiation by UVA laser. We show that the kinetics of the accumulation of selected DNA repair-related proteins is protein specific at locally induced DNA lesions, and that the formation of γH2AX- and NBS1-positive foci, but not 53BP1-positive NBs, is cell cycle dependent in HeLa cells. Moreover, γH2AX is the most striking protein present not only at DNA lesions, but also spreading out in their vicinity. Our conclusions highlight the significant role of the spatiotemporal dynamics of DNA repair-related proteins and their specific assembly/disassembly at DNA lesions, which can be cell type- and cell cycle dependent.

Abstract 1: Noxa and ceramide: Crosstalk between Bcl-2 family members and ceramide in mediating intrinsic apoptosis in Molt-4 human T-cell leukemia

Abstract The sphingolipid breakdown product, ceramide, has been proposed as a coordinator of many cellular processes, one of which is apoptosis. We have previously shown that γ-irradiation induces p53-dependent apoptosis through ceramide accumulation in Molt-4 human T-cell leukemia cell line. Noxa, a BH3-only pro-apoptotic protein and a member in the Bcl-2 family, is activated by p53 and regulates downstream proteins that initiate mitochondrial outer membrane permeabilization (MOMP) and subsequently apoptosis. Here we identify a novel link between Noxa and ceramide in the apoptotic pathway that were previously thought to work independently. Specifically, we knocked down either p53 or Noxa protein expression in γ-irradiated Molt-4 cells and measured ceramide level in response to γ-irradiation. Our results demonstrate that ceramide accumulation requires the expression of both p53 and Noxa whereas inhibition of either p53 or Noxa totally inhibits ceramide accumulation. Furthermore, lipid and protein analysis of mitochondria isolated from Molt-4 cells showed a simultaneous ceramide accumulation and cytochrome c release, suggesting that ceramide's role is intricately related to the execution phase of apoptosis. These findings establish a role for Noxa in regulating ceramide at the mitochondrial level and provide a better understanding of the mechanisms of apoptosis initiated by p53. Citation Format: Hadile Kobeissy, Rouba Hage-Sleiman, Ghassan Dbaibo. Noxa and ceramide: Crosstalk between Bcl-2 family members and ceramide in mediating intrinsic apoptosis in Molt-4 human T-cell leukemia. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 1. doi:10.1158/1538-7445.AM2015-1

The differential role of human macrophage in triggering secondary bystander effects after either gamma-ray or carbon beam irradiation

The abscopal effect could be an underlying factor in evaluating prognosis of radiotherapy. This study established an in vitro system to examine whether tumor-generated bystander signals could be transmitted by macrophages to further trigger secondary cellular responses after different irradiations, where human lung cancer NCI-H446 cells were irradiated with either γ-rays or carbon ions and co-cultured with human macrophage U937 cells, then these U937 cells were used as a bystander signal transmitter and co-cultured with human bronchial epithelial cells BEAS-2B. Results showed that U937 cells were only activated by γ-irradiated NCI-H446 cells so that the secondary injuries in BEAS-2B cells under carbon ion irradiation were weaker than γ-rays. Both TNF-α and IL-1α were involved in the γ-irradiation induced secondary bystander effect but only TNF-α contributed to the carbon ion induced response. Further assay disclosed that IL-1α but not TNF-α was largely responsible for the activation of macrophages and the formation of micronucleus in BEAS-2B cells. These data suggest that macrophages could transfer secondary bystander signals and play a key role in the secondary bystander effect of photon irradiation, while carbon ion irradiation has conspicuous advantage due to its reduced secondary injury.

Differential effects of p53 on bystander phenotypes induced by gamma ray and high LET heavy ion radiation

High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.

Corrigendum

British Journal of HaematologyVolume 162, Issue 3 p. 428-428 CorrigendumFree Access Corrigendum This article corrects the following: Targeting of acute myeloid leukaemia by cytokine-induced killer cells redirected with a novel CD123-specific chimeric antigen receptor Sarah Tettamanti, Virna Marin, Irene Pizzitola, Chiara F. Magnani, Greta M. P. Giordano Attianese, Elisabetta Cribioli, Francesca Maltese, Stefania Galimberti, Angel F. Lopez, Andrea Biondi, Dominique Bonnet, Ettore Biagi, Volume 161Issue 3British Journal of Haematology pages: 389-401 First Published online: February 25, 2013 First published: 11 July 2013 https://doi.org/10.1111/bjh.12430AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat ‘Targeting of acute myeloid leukaemia by cytokine-induced killer cells redirected with a novel CD123-specific chimeric antigen receptor’ by Sarah Tettamanti et al, British Journal of Haematology, 161:3, May 2013, 389-401, the y-axis label ‘pg/ml’ should have been added to Fig 6 and its accompanying legend. The corrected legend should read as below: Fig 6. Cytokines release by anti-CD123. CAR + CIK cells after stimulation with leukaemic targets, HUVEC and monocytes. CIK cells were stimulated with γ-irradiated CEM cells, THP-1 cells, primary AML cells, HUVEC cells and monocytes at 1:5 E:T ratio for 24 h. Release of INF-γ, TNF-α, TNF-β and IL-10 was detected in the culture supernatants by flow cytometry (measured as pg/ml). Data shown are mean ± SE of independent experiments with THP-1 (n = 6), CEM, AML, HUVEC and monocytes (n = 3), and for selected comparisons, P-values of the Mann–Whitney test are reported. Reference Tettamanti, S., Marin, V., Pizzitola, I., Magnani, C.F., Giordano Attianese, G.M.P., Cribioli, E., Maltese, F., Galimberti, S., Lopez, A.F., Biondi, A., Bonnet, D. & Biagi, E. (2013) Targeting of acute myeloid leukaemia by cytokine-induced killer cells redirected with a novel CD123-specific chimeric antigen receptor. British Journal of Haematology, 161, 389– 401. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Volume162, Issue3August 2013Pages 428-428 ReferencesRelatedInformation

Abstract 4737: IL-4 and CpG therapy suppresses the outgrowth of tumors by activating tumor-specific Th1-type immune responses.

Abstract Although interleukin (IL) -4 is often regarded as a type-2 response inducer, recent studies have demonstrated that local IL-4 delivery at the site of vaccination activates local dendritic cells (DCs) and promote type-1 T cell responses. In particular, IL-4 supports DC maturation and enhances IL-12p70 secretion from DCs. Microbial molecules such as lipopolysaccharides, bacteriaderived RNA, and DNA are recognized by host cells through the TLR family, which belongs to the family of pattern-recognition receptors and stimulates immune responses. It has been reported that DNA vaccines and synthetic oligodeoxynucleotides (ODN) containing an unmethylated cytidine-phosphate-guanosine (CpG) motif promote Th1-type immune responses. CpG stimulates DCs through TLR9 and enhances DC maturation, which may improve the therapeutic effects on established tumors. In this study, we evaluated the antitumor effects of IL-4 gene therapy and CpG-ODN treatment in a poorly immunogenic murine cancer model. We used the IL-4 gene-overexpressing murine colorectal cancer MC38 cell line (MC38-IL4). Incubation with MC38-IL4 and CpG-ODN enhanced bone marrow-derived dendritic cell (DC) maturation in vitro. In addition, interferon (IFN)-γ production was significantly increased in naïve splenocytes after they were coincubated with MC38-IL4 and CpG-ODN. When mice bearing MC38 wild-type tumors were inoculated subcutaneously with MC38-IL4 cells and CpG-ODN, the outgrowth of established parental tumors was significantly suppressed compared to those in the MC38-IL4-treated group (IL-4 vs IL-4 + CpG-ODN, p= 0.015). A marked infiltration of CD8+ cells in the established parental tumors of mice treated with MC38-IL4 and CpG-ODN was confirmed by immunohistochemical analyses (MC38-IL4: 2.8 ± 1.9 cells/field vs MC38-IL4 + CpG-ODN: 20.7 ± 15.3 cells/field, p=0.027). Obvious tumor-specific cytolysis was detected when splenocytes of MC38-IL4 + CpG-ODN-treated mice were stimulated by γ-irradiated MC38-IL4 cells and CpG-ODN twice weekly in vitro and used as effector cells in a chromium-release assay (32.2% ± 3.5% for MC38 cells vs 3.2% ± 1.1% for YAC-1 cells; at an effector to target ratio of 40). These results suggest that IL-4 and CpG-ODN treatment promotes potent Th1-type antitumor immune responses. Therefore, the combination of IL-4 gene therapy and CpG-ODN treatment for cancer should be evaluated in clinical trials. Citation Format: Atsushi Kajiwara, Hiroyoshi Doi, Junichi Eguchi, Shigeaki Ishii, Ayako Sasagawa, Masaki Sakaki, Risa Omori, Eiichi Hayashi, Reiko Makino, Jin Yoshida, Kazumasa Hiroishi, Michio Imawari. IL-4 and CpG therapy suppresses the outgrowth of tumors by activating tumor-specific Th1-type immune responses. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 4737. doi:10.1158/1538-7445.AM2013-4737

DNA-damage response in chromatin of ribosomal genes and the surrounding genome

DNA repair events have functional significance especially for genome stability. Although the DNA damage response within the whole genome has been extensively studied, the region-specific characteristics of nuclear sub-compartments such as the nucleolus or fragile sites have not been fully elucidated. Here, we show that the heterochromatin protein HP1 and PML protein recognize spontaneously occurring 53BP1- or γ-H2AX-positive DNA lesions throughout the genome. Moreover, 53BP1 nuclear bodies, which co-localize with PML bodies, also occur within the nucleoli compartments. Irradiation of the human osteosarcoma cell line U2OS with γ-rays increases the degree of co-localization between 53BP1 and PML bodies throughout the genome; however, the 53BP1 protein is less abundant in chromatin of ribosomal genes and fragile sites (FRA3B and FRA16D) in γ-irradiated cells. Most epigenomic marks on ribosomal genes and fragile sites are relatively stable in both non-irradiated and γ-irradiated cells. However, H3K4me2, H3K9me3, H3K27me3 and H3K79me1 were significantly changed in promoter and coding regions of ribosomal genes after exposure of cells to γ-rays. In fragile sites, γ-irradiation induces a decrease in H3K4me3, changes the levels of HP1β, and modifies the levels of H3K9 acetylation, while the level of H3K9me3 was relatively stable. In these studies, we confirm a specific DNA-damage response that differs between the ribosomal genes and fragile sites, which indicates the region-specificity of DNA repair.

Enhanced anti-cancer activity of human dendritic cells sensitized with gamma-irradiation-induced apoptotic colon cancer cells

Properly sensitized dendritic cells (DCs) can be an effective immunotherapeutic against cancers. We investigated the phenotypic and functional changes in human DCs sensitized with γ-irradiated colon cancer cell-line HT-29 (GIH). GIH induced maturation and activation of DCs. GIH-sensitized DCs showed increased cytotoxic activity against HT-29 through higher expression of perforin and granzyme B. They further induced expression of effector cytokines, cytotoxic molecules, and mucosal-homing receptor in autologous T-cells. Conclusively, these results suggest that effective anti-cancer activity is induced when DCs are sensitized with γ-irradiated cancer cells via both direct augmentation of the cytotoxicity and indirect activation of T cells.

TGF-β signaling plays an important role in resisting γ-irradiation

Transforming growth factor-β1 (TGF-β1) regulates various biological processes, including differentiation, bone remodeling and angiogenesis, and is particularly important as a regulator of homeostasis and cell growth in normal tissue. Interestingly, some studies have reported that TGF-β1 induces apoptosis through induction of specific genes, whereas others suggest that TGF-β1 inhibits apoptosis and facilitates cell survival. Resolving these discrepancies, which may reflect differences in cellular context, is an important research priority. Here, using the parental mink lung epithelial cell line, Mv1Lu, and its derivatives, R1B and DR26, lacking TGF-β receptors, we investigated the involvement of TGF-β signaling in the effects of γ-irradiation. We found that canonical TGF-β signaling played an important role in protecting cells from γ-irradiation. Introduction of functional TGF-β receptors or constitutively active Smads into R1B and DR26 cell lines reduced DNA fragmentation, Caspase-3 cleavage and γ-H2AX foci formation in γ-irradiated cells. Notably, we also found that de novo protein synthesis was required for the radio-resistant effects of TGF-β1. Our data thus indicate that TGF-β1 protected against γ-irradiation, decreasing DNA damage and reducing apoptosis, and thereby enhanced cell survival.

Radiation-Induced Human Endogenous Retrovirus (HERV)-R env Gene Expression by Epigenetic Control

It is commonly accepted that ionizing radiation induces genomic instability by changes in genomic structure, epigenetic regulation and gene expression. Human endogenous retroviruses (HERV)-R also are often differentially expressed between normal and disease tissues under unstable genomic conditions and are implicated in the pathogenesis of several human diseases. To understand the influence of ionizing radiation on HERV-R expression, we performed quantitative reverse transcription-polymerase chain reaction (RT-PCR) analyses using γ-irradiated normal human cells. Compared to nonirradiated cells, HERV-R expression was up-regulated in γ-irradiated cells. The regulatory mechanism of HERV-R expression in irradiated cells was investigated by methylation analyses of HERV-R 5'LTRs and treatment with garcinol. These data indicated that the up-regulated transcription of HERV-R may be regulated by radiation-induced epigenetic changes induced by histone modification, and thus could be of great importance for understanding the relationship between radiation-induced biological effects and transposable elements.