Field-effect Transistor Sensor Research Articles

Recent progress in silicon-based biologically sensitive field-effect devices

Biologically sensitive field-effect devices (BioFEDs) advantageously combine the electronic field-effect functionality with the (bio)chemical receptor's recognition ability for (bio)chemical sensing. In this review, basic and widely applied device concepts of silicon-based BioFEDs (ion-sensitive field-effect transistor, silicon nanowire transistor, electrolyte-insulator-semiconductor capacitor, and light-addressable potentiometric sensor) are presented, and recent progress (from 2019 to early 2021) is discussed. One of the main advantages of BioFEDs is the label-free sensing principle enabling them to detect a large variety of biomolecules and bioparticles by their intrinsic charge. The review encompasses applications of BioFEDs for the label-free electrical detection of clinically relevant protein biomarkers, DNA molecules and viruses, enzyme–substrate reactions as well as recording of the cell acidification rate (as an indicator of cellular metabolism) and the extracellular potential. • Biologically sensitive field-effect devices offer a universal platform for numerous (bio)chemical sensors. • Biologically sensitive field-effect devices enable label-free detection of biomolecules by their molecular charge. • Conventional device concepts are the ion-sensitive field-effect transistor, silicon nanowire field-effect transistor, electrolyte-insulator-semiconductor capacitor, and light-addressable potentiometric sensor. • Applications include detection of proteins, DNA, viruses, and cellular activity.

Real-time nucleic acid detection via field-effect transistor sensors based on graphite oxide decorated with trimetallic nanocluster of gold, silver, and platinum

Field effect transistor (FET) based sensors are witnessing robust evolutions in the fabrication and characterization for the purpose of biomedical applications. In this article, a graphite oxide FET based sensor is designed, fabricated, and characterized for real-time detection of various concentrations of nucleic acid with a detection limit of 1.28 nM of DNA. This sensor consists of two gold electrodes connected through a channel of graphite oxide. Moreover, the sensor sensitivity is enhanced by decorating the graphite oxide channel with composite trimetallic nanoclusters that include gold, silver, and platinum. The developed sensor is investigated by both simulation and experiment. Both experimental and simulation agree where the current signal is higher for sensors decorated with trimetallic nanoclusters, which indicate higher sensitivity. Moreover, increasing the concentration of DNA results in an increment in the current signal thus the response is proportional to DNA concentration. The results indicate a promising sensor for real-time, reliable, and cost-effective DNA detection.

Recent Advances in Silicon FET Devices for Gas and Volatile Organic Compound Sensing

Highly sensitive and selective gas and volatile organic compound (VOC) sensor platforms with fast response and recovery kinetics are in high demand for environmental health monitoring, industry, and medical diagnostics. Among the various categories of gas sensors studied to date, field effect transistors (FETs) have proved to be an extremely efficient platform due to their miniaturized form factor, high sensitivity, and ultra-low power consumption. Despite the advent of various kinds of new materials, silicon (Si) still enjoys the advantages of excellent and reproducible electronic properties and compatibility with complementary metal–oxide–semiconductor (CMOS) technologies for integrated multiplexing and signal processing. This review gives an overview of the recent developments in Si FETs for gas and VOC sensing. We categorised the Si FETs into Si nanowire (NW) FETs; planar Si FETs, in which the Si channel is either a part of the silicon on insulator (SOI) or the bulk Si, as in conventional FETs; and electrostatically formed nanowire (EFN) FETs. The review begins with a brief introduction, followed by a description of the Si NW FET gas and VOC sensors. A brief description of the various fabrication strategies of Si NWs and the several functionalisation methods to improve the sensing performances of Si NWs are also provided. Although Si NW FETs have excellent sensing properties, they are far from practical realisation due to the extensive fabrication procedures involved, along with other issues that are critically assessed briefly. Then, we describe planar Si FET sensors, which are much closer to real-world implementation. Their simpler device architecture combined with excellent sensing properties enable them as an efficient platform for gas sensing. The third category, the EFN FET sensors, proved to be another potential platform for gas sensing due to their intriguing properties, which are elaborated in detail. Finally, the challenges and future opportunities for gas sensing are addressed.

Performance Improvement of MoS₂ Gas Sensor at Room Temperature

The poor response time and incomplete recovery of MoS <sub xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">2</sub> sensor at room temperature (RT) have been a serious issue to obstruct its widely sensing applications. In present work, we comprehensively studied three methods: rising temperature, building field-effect transistors (FETs), and adding light illumination to improve the performance of the device. The related sensing mechanism of the three processes was also analyzed. The high response rate up to 2510%, low theoretical concentration detection limit down to 693 ppb, and excellent recovery at RT to NO <sub xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">2</sub> were achieved for the MoS <sub xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">2</sub> FET sensor with the aid of light illumination. This significant improvement in sensing performances is mainly attributed to the activated sensing layer by phonon energy transfer and enhanced population of the charge carrier raised from optical energy. Schottky barrier modulation was also an important factor to impact sensing performance. Furthermore, the MoS <sub xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">2</sub> nanosheets exhibit good photosensing characteristics such as rapid photon response, high light-induced photocurrent, and so on. It has been demonstrated that the light illuminated FET configuration can effectively accelerate response time and promote recovery rate of MoS <sub xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">2</sub> -based sensor operating at RT, which provides a strategy to design an optoelectronic device with optimal sensing properties.

Construction of a Wireless-Enabled Endoscopically Implantable Sensor for pH Monitoring with Zero-Bias Schottky Diode-based Receiver.

Ambulatory pH monitoring of pathological reflux is an opportunity to observe the relationship between symptoms and exposure of the esophagus to acidic or non-acidic refluxate. This paper describes a method for the development, manufacturing, and implantation of a miniature wireless-enabled pH sensor. The sensor is designed to be implanted endoscopically with a single hemostatic clip. A fully passive rectenna-based receiver based on a zero-bias Schottky diode is also constructed and tested. To construct the device, a two-layer printed circuit board and off-the-shelf components were used. A miniature microcontroller with integrated analog peripherals is used as an analog front end for the ion-sensitive field-effect transistor (ISFET) sensor and to generate a digital signal which is transmitted with an amplitude shift keying transmitter chip. The device is powered by two primary alkaline cells. The implantable device has a total volume of 0.6 cm3 and a weight of 1.2 grams, and its performance was verified in an ex vivo model (porcine esophagus and stomach). Next, a small footprint passive rectenna-based receiver which can be easily integrated either into an external receiver or the implantable neurostimulator, was constructed and proven to receive the RF signal from the implant when in proximity (20 cm) to it. The small size of the sensor provides continuous pH monitoring with minimal obstruction of the esophagus. The sensor could be used in routine clinical practice for 24/96 h esophageal pH monitoring without the need to insert a nasal catheter. The "zero-power" nature of the receiver also enables the use of the sensor for automatic in-vivo calibration of miniature lower esophageal sphincter neurostimulation devices. An active sensor-based control enables the development of advanced algorithms to minimize the used energy to achieve a desirable clinical outcome. One of the examples of such an algorithm would be a closed-loop system for on-demand neurostimulation therapy of gastroesophageal reflux disease (GERD).

Recent advances in field‐effect transistor sensing strategies for fast and highly efficient analysis of heavy metal ions

AbstractHeavy metal ions are highly toxic for living organisms especially after bioaccumulation and biomagnification, which possess a serious threat to human health and ecological environment. The rapid, portable, and efficient analytical methods are urgently needed for the determination of heavy metals in different media. Due to the unique advantages of field‐effect transistor (FET) sensors including fast response, easy manipulation, small size, and high sensitivity, FET sensor has become a novel strategy for heavy metal ion monitoring and numerous attempts have been made for the analysis of various heavy metal ions (e.g., mercury, lead, arsenic, copper, cadmium, iron, and silver) in the past decade. Thus, it is of urgent need to systematically summarize recent advances of FET sensing strategies in fast and highly efficient detection of heavy metal ions. In this review, the representative FET sensing platforms for heavy metal ions are introduced with a focus on their working principle and sensing performance. Moreover, the limitations of current FET sensors as well as the gap between the research achievements and practical application requirements are also discussed. At last, future directions of FET sensors in heavy metal ion analysis are proposed, which provides guidance to the further development of FET sensors for monitoring heavy metal ions as well as other chemicals.

Preparation of conjugated polymer/reduced graphene oxide nanocomposites for high-performance volatile organic compound sensors

We have reported a facile approach to fabricate poly(3-hexylthiophene)/reduced graphene oxide (P3HT/rGO) composite films via the photoirradiation of the corresponding composite solutions. The films are applied to organic field-effect transistor (OFET) sensors for the high-performance detection of volatile organic compounds (VOCs). The photoirradiation of the composite solutions and the presence of rGO act synergistically to facilitate the molecular ordering of P3HT. Thus, the P3HT/rGO composite films containing 20 wt% rGO exhibit a maximized charge carrier mobility of ~0.18 cm2 V−1 s−1, which is 6-folds higher than that of pristine P3HT films. The interfacial interactions between rGO and P3HT are enhanced by the favorable π − π and electrostatic interactions following photoirradiation. The OFET sensors based on the P3HT/rGO composites consistently show enhanced sensitivity to polar VOCs (methanol, acetone, ethanol, and isopropyl alcohol) compared to those based on the pristine P3HT, photoirradiated bare P3HT, and pristine P3HT/rGO composites. In particular, the photoirradiated P3HT/rGO-based OFET sensors achieve significantly improved responsivity (~110.6%) to methanol vapors (10 ppm) under rapid on/off pulses of 60 s, compared to those based on pristine P3HT (~6.8%), photoirradiated bare P3HT (~20.8%), and pristine P3HT/rGO (~55.1%) composites. Finally, excellent response and recovery behaviors (e.g., ~15 s and ~42 s, respectively) are also observed.

NO2‐Affinitive Amorphous Conjugated Polymer for Field‐Effect Transistor Sensor toward Improved NO2 Detection Capability

AbstractThree conjugated polymers (CPs) containing indolocarbazole‐based similar conjugated frameworks are designed to investigate the NO2 detection capability of field‐effect transistor (FET) sensors. The partly linear aliphatic side chain strengthens the crystallization tendency of the CPs, but the crystallinity is critically degraded when introducing an ethylene oxide (EO)‐modified side chain to the same conjugated framework. Although the highly crystalline morphology of the CP helps to achieve high hole mobility, the NO2 response rate of the CP‐based FET sensor is severely deteriorated because of the suppression of NO2 diffusion into the CP matrix. The polar and flexible EO‐modified side chain is helpful to improve the NO2‐affinity of the CPs and induce favorable pathways for NO2 diffusion, ultimately providing enhanced detectivity with better NO2‐response characteristics. As a result, despite low charge carrier mobility due to pure amorphous nature, the CP with EO‐modified side chains provides an exceptional sensitivity of 180%/ppm upon NO2 (100 ppb) exposure for 50 s, including distinct detectivity toward other environmentally abundant harmful polar gases, such as SO2, NO, and NH3.

Multiple ions detection by field-effect transistor sensors based on ZnO@GO and ZnO@rGO nanomaterials: Application to trace detection of Cr (III) and Cu (II)

This work narrates the preparation of efficient nanomaterials framework of zinc oxide (ZnO) nanoglobules (NGs) with graphene oxide (GO) and reduced graphene oxide (rGO) for the fabrication of rapid multiple ion field-effect transistor (MI-FET) sensors. Prepared ZnO-NGs@GO and ZnO-NGs@rGO nanocomposites were broadly analyzed by different analytical techniques to study their morphological, structural, compositional, and electrochemical properties. As electrode materials, ZnO-NGs@GO and ZnO-NGs@rGO were used to fabricate MI-FETs sensor for the detection of multiple ions such as Ni (II), Co (II), Cu (II), Cr (III), Fe (II), and Bi (II) ions. ZnO-NGs@GO and ZnO-NGs@rGO modified MI-FETs sensor exhibited excellent responses towards Cr (III) and Cu (II) ions, which presented the remarkable sensitivities of ~49.28 mA μM−1. cm−2 (Cr (III) ions) and ~185.32 mA μM−1. cm−2 (Cu (II) ions), respectively. The fabricated MI-FETs sensor displayed good dynamic linear detection of ions with low limit of detection (LOD) values of ~7.05 μM and ~14.9 μM for ZnO-NGs@GO and ZnO-NGs@rGO electrodes, respectively. Efficient charge transfer over electrode considerably enhanced the trace detection of Cr (III) and Cu (II) ions. The fabricated MI-FETs sensor platform exhibited extraordinary reproducibility and excellent stability of sensing performance and thus, confirmed delightful potential to sprout a useful tool for water maintaining system.

The role of graphene patterning in field-effect transistor sensors to detect the tau protein for Alzheimer's disease: Simplifying the immobilization process and improving the performance of graphene-based immunosensors

We report the improvement in the sensing performance of electrolyte-gated graphene field-effect transistor (FET) sensors capable of detecting tau protein through a simplified, linker-free, anti-tau antibody immobilization process. For most of the graphene-based immunosensor, linkers, such as pyrenebutanoic acid, succinimidyl ester (PSE) must be used to the graphene surface, while the other side of linkers serves to capture the antibodies that can specifically interact with the target biomarker. In this study, graphene was patterned into eight different types and linker-free patterned graphene FET sensors were fabricated to verify their detection performance. The linker-free antibody immobilization to patterned graphene exhibited that the antibody was immobilized to the edge defect and had a doping-like behaviors on graphene. As the tau protein concentration in the electrolyte increased from 10 fg/ml to 1 ng/ml, the performances, charge neutral point shift and current change rate of the patterned graphene sensors without linkers were enhanced 2–3 times compared to a pristine graphene sensor with the PSE linker. Moreover, tau protein in the plasma of five Alzheimer's disease patients was measured using a linker-free patterned graphene sensor. It shows a 3–4 times higher current change rate than that of pristine graphene sensor with the PSE linker. Since the antibody is immobilized directly without a linker, a patterned graphene sensor without a linker can operate more sensitively in higher ionic concentration electrolyte.

Ultrasensitive WSe2 field-effect transistor-based biosensor for label-free detection of cancer in point-of-care applications

We demonstrate a highly sensitive tungsten diselenide (WSe2) field-effect transistor (FET) biosensor for label-free detection of early stage prostate cancer. We modified the FET channel by attaching the monoclonal antibody of prostate specific antigen (anti-PSA) through a multi-step process, followed by bovine serum albumin treatment, which ensures specific binding between anti-PSA and PSA. Our FET biosensor has a detection limit of 10 PSA, the lowest concentration detected so far by any FET sensor. At this detection limit, the sub-threshold swing is ; and the drain current () in the FET increases by 70% compared to that in a pristine device. The FET sensor exhibits linear change in threshold voltage () and drain current () over the detection range of 10 –1 PSA. Our demonstrated ultra-sensitive and fast WSe2 FET biosensors are promising for point-of-care diagnostics applications.

COVID-19 Biomarkers and Advanced Sensing Technologies for Point-of-Care (POC) Diagnosis.

COVID-19, also known as SARS-CoV-2 is a novel, respiratory virus currently plaguing humanity. Genetically, at its core, it is a single-strand positive-sense RNA virus. It is a beta-type Coronavirus and is distinct in its structure and binding mechanism compared to other types of coronaviruses. Testing for the virus remains a challenge due to the small market available for at-home detection. Currently, there are three main types of tests for biomarker detection: viral, antigen and antibody. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) remains the gold standard for viral testing. However, the lack of quantitative detection and turnaround time for results are drawbacks. This manuscript focuses on recent advances in COVID-19 detection that have lower limits of detection and faster response times than RT-PCR testing. The advancements in sensing platforms have amplified the detection levels and provided real-time results for SARS-CoV-2 spike protein detection with limits as low as 1 fg/mL in the Graphene Field Effect Transistor (FET) sensor. Additionally, using multiple biomarkers, detection levels can achieve a specificity and sensitivity level comparable to that of PCR testing. Proper biomarker selection coupled with nano sensing detection platforms are key in the widespread use of Point of Care (POC) diagnosis in COVID-19 detection.

NO2-Affinitive Conjugated Polymer for Selective Sub-Parts-Per-Billion NO2 Detection in a Field-Effect Transistor Sensor.

Conjugated polymers (CPs) have provided versatile semiconducting implements for the development of soft electronic devices. When three CPs with the same conjugated framework but different side chains were adopted in the field-effect transistor (FET) sensor for NO2 detection, the response to NO2 showed an opposite tendency to the charge carrier mobility of each CP. Morphological and structural characterizations revealed that the flexible glycol side chain enhances NO2 affinity as well as prevents the formation of lamellar stacking of the CP chains, thereby providing routes for the facile diffusion of NO2. Additionally, theoretical calculations for CP-NO2 complex formation at the molecular level support the relatively low energy barrier for inter-chain transition of NO2 between the glycol-based conjugated frameworks, which implies the spontaneous internal diffusion of NO2 to the semiconductor-dielectric interface in the FET-based sensor. As a result, the CP with a NO2-affinitive morphology exhibited an exceptional sensitivity of 13.8%/ppb upon NO2 (100 ppb) exposure for 50 s and provided excellent selectivity to the FET-based sensor toward other environmentally abundant harmful gases, such as SO2, CO2, and NH3. In particular, the theoretic limit of detection reached down to 0.24 ppb, which is the lowest value ever reported for organic FET-based NO2 gas sensors.

Redox Buffering Effects in Potentiometric Detection of DNA Using Thiol-Modified Gold Electrodes.

Label-free potentiometric detection of DNA molecules using a field-effect transistor (FET) with a gold gate offers an electrical sensing platform for rapid, straightforward, and inexpensive analyses of nucleic acid samples. To induce DNA hybridization on the FET sensor surface to enable potentiometric detection, probe DNA that is complementary to the target DNA has to be immobilized on the FET gate surface. A common method for probe DNA functionalization is based on thiol–gold chemistry, immobilizing thiol-modified probe DNA on a gold gate with thiol–gold bonds. A self-assembled monolayer (SAM), based on the same thiol–gold chemistry, is also needed to passivate the rest of the gold gate surface to prevent non-specific adsorption and to enable favorable steric configuration of the probe DNA. Herein, the applicability of such FET-based potentiometric DNA sensing was carefully investigated, using a silicon nanoribbon FET with a gold-sensing gate modified with thiol–gold chemistry. We discover that the potential of the gold-sensing electrode is determined by the mixed potential of the gold–thiol and gold–oxygen redox interactions. This mixed potential gives rise to a redox buffer effect which buffers the change in the surface charge induced by the DNA hybridization, thus suppressing the potentiometric signal. Analogous redox buffer effects may also be present for other types of potentiometric detections of biomarkers based on thiol–gold chemistry.

P-TiO2/GO heterojunction based VOC sensors: A new approach to amplify sensitivity in FET structure at optimized gate voltage

Graphene/graphene oxide (GO) field effect transistor (FET) is widely investigated for the mainstream electronics. On the other hand, GO and TiO2 nanocomposite is extensively reported for sensing and energy applications. In the current study, we developed p-type TiO2/GO hybrid channel based back gated FET sensors for the detection of volatile organic compounds (VOCs) of very low concentrations. High sensitivity at low concentration of VOC was achieved by high surface reactivity towards VOC by p-TiO2/GO heterojunctions and limited drain current at appropriate gate voltage near Dirac point. Ambipolar transport due to field effect is only observed in GO dominated nanocomposites where 1 vol% p-TiO2 and 99 vol% GO based FET exhibits best performance having 115% response in 100 ppm ethanol at 100 °C with VDS = 0.5 V, VGS = 0.7 V. The response is enlarged ~ 34 times at VGS = 0.7 V as compared to the VGS = 0 V extending the lower detection limit of ethanol up to 500 ppb.

Design and mechanism of photocurrent-modulated graphene field-effect transistor for ultra-sensitive detection of DNA hybridization

Field-effect transistors (FET) using low-dimensional materials has attracted attention for detection of DNA hybridization. Here, we proposed a photocurrent-modulated FET sensor, where the Iphotocurrent(gate)+Iphotocurrent(DNA) dramatically enhance the response signal, Icurrent, compared to a traditional FET sensor. The proposed sensor successfully detects DNA signals with a limit of detection (LOD) down to attomolar concentrations that is nearly 100x lower than a traditional FET sensor. The sensing mechanism is postulated and discussed. The results suggest that photo-coupled modulation opens new avenues for further development of the FET in biosensing applications.

Ti3C2Tx MXene sensor for rapid Hg2+ analysis in high salinity environment

Mercury is one of the leading chemicals of concern and receives much attention in environmental safety. It is of great necessity to develop advanced Hg2+ analysis method for rapid detection and monitoring. Field-effect transistor (FET) sensor, an emerging electronic sensor, has received great attention in environmental analysis since it has unique advantages in achieving rapid analysis of chemicals. Herein, an FET sensor is constructed with Ti3C2Tx MXene as the channel material to detect Hg2+ in water. The sensor displays rapid and selective response to Hg2+. Moreover, the sensor achieves satisfactory performance in Hg2+ detection in high salinity environment (1 M NaCl), which benefits its applications in real water analysis. Based on the investigation of sensing mechanism, the strong response of Ti3C2Tx MXene FET sensor to Hg2+ is due to the adsorption and reduction of Hg2+ to Hg+ on the Ti3C2Tx surface. This reported label-free Ti3C2Tx MXene platform can detect Hg2+ in high salinity environment with high specificity, which has significant application potential for on-site monitoring and risk assessment of Hg2+ in aqueous systems.

Three-dimensional CuPc films decorated with well-ordered PVA parallel nanofiber arrays for low concentration detecting NO2 sensor

Abstract Well-ordered polyvinyl alcohol (PVA) parallel nanofiber arrays (PNAs) were fabricated by using electrospinning receiving board with clined gap. A three-dimensional (3D) copper phthalocyanine (CuPc) organic field effect transistor (OFET) sensor was obtained by evaporating CuPc on the PVA PNAs. This 3D structure is conducive to the multi angle adsorption and desorption of the target gas and active layers. The detection limit of the obtained sensors is lower, and the response and recovery time are also shorter. Compared with single CuPc films and CuPc films with disordered PVA nanofibers sensors, the minimum detection concentration is reduced by one third. The CuPc/PVA PNAs sensors have been successfully used in real-time monitoring of NO2 at 0.3 ppm. The response and recovery time of the CuPc/PVA PNAs sensors are both 0.02 min for 25 ppm NO2. The response and recovery time are 350 and 130 times faster than those of CuPc sensors with disordered PVA nanofibers, respectively. Humidity has little effect on the response of the sensor. This convenient and effective method to prepare high performance OFET sensors can be extended to other gas monitoring.

EDL-FET Sensor As a New Platform for COVID 19 Diagnosis

Studies utilizing biosensors are being extensively used in the field of biomedicine, drug testing and environmental sensing in recent years. Various types of biosensors are being developed to employ in different ways with different sets of advantages. Field -effect transistor (FET) based sensor system is one such sensor which has the unique advantages of rapid detection, low manufacturing cost, ease of use and high sensitivity. In this study, an EDL-FET sensor array has been used to detect a fragment of COVID-19 viral RNA in saliva without performing complex pre-treatment procedures on the sample. The results of this study demonstrate a promising screening tool that can potentially be used for rapid detection of COVID-19. The portability of the device adds an additional advantage that it can be used even in the places with poor healthcare facilities for accurate detection of the pathogen. Introduction Covid19 is one of the deadliest pandemic till date, which is challenge for the complete health care system all over the world. Rapid disease diagnosis and proper patient isolation have been proven as better way in epidemic handling and control. Due to the present unavailability of vaccines and standardized treatment protocol, rapid diagnosis and treatment is in very high mandate. Multiple diagnosing platforms have been developed for the diagnosis of COVID-19 effectively. At present, many platforms such as Lateral flow immune chromatography, serology testing and Antigen detection have been authorized by WHO for the SARS-CoV-2 detection. Real time RT-PCR is considered as the gold standard for disease diagnosis and it is the most viable method to perceive viral RNA from nasopharyngeal swab samples. However, false negative signal is also commonly seen in this PCR method. The long analysis time and large sample collection to result challenges the consistent SARS-CoV-2 detection in PCR analysis method. The quality of testing and realistic data processing also plays a critical role in success of treatment. For nasopharyngeal sampling, the swab sample is invasively collected from nasal duct and it can make the patient very uncomfortable. This may result in reduced viral content in the test sample and resulting in the rise of false negative results. Testing for viral RNA in the patient’s saliva is suggested to be an alternative source for COVID-19 detection. Taking this idea to account, our sensor array was specially fabricated for the diagnosis of viral RNA in the saliva from patient. Artificial ssDNA probes that specifically match with viral RNA, were designed and immobilized over the sensor surface. The functionalized sensor surface was exposed to the saliva sample, which was collected from the suspected patient sample. The specified viral RNA binds with the pre-immobilised ssDNA probes over the FET sensor surface. The corresponding signal changes of EDL-FET sensor for different concentration of complimentary DNA strands and an artificial Covid viral RNA (S-gene RNA) has been analysed. Sensor fabrication An extended gate chip was employed in the sensor array. Electrode surface was cleaned and to ensure proper cleaning of surface, fluorescent images were taken. 10μM ssDNA probe was prepared with TE buffer, followed by adding 1mM TCEP (tris (2-carboxyethyl) phosphine) buffer. The probe solution was then dropped on the cleaned chip and allowed to react for 30 minutes at room temperature. TCEP was used as a reducing agent which helps in the formation of dithiol bonds (SS), making the attachment of the probe easier.Probe- TTT TTT TGG CAA TGT TGT TCC TTG AGG AAGT- FAMComplementary DNA:GCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAG Electrical measurement After the DNA probe was immobilized over the sensor surface, baseline measurement was carried out. The drain current was measured at different voltage bias (Vg=0V and 1V, at Vd=2V). Throughout the measurement, drain current change was taken as sensing signal. Drain current change ( ) is defined as the difference in drain current at Vg=0V and 1V, at Vd=2V. All were performed using identical test solution composition and every measurement was carried out for 20 minutes. Conclusion We successfully immobilized the probe over the sensor area and the corresponding signals were measured with different concentrations of complimentary DNA and viral RNA. Responses to artificial-SARS-CoV-2 viral RNA on functionalized EDL-FET sensor array were effectively monitored. The detection limit of DNA in saliva sample is found to be approximately 1fM, which indicates the feasibility to direct viral RNA without PCR. Due to the ease of usage and sample collection from the patients and fast test results, the EDL-FET platform has significant promise for point of care diagnosis and high potential to be implemented in remote sensing. Figure 1

Immunoaffinity-Based Graphene Field-Effect Transistor Sensor Platform for Fast Detection of S1 Subunit Protein from COVID-19

The epidemic of the novel coronavirus (COVID-19) pneumonia touches the nerve of every person. To prevent and control the epidemic, early diagnosis must be addressed. Nucleic acid polymerase chain reaction (PCR) is currently used worldwide to identify positive carriers of COVID-19 when the virus attacks. However, it requires sophisticated biological design, trained personnel, bulky instruments, and is impossible or inaccurate to detect infected but recovered people or asymptomatic carriers. Here, in an effort towards expanding the screening coverage, we combined the extremely sensitive graphene field-effect transistor (Gr-FET) with highly selective antibody-antigen interaction to develop a COVID-19 immuno-sensor. The Gr-FET immunosensors can fast identify and accurately capture the subunit S1 protein from COVID-19 at a limit of detection down to 0.2 pM. Further results suggest that antigen S1 functionalized Gr-FET can be applied to screen neutralizing-antibodies with high efficiency. Thus, Gr-FET immunosensors provide an appealing opportunity to address the earlier diagnosis as well as the analysis and design of neutralizing-antibody locking methods of this ongoing public health crisis.