Female Pattern Research Articles

Brighteness-dependent visual attractiveness of the human body for horse flies (Diptera: Tabanidae): a field experiment.

The landing patterns of blood-sucking females (Diptera: Tabanidae) are largely influenced by their visual perceptions. When attacking humans, the shape of different body parts and overall brightness of the body could be the factors determining the place of blood-sucking. The visual attractiveness of the human body for tabanids was investigated through a black and a white mannequin in the Danube floodplain, Slovakia. The mannequins were covered by glue once a week. On both of the mannequins, 332 horse flies were stuck. The trapped horse flies on the mannequins belong to the genera Tabanus Linnaeus, 1758, Hybomitra Enderlein, 1922, Chrysops Meigen, 1803, Haematopota Linnaeus, 1758 and Atylotus (Linnaeus, 1767). Based on the trapped tabanids, the black mannequin is 6.06 times more attractive than the white one. The most tabanid carcasses were found on the lower limbs (56.32%) and the least occurred on the head (2.1%), the difference in their occurrence between the lower limbs and head of both mannequins was significant (P < 0.001). A similar significant difference was observed on certain parts of both mannequins on the taxonomical level of the genera Tabanus, Hybomitra, and Atylotus, the carcasses of which aggregated mostly on the lower limbs, rather than on the upper limbs and head.

Identification of Fingerprint Pattern and Lip Print Pattern in Females of Type 2 Diabetes Mellitus as a Biomarker

Diabetes mellitus (D.M.) is a chronic metabolic disorder that has increased worldwide. Fingerprints and lip prints are noninvasive procedures that are genetically used in criminal cases and to determine genetic disorders such as Diabetes mellitus type 2. Dermatoglyphics is the epidermal ridge configuration, the ridged skin on our fingertips, palms, and toes. There are three types (Whorl, et al.). Cheiloscopy, derived from the Greek word (cheilos), which means lip, is the study of crinkles and grooves that are perceptible on our lips and unique. We conducted our research with 90 females, 45 were with (DMT2), and 45 were normal females over 30 years old. The samples were collected in different Kurdistan regions (Erbil City, Qaladza Town, Koya Town, and Koya University). We collected all 10 (ten) fingerprint patterns and divided them into Whorl, loop, and arch using an ink pad. Also, lip samples were collected by using lipstick on A4 paper. According to our research, the predominant fingerprints and lip prints in females with type 2 diabetes were loops for both hands (right (31.1%) and left (28.4%)), and for lips, the print was intersected grooves (28.9%). The predominant fingerprint and lip print for normal females were also loops in both hands (right (28%) and left (25%)), and the lip print was complete vertical grooves (42.2%). The study showed no association between fingerprint pattern and diabetes mellitus type 2 and cannot be used as a biomarker for it. However, there is a clear association between lip print pattern and diabetes mellitus type 2, and it can be used as a specific biomarker.

Zinc Status in Kurdish Adults With Hair Loss.

Zinc is an essential element for hair growth and may act as a strong inhibitor in accelerating follicle regression, besides being an accelerator for the recovery of the hair follicle.This study investigated the status of zinc in Kurdish adults with hair loss and its relation with each of the four types of hair loss. We investigated the zinc status of a sample of Kurdish adults with hair loss who attended the Dermatology Outpatient Clinics at Azadi Teaching Hospital in Duhok, Kurdistan Region, Iraq. We included a total of 200 subjects in this study, of which 125 had hair loss with a diagnosis of alopecia areata, female pattern hair loss, male pattern hair loss, and telogen effluvium, and 75 were sex- and age-matched apparently healthy subjects without hair fall as a control group. Serum samples were used to measure zinc by colorimetric technique. In participants with hair loss, we found significantly lower serum zinc levels (p=0.002) compared with the control group. The telogen effluvium group had the lowest mean serum zinc level (p=0.006) and higher odds ratio compared with other hair loss groups (4.61). Overall, severe zinc deficiency was found in 12 (9.6%) subjects with hair loss, whereas none of the controls had severe zinc deficiency. Mild-to-moderate zinc deficiency was observed in 43 (34.4%) subjects with hair loss compared to one (1.3%) in the control group. Conclusions: Our results showed that lower zinc status is linked to hair loss, especially alopecia areata and telogen effluvium in the Kurdish population.

Females increase reproductive investment when mated to less sexually attractive males in a serially monogamous fish

Reproductive investment decision is an integral part of life-history theory. Differential allocation hypothesis predicts that females should increase investment when mated to high-quality males, conversely, reproductive compensation hypothesis predicts that females should increase investment when mated to low-quality males. Empirical research dominantly focuses on polygamous species and rarely on serially monogamous species. So, the question remains: which hypothesis does serially monogamous species fit? And if it fits reproductive compensation hypothesis, do females only compensate once or continuously for multiple times when mating to low-quality males? Here, we used a serially monogamous fish, the lined seahorse (Hippocampus erectus), to investigate the reproductive investment pattern of females in relation to male quality (measured by sexual attractiveness). We found that females allocated more resources into eggs when they mated to less-sexually-attractive males, indicating the investment pattern of lined seahorse falls in with the prediction of reproductive compensation hypothesis. This finding may imply that the sex role of seahorses is reversed, and female is the side imposed on a greater sexual selection pressure. On this basis, we compared the investment difference of females in two consecutive breeding events when mated to less-sexually-attractive males. We found that females allocated less resources into eggs in the second breeding than in the first one. Females reduced their reproductive compensation in the second breeding, which may be attributed to the improvement in the quality (e.g., paternal care ability) of their mates after the first breeding, thus eliminating the need for them to invest more in the second breeding.

Alterations in neurotransmitters, steroid hormones, vitellogenin, and antioxidant system induced by di-n-butyl phthalate and di-isopentyl phthalate on catfish Rhamdia quelen.

Phthalates, such as di-n-butyl phthalate (DBP) and di-isopentyl phthalate (DiPeP), are pollutants with a high potential for endocrine disruption. This study aimed to evaluate parameters of endocrine disruption in specimens of the Neotropical fish Rhamdia quelen exposed to DBP and DiPeP through their food. After 30days of exposure, the fish were anesthetized and then euthanized, and blood, hypothalamus, liver, and gonads were collected. DBP caused statistically significant alterations in the serotoninergic system of males (5 and 25ng/g) and females (5ng/g) of R. quelen and it increased testosterone levels in females (25ng/g). DiPeP significantly altered the dopaminergic system in females, reduced plasma estradiol levels (125ng/g) and hepatic vitellogenin expression (25ng/g), and changed the antioxidant system in gonads (125ng/g). The results suggest that DBP and DiPeP may have different response patterns in females, with the former being androgenic and the latter being anti-estrogenic. These findings provide additional evidence regarding the molecular events involving DBP and DiPeP in the endocrine disruption potential in juvenile specimens of Rhamdia quelen.

Genotype and X-chromosome inactivation are associated with disease severity in females with X-linked Alport syndrome.

Male patients with X-linked Alport syndrome (XLAS) generally develop end-stage kidney disease in early or middle adulthood and show distinct genotype-phenotype correlations. Female patients, however, show various phenotypes ranging from asymptomatic to severe with no genotype-phenotype correlations. However, the factors affecting the severity of XLAS in female patients are unclear. Since X-chromosome inactivation (XCI) affects the severity of certain female X-linked diseases, we investigated whether genotype and XCI were associated with XLAS severity in female patients in a large Japanese cohort. Among 139 female patients with genetically diagnosed XLAS at our institution, we conducted XCI analysis on peripheral blood leukocytes using the human androgen receptor assay method and analyzed two cohorts. In 74 adult female patients, we evaluated the correlation between kidney function (creatinine-estimated glomerular filtration rate [Cr-eGFR] optimized for Japanese individuals) and genotype/XCI using multivariable linear regression analysis, and in 65 pediatric female patients, we evaluated the correlation between kidney function (Cr-eGFR optimized for Japanese individuals) and genotype/XCI using multivariable linear regression analysis. We also investigated the correlation between the development of proteinuria (urine protein-to-creatinine ratio above normal for the patient's age) and genotype/XCI using multivariable Cox proportional hazard analysis. In adult female patients, XCI pattern was significantly associated with Cr-eGFR (regression coefficient estimate = -0.53, P=0.004), whereas genotype was not (P=0.892). In pediatric female patients, both genotype and XCI pattern were significant independent risk factors for the development of proteinuria (hazard ratio [HR], 3.702; 95% confidence interval [CI], 1.681-8.150; P=0.001 and HR, 1.043; 95% CI, 1.061-1.070; P=0.001, respectively), whereas both genotype and XCI pattern were not associated with Cr-eGFR (P=0.20, P=0.67, respectively). Genotype and XCI are factors associated with the severity in females with XLAS.

Phytoseius Ribaga (Mesostigmata: Phytoseiidae) in the Brazilian Espinhaço Range: seven new species, renaming of the plumifer species group, and a critical review of its taxonomic characters

The mountainous regions in eastern Brazil are home to an astonishing variety of Phytoseius (Mesostigmata: Phytoseiidae) species, 11 of which were collected in surveys conducted between 2010–2012. Our study revealed a great diversity in the plumifer species-group, in which we describe seven new taxa, P. maspretiosus sp. nov., P. multilunatus sp. nov., P. trisetatus sp. nov., P. itobira sp. nov., P. dasalmas sp. nov., P. bahiensis sp. nov., and P. paucipapillatus sp. nov.. This enabled us to compare close species in this group determining valid diagnostic characters, providing a critical review of the prevailing taxonomic traits and revealing unexpected patterns in important diagnostic features based on our observations and the literature. Moreover, we claim the taxonomic importance of two morphological traits usually mentioned in previous studies, but never exploited to their full potential: the female pattern of dorsal ornamentation and the shape of the male spermatodactyl. Aware of the incongruity that the exemplar species of the plumifer group, P. plumifer (Canestrini &amp; Fanzago), belongs to the horridus species group, we propose that the group be renamed as mexicanus-species group. A key to the Brazilian species of Phytoseius is included.

Reduced spatial frequency differentiation and sex-related specificities in fearful face detection in autism: Insights from EEG and the predictive brain model.

Face processing relies on predictive processes driven by low spatial frequencies (LSF) that convey coarse information prior to fine information conveyed by high spatial frequencies. However, autistic individuals might have atypical predictive processes, contributing to facial processing difficulties. This may be more normalized in autistic females, who often exhibit better socio-communicational abilities than males. We hypothesized that autistic females would display a more typical coarse-to-fine processing for socio-emotional stimuli compared to autistic males. To test this hypothesis, we asked adult participants (44 autistic, 51 non-autistic) to detect fearful faces among neutral faces, filtered in two orders: from coarse-to-fine (CtF) and from fine-to-coarse (FtC). Results show lower d' values and longer reaction times for fearful detection in autism compared to non-autistic (NA) individuals, regardless of the filtering order. Both groups presented shorter P100 latency after CtF compared to FtC, and larger amplitude for N170 after FtC compared to CtF. However, autistic participants presented a reduced difference in source activity between CtF and FtC in the fusiform. There was also a more spatially spread activation pattern in autistic females compared to NA females. Finally, females had faster P100 and N170 latencies, as well as larger occipital activation for FtC sequences than males, irrespective of the group. Overall, the results do not suggest impaired predictive processes from LSF in autism despite behavioral differences in fear detection. However, they do indicate reduced brain modulation by spatial frequency in autism. In addition, the findings highlight sex differences that warrant consideration in understanding autistic females.

Genetic Differences between Male and Female Pattern Hair Loss in a Korean Population.

Studies on androgenetic alopecia (AGA or patterned hair loss (PHL)) have suggested different underlying pathological mechanisms between males and females. While many genetic factors for male hair loss have been identified through genome-wide association studies (GWASs), the genetic determinants of female hair loss remain unclear. In this study, we analyzed approximately 1000 individuals (436 males and 568 females) to identify sex-specific genetic factors. We conducted three independent GWASs for the total, male-only, and female-only groups, identifying three novel loci (rs7814359, rs2163085, and rs4793158 of the TSNARE1, FZD1, and GJC1 genes, respectively). rs7814359 showed a significant genome-wide association with AGA in the combined sex group and a weak association in both the male-only and female-only groups. The single nucleotide polymorphism (SNP) rs2163085 showed a significant genome-wide association with AGA in the combined group and notable significance in females. The rs4793158 SNP showed a suggestive association with AGA in both the combined and female-only groups. TSNARE1, related to rs7814359, is involved in vesicle transport. FZD1 is a key regulator of the Wnt signaling pathway. GJC1 is a gap junction protein. The associations of FZD1 and GJC1 with female-specific AGA suggest that sex hormones, such as estrogen, may influence FPHL through these genes. These findings will contribute to our understanding of the sex-specific pathophysiology of AGA.

Estrogen receptor Esr1 induces early ovarian differentiation in Trachemys scripta

This study aims to explore the roles of three estrogen receptors (Esr1, Esr2, and Gper1) in early differentiation of embryonic gonads of Trachemys scripta. The expression characteristics of the receptor genes were studied first. The Esr1, Esr2, and Gper1 agonists PPT, WAY 200070, and G-1 were respectively injected into the embryos at the male-producing temperature (MPT) before initiation of gonadal differentiation. The sex reversal of the treated embryonic gonads was analyzed in terms of morphological structure of gonads, distribution pattern of germ cells, and expression of key genes and proteins involved in sex differentiation. The expression level of esr1 during the critical stage of sex differentiation was higher than those of esr2 and gper1 (very low expression) and was particularly high in the gonads at the female-producing temperature (FPT). After treatment with PPT, the MPT gonads presented obviously feminized morphology and structure, with the germ cells exhibiting a female distribution pattern. Furthermore, the mRNA expression levels of the key genes (dmrt1, amh, and sox9) for male differentiation were down-regulated significantly, while those of the key genes (foxl2 and cyp19a1) for female differentiation were up-regulated observably. The fluorescent signals of Amh and Sox9 expression almost disappeared, while Foxl2 and Arom were activated to express abundantly, which fully demonstrated the sex reversal of the gonads from male to female (sex reversal rate: 70.27%). However, the MPT gonads treated with WAY 200070 and G-1 still differentiated into testes, and the expression patterns of the key genes and proteins were similar to those in male gonads. The above results demonstrate that activation of Esr1 alone can fully initiate the early female differentiation process of gonads, suggesting that estrogen may induce early ovarian differentiation via Esr1 in Trachemys scripta. The findings provide a basis for further revealing the mechanisms of estrogen regulation in sex determination and differentiation of turtles.

Surgeon Gender and Early Complications in Elective Surgery: A Systematic Review and meta-analysis.

To examine the association between surgeon gender and early postoperative complications, including 30-day death and readmission, in elective surgery. Variations between male and female surgeon practice patterns may be a source of bias and gender inequality in the surgical field, perhaps impacting quality of care. However, there are limited and conflicting studies regarding the association between surgeon gender and postoperative outcomes. MEDLINE and Embase were searched in October 2023 for observational studies including patients who underwent elective surgery requiring general or regional anesthesia across multiple surgical specialties. Multiple independent blinded reviewers oversaw the data selection, extraction, and quality assessment according to the PRISMA, MOOSE, and Newcastle Ottawa Scale guidelines. Data were pooled as odds ratios, using a generic inverse-variance random-effects model. Of 944 abstracts screened, 11 studies were included in this systematic review and meta-analysis. A total of 4,440,740 postoperative patients were assessed for a composite primary outcome of mortality, readmission, and other complications within 30 days of elective surgery, with a total of 325,712 (7.3%) surgeries performed by 7,072 (10.9%) female surgeons. There was no association between surgeon gender and the composite of mortality, readmission, and/or complications (odds ratio=0.97, 95% CI 0.95 to 1.00; I2=64.9%; P=0.001). These results support that surgeon gender is not associated with early postoperative outcomes, including mortality, readmission, or other complications in elective surgery. These findings encourage patients, healthcare providers, and stakeholders not to consider surgeon gender as a risk factor for postoperative complications.

Unique Presentations of Female Pattern Hair Loss Evident in Asian and Black Women.

While racial variations in the presentation of androgenetic alopecia have been reported in men, similar data are very limited in women. We studied the distribution patterns of 112 women with female pattern hair loss and identified unique presentations in Asian, particularly those of South Asian descent, and Black women. These results may have implications for treatment response rates in different populations.

Norepinephrine Neurons in the Nucleus of the Solitary Tract Suppress Luteinizing Hormone Secretion in Female Mice.

Stress impairs fertility, at least in part, via inhibition of gonadotropin secretion. Luteinizing hormone (LH) is an important gonadotropin that is released in a pulsatile pattern in males and in females throughout the majority of the ovarian cycle. Several models of stress, including acute metabolic stress, suppress LH pulses via inhibition of neurons in the arcuate nucleus of the hypothalamus that coexpress kisspeptin, neurokinin B, and dynorphin (termed KNDy cells) which form the pulse generator. The mechanism for inhibition of KNDy neurons during stress, however, remains a significant outstanding question. Here, we investigated a population of catecholamine neurons in the nucleus of the solitary tract (NTS), marked by expression of the enzyme dopamine beta-hydroxylase (DBH), in female mice. First, we found that a subpopulation of DBH neurons in the NTS is activated (express c-Fos) during metabolic stress. Then, using chemogenetics, we determined that activation of these cells is sufficient to suppress LH pulses, augment corticosterone secretion, and induce sickness-like behavior. In subsequent studies, we identified evidence for suppression of KNDy cells (rather than downstream signaling pathways) and determined that the suppression of LH pulses was not dependent on the acute rise in glucocorticoids. Together these data support the hypothesis that DBH cells in the NTS are important for regulation of neuroendocrine and behavioral responses to stress.

Prospective Evaluation of Normal Supraspinatus Muscle Using Shear Wave Elastography: Comparison With Symptomatic Tendon Tears.

This study aimed to evaluate normal supraspinatus (SS) muscle elasticity using shear wave elastography (SWE) in an asymptomatic group, analyze its correlation with demographic factors and ultrasound (US) grayscale grade, and compare the elasticity between normal SS muscles and symptomatic SS muscles with tendon tears. A prospective study was conducted with 101 adult patients with normal SS muscle scheduled for surgery due to a contralateral shoulder with SS tendon tear. Both shoulders underwent US examinations, including SWE. The SWE values, including mean and median elasticity, as well as the elasticity ratio, were analyzed for their correlation with demographic characteristics and grayscale grades. A comparison of SWE values was performed between the normal and symptomatic SS muscle groups. The mean SWE modulus of the normal SS muscle was 27.87 kPa (±49.04), with an elasticity ratio of approximately 1.52 (±0.03). Males exhibited slightly higher elasticity ratios compared with females (1.61 vs 1.45, P = .016). The interobserver agreement for all SWE measurements was excellent (>0.8). Grayscale grade increased with age, showing a similar pattern in females (P < .001). However, no significant correlation was observed between SWE values and grayscale grade in the normal SS muscle group. SWE values in normal SS muscles were significantly lower than those with tendon tears (P < .001). SWE provides objective measurements of normal SS muscle elasticity. Gender-based variations were observed, with males exhibiting slightly higher elastography ratios. SWE values were significantly lower in asymptomatic SS muscles compared with those with tendon tears.

No sex difference in maturation of brain morphology during the perinatal period.

Accumulating evidence have documented sex differences in brain anatomy from early childhood to late adulthood. However, whether sex difference of brain structure emerges in the neonatal brain and how sex modulates the development of cortical morphology during the perinatal stage remains unclear. Here, we utilized T2-weighted MRI from the Developing Human Connectome Project (dHCP) database, consisting of 41 male and 40 female neonates born between 35 and 43 postmenstrual weeks (PMW). Neonates of each sex were arranged in a continuous ascending order of age to capture the progressive changes in cortical thickness and curvature throughout the developmental continuum. The maturational covariance network (MCN) was defined as the coupled developmental fluctuations of morphology measures between cortical regions. We constructed MCNs based on the two features, respectively, to illustrate their developmental interdependencies, and then compared the network topology between sexes. Our results showed that cortical structural development exhibited a localized pattern in both males and females, with no significant sex differences in the developmental trajectory of cortical morphology, overall organization, nodal importance, and modular structure of the MCN. Furthermore, by merging male and female neonates into a unified cohort, we identified evident dependencies influences in structural development between different brain modules using the Granger causality analysis (GCA), emanating from high-order regions toward primary cortices. Our findings demonstrate that the maturational pattern of cortical morphology may not differ between sexes during the perinatal period, and provide evidence for the developmental causality among cortical structures in perinatal brains.

Multimodal Biometric Analysis: Exploring Lip Print, Fingerprint, and Blood Group Correlations in the Firozabad Populations

Abstract Aim: This study aimed to establish a relationship between blood groups, fingerprint types, and lip prints that can be utilized to distinguish between genders when identifying a person. Materials and Methods: The study was conducted among 200 female and male participants ages 28 of Firozabad-based populations. Along with the blood types, finger, and lip print patterns were also gathered. For statistical analysis, SPSS Normal H. Nie, standford, california, united states was employed. The qualitative factors’ frequency and percentages were determined. Results: In the present study, overall Type II lip print in males and Type III lip print in females, loop fingerprint pattern and blood group O(+)ve in both sexes were most prevalent, and our findings were matched with the study of Harsha and Jayaraj, in which Type II (39.9%), loops 27 (42.2%), and blood group O(+)ve were observed predominantly. Conclusion: Personal identification of an individual can be greatly aided by personal characteristics such as blood group type, fingerprints, and lip prints. The most frequent patterns in our study were the Type II lip pattern in the males and Type III lip pattern in females, blood group O+, and the loop fingerprint pattern.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

A single exposure to the predator odor 2,4,5-trimethylthiazoline causes long-lasting affective behavioral changes in female mice: Modulation by kappa opioid receptor signaling

The volatile compound 2,4,5-trimethylthiazoline (TMT, a synthetic predator scent) triggers fear, anxiety, and defensive responses in rodents that can outlast the encounter. The receptor systems underlying the development and persistence of TMT-induced behavioral changes remain poorly characterized, especially in females. Kappa opioid receptors regulate threat generalization and fear conditioning and alter basal anxiety, but their role in unconditioned fear responses in females has not been examined. Here, we investigated the effects of the long-lasting kappa opioid receptor antagonist, nor-binalthorphinmine dihydrochloride (nor-BNI; 10mg/kg), on TMT-induced freezing and conditioned place aversion in female mice. We also measured anxiety-like behavior in the elevated plus maze three days after TMT and freezing behavior when returned to the TMT-paired context ten days after the single exposure. We found that 35μl of 10% TMT elicited a robust freezing response during a five-minute exposure in female mice. TMT evoked persistent fear as measured by conditioned place aversion, reduced entries into the open arm of the elevated plus maze, and increased general freezing behavior long after TMT exposure. In line with the known role of kappa-opioid receptors in threat generalization, we found that kappa-opioid receptor antagonism increased basal freezing but reduced freezing during TMT presentation. Together, these findings indicate that a single exposure to TMT causes long-lasting changes in fear-related behavioral responses in female mice and highlights the modulatory role of kappa-opioid receptor signaling on fear-related behavioral patterns in females.

Sonographic comparison of subcutaneous fat layer thickness in the scalp area in patients with androgenetic alopecia compared to healthy individuals: Cross-sectional.

Androgenetic alopecia (AGA) is one of the most common alopecia among men and women worldwide. It is a nonscarring alopecia that has a characterized pattern. In female pattern AGA, the hairline is stable but general thinning occurs most notably in the frontal region. In male-pattern AGA, the hairline is receding and the thinning is most notable in the frontotemporal region. AGA has a complex pathogenesis and relation of subcutaneous fat in the scalp region and the miniaturization of terminal hair follicles is vague. In this study, subcutaneous fat in the frontal scalp an important region for AGA is compared to the occipital scalp that is spared in AGA. Our study is a cross-sectional study that has four groups. Male patient, female patient, male control, female control. Every group has 15 individuals. All of the people in the study are those referred to Rasoul Akram's dermatology clinic. The severity of alopecia is classified by Norwood scaling for male pattern AGA and Ludwig scaling for female pattern AGA. Subcutaneous tissue in the frontal and occipital regions is measured by ultrasonography. For evaluating the effect of aging on subcutaneous fat thickness, we subdivided any group into more than 40 years old and between 20 and 40 years old and compared these two subgroups. The mean age of the three groups of male patient, female patient, and female control is 40 y/o and the mean age of male control is 41 y/o. The mean subcutaneous fat layer thickness in frontal region in male patients group is 6.0mm (more than 40 y/o=6.6mm, between 20 and 40 y/o=5.5mm), in female patients group 5.1mm (more than 40 y/o=5.7mm, between 20 and 40 y/o=4.6mm), in the male control group is 4.4mm (more than 40 y/o=4.7mm, between 20 and 40 y/o=4mm) and in the female control group is 4.1mm (more than 40 y/o=4.5mm, between 20 and 40 y/o=3.6mm). The mean subcutaneous fat layer thickness in the occipital region in the male patient's group is 6.4mm (more than 40 y/o=6.7mm, between 20 and 40 y/o=6mm), in the female patient's group 6.1mm (more than 40 y/o=6.5mm, between 20 and 40 y/o=5.7mm), in the male control group is 6.3mm (more than 40 y/o=6.8mm, between 20 and 40 y/o=5.7mm) and in the female control group is 6.2mm (more than 40 y/o=6.6mm, between 20 and 40 y/o=5.8mm). This study demonstrates that the subcutaneous fat layer in the frontal region in both males and females is thicker in AGA patients than healthy group and the more severe the AGA, the thicker is subcutaneous layer in the frontal region. In the male patients group, the subcutaneous fat layer in the frontal region is thicker than in the female patients group but in the male and female control groups is not so different. The subcutaneous fat layer in the occipital region is thicker in older individuals in both patients and control groups but is not different when compared to AGA patients and control individuals.

Hair transplantation versus scalp micropigmentation: A retrospective study of treatment selection in persons with female pattern hair loss.

Hair transplant (HT) is the standard treatment for female pattern hair loss (FPHL), but scalp micropigmentation (SMP) is an alternative. Currently, there are no criteria to help choose between HT and SMP. Forty female patients with FPHL who had successfully undergone HT and SMP, were reviewed to identify factors that might help decide between treatments. Hair density (HD) and hair caliber were measured at the part line and mid-occipital region by a Folliscope. The sensitivity and specificity of HT and SMP were determined by area under the curve (AUC) and receiver operating characteristic curve. Patients were divided into HT (n = 23) and SMP (n = 17) groups. The follicular unit density (FUD) (HT: 62.06 ± 4.8551/cm2; SMP: 66.59 ± 3.4971/cm2) and HD (HT: 96.16 ± 16.6954/cm2; SMP: 116.08 ± 17.0520/cm2) were significantly different (p < 0.01) between groups. The AUC for FUD was 77.6% with a cutoff value of 66.83 and 87.0% (1-0.412) sensitivity. The AUC for HD was 82.4% with a cutoff value of 96.17 and 69.6% (1-0.118) sensitivity. HD was the most important factor when deciding between HT surgery and SMP. SMP is recommended when the HD is ≥104.6 hairs/cm2 and HT surgery is strongly recommended when the HD is ≤96.17 hairs/cm2.