Fast Real-time Polymerase Chain Reaction Research Articles

Rapid and sensitive detection of shrimp allergens within 30 min using a new food nucleic acid release agent combined with a fast real-time PCR assay

To achieve fast on-site detection of shrimp allergens in food, this study established a new direct, fast, and real-time quantitative polymerase chain reaction (PCR) technology. The technology completed nucleic acid extraction in 4 min using a new nucleic acid releaser, and the DNA samples were detected using fast qPCR within 25 min (total detection was approximately 30 min). The results indicated that the direct fast qPCR can specifically detect shrimp, with a limit of detection of 0.0001% of shrimp in artificially simulated meat samples and a detection precision variation coefficient (CV value) was less than 5%. It successfully identified shrimp in different types of commercial food samples. As a simple, fast, and sensitive nucleic acid testing technology, it has broad application prospects for the on-site detection of shrimp allergens in food.

Gene-Environment Interaction of Interleukin 10 Gene Polymorphism, rs1800896, with Lifestyle on Cardiovascular Risk in Type 2 Diabetes

Abstract Background: Gene–environment interactions play a major role in the phenotypic expression of complex disease traits such as those for cardiovascular diseases. Aims: This study aimed to determine the gene–environment interactions that underpin the relationship between interleukin-10 (IL-10) single-nucleotide polymorphism (1082 G/A [rs1800896]) with lifestyle on cardiovascular disease risk in adult Nigerians with type 2 diabetes mellitus (DM). Setting and Design: This case–control study involved patients with type 2 DM with high cardiovascular risk, determined by the Framingham’s classification, and age, sex, and diabetes-duration matched subjects with low and intermediate cardiovascular risks. Subjects and Methods: The genotypes were detected by polymerase chain reaction (PCR) followed by allelic discrimination using the Applied Biosystems 7900HT Fast Real-Time PCR System. One-way analysis of variance and logistic regression were employed for analysis. Odds ratios (ORs) with 95% confidence intervals (CI) were calculated to estimate the risk caused by the polymorphism. P <0.05 was considered significant. Results: The odds for cardiovascular risk decreased progressively in individuals with the GG, GA, and AA genotypes (OR = 0.80, 95% CI = 0.49–1.28, P = 0.345 and OR = 0.46, 95% CI = 0.24–0.88, P = 0.018 for GA and AA genotypes, respectively. A significantly higher proportion of homozygous (AA) individuals were in the low cardiovascular risk group (54.2%, P = 0.018). Compared with the whole study population, individuals with the AA genotype had consistently lower odds for cardiovascular risk in subpopulations like alcohol users (OR = 0.25 [0.11–0.55], P = 0.001), but the odds were higher among smokers (OR = 1.80 [1.14–2.90], P = 0.017) and those with sedentary lifestyles (OR = 2.46, 95% CI = 1.14–5.33, P = 0.024). Conclusions: The homozygous mutant genotype AA of the IL-10 gene 1082 G/A had a protective effect on cardiovascular risk in type 2 DM. However, this protection was absent in those leading a sedentary lifestyle.

Group B Streptococcus real-time PCR may potentially reduce intrapartum maternal antibiotic treatment.

Protocols for preventing early-onset group B streptococcal (GBS) neonatal infection may result in unnecessary antibiotics administration. Real-time polymerase chain reaction (PCR) can provide a result within 30-60min and has been found to be specific and sensitive for defining intrapartum GBS status. To evaluate whether implementation of GBS fast real-time PCR to all women who require GBS prophylaxis may reduce the use of maternal prophylactic antibiotics. This prospective cohort study included women admitted to a single delivery ward who required prophylactic antibiotics either due to a positive antepartum GBS culture screening performed at 35-37weeks or due to an unknown GBS status with an intrapartum risk factor. All the women were tested by a double vaginal swab (real-time PCR and culture) as soon as it became apparent, they required antibiotic prophylaxis and prior to its administration. Between May 2019 and August 2020, 303 women met eligibility criteria and were enrolled, but four were excluded from the analysis due to failed culture or PCR tests. Of 299 women included in the study, 208 (69.5%) and 180 (60.2%) women, showed no evidence of GBS on intrapartum culture or PCR, respectively. Of 89GBS antepartum carriers, 43 (48.3%) and 32 (35.9%) had negative intrapartum culture and PCR results, respectively. Of the 210 women with risk factors, 165 (78.5%) were culture negative and 148 (70.4%) had a negative PCR. Using intrapartum culture as the gold standard, intrapartum GBS real-time PCR was found to have a sensitivity of 97.8% (95% confidence interval [CI] 92.3, 99.7) and a specificity of 85.6% (95% CI 80.1, 90.1). Compared with antepartum universal culture screening or intrapartum risk-factor assessment, the need for maternal antibiotic treatment may be substantially reduced by implementation of intrapartum GBS real-time PCR, without compromising the sensitivity of GBS detection.

Retrospective Analysis of Minimal Residual Disease Testing By High Throughput Immunosequencing Versus High Sensitivity Flow Cytometry and qPCR in B-Lymphoblastic Leukemia

Introduction: Detection of minimal residual disease (MRD) is one of the most powerful predictors of prognosis in patients with B-Lymphoblastic Leukemia (ALL). Standard methods to detect MRD in ALL include high-resolution flow cytometry (FC) (sensitivity 10 -4 to 10 -5) and qPCR for Ph+ ALL (sensitivity 10 -5 to -6). More recently, high-throughput sequencing (NGS) has been leveraged to detect MRD (sensitivity 10 -6). Retrospective, non-clinical trial based real-world data comparing between these methodologies in the literature is limited to absent. We report our experience at a high-volume cancer center comparing NGS, qPCR, and FC.Methods: All cases of ALL with NGS MRD data at the Moffitt Cancer Center were identified. Corresponding FC, qPCR (p190 and p210) and clinical data were collected electronically and via chart review.10-color flow cytometry was performed on a Gallios System and analyzed on Kaluza (Beckman Coulter, IN). 750,000 events were collected on all cells. Validated lower limit of detection was at least 0.01%. Antibodies included CD15, CD130, CD10, CD58, CD22, CD33, CD13, CD123, CD19, CD20, CD45, CD38, CD34, CD81, CD200 (BD, Biolegend, Beckman Coulter).Quantidex™ BCR-ABL IS Kit (RT qPCR) was used to quantify BCR-ABL (p190 and p210) and ABL transcripts in total RNA in patients with ALL on Applied Biosystems 7500 Fast Dx Real-Time PCR instrument. The results were expressed by normalized BCR-ABL to ABL (control) ratio.clonoSEQ ® (Adaptive Biotechnologies, Seattle, WA) testing was performed which uses multiplex polymerase chain reaction (PCR) and NGS to identify, characterize, and monitor clonotypes of immunoglobulin (Ig) IgH (V-J), IgH (D-J), IgK, and IgL receptor gene sequences, and translocated BCL1/IgH (J) and BCL2/IgH (J) sequences.Statistical analysis was performed by Spearman correlation coefficient and Kaplan-Meier analysis.Results: 95 samples from 54 unique patients were identified that had both NGS and FC data. A subset of patients had qPCR data (n=31 samples). FC+ values ranged from 0.00004 to 0.75. NGS+ values ranged from 8.25E-08 to 0.49. Spearman correlation coefficient showed moderate concordance between NGS and FC at r=0.62 (p<0.001). Spearman correlation coefficient for qPCR vs Flow was r= 0.08 (p=0.68). Three samples were positive by FC (mean tumor burden (MTB= 0.002) but missed by NGS; whereas 31 samples were detected by NGS (MTB= 0.0016) that were missed by flow cytometry. By FC, 9 samples were equivocal of which 7 were definitively designated as MRD+ by NGS. There were 7 qPCR+/NGS- samples (MTB= 2.5 x 10 -5) and 6 qPCR-/NGS+ cases (MTB= 0.012). Overall survival was worse for MRD+ (by NGS, qPCR, or FC) vs MRD(-) (Figure 1).Conclusion:Our study confirms the importance of MRD detection in ALL and shows the robust utility of NGS for MRD detection in routine hematopathology practice. While qPCR, FC and NGS are complementary given that each can potentially detect MRD missed by another method, the data supports the increased sensitivity of NGS over FC. [Display omitted] DisclosuresShah: Servier Genetics: Other; Jazz Pharmaceuticals: Research Funding; Incyte: Research Funding; BeiGene: Consultancy, Honoraria; Acrotech/Spectrum: Honoraria; Pharmacyclics/Janssen: Honoraria, Other: Expenses; Kite, a Gilead Company: Consultancy, Honoraria, Other: Expenses, Research Funding; Precision Biosciences: Consultancy; Amgen: Consultancy; Pfizer: Consultancy, Other: Expenses; Novartis: Consultancy, Other: Expenses; Bristol-Myers Squibb/Celgene: Consultancy, Other: Expenses; Adaptive Biotechnologies: Consultancy. Hussaini: Stemeline Therapeutics: Honoraria.

Photonic toolbox for fast real-time polymerase chain reaction

We present an optical scientist vision for a photonic platform for real-time polymerase chain reaction (qPCR) and reverse-transcription qPCR (qRT-PCR) that integrates a rapid-cycle fiber-optic PCR chamber with feedback-controlled laser heating, online fluorometric detection of PCR products, and all-optical thermometry using an optical readout from color centers of diamond nanoparticles. We show that, with a careful optimization of laser-induced heating and heat-removal geometry, this approach can radically shorten the qPCR thermal cycle relative to standard PCR systems, paving the way toward credit-card-size testing kits for fast point-of-care infection diagnosis. Faster photonic qPCR/qRT-PCR will enable a rapid and highly specific early detection of infections, including new viruses, such as SARS-CoV-2 at very early stages—in most cases, even before the onset of disease, providing much-needed lead time for early treatment and disease spread prevention.

A fast multiplex real-time PCR assay for simultaneous detection of pork, chicken, and beef in commercial processed meat products

As rapid and efficient methods for species identification were required, we developed a fast multiplex real-time polymerase chain reaction (PCR) assay based on TaqMan® probes to simultaneously detect pork, chicken, and beef in processed meat samples within 40 min. For multiplex PCR reactions, the 5’ ends of the pork-, chicken-, and beef-specific probes were labeled with FAM, VIC, and NED, respectively. The specificity of this assay was evaluated using 20 animal species and no cross-contamination was observed. The absolute detection limit was 0.1 pg of DNA extracted for all three target species, and the limit of detection (LOD) of reference meat mixtures was determined to be 0.5%. The optimized method was applied to 66 commercial processed products and specific targets were successfully amplified in under 40 min. Therefore, the fast multiple real-time PCR method can be utilized for easily and rapidly monitoring the presence of three meat species in various processed meat products.

Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Two Multiplex Real-Time PCR Assays to Detect and Differentiate Acinetobacter baumannii and Non- baumannii Acinetobacter spp. Carrying blaNDM, blaOXA-23-Like, blaOXA-40-Like, blaOXA-51-Like, and blaOXA-58-Like Genes

Nosocomial infections caused by Acinetobacter spp. resistant to carbapenems are increasingly reported worldwide. Carbapenem-resistant Acinetobacter (CRA) is becoming a serious concern with increasing patient morbidity, mortality, and lengths of hospital stay. Therefore, the rapid detection of CRA is essential for epidemiological surveillance. Polymerase chain reaction (PCR) has been extensively used for the rapid identification of most pathogens. In this study, we have developed two multiplex real-time PCR assays to detect and differentiate A. baumannii and non-A. baumannii Acinetobacter spp, and common carbapenemase genes, including blaNDM, blaOXA-23-like, blaOXA-40-like, blaOXA-51-like, and blaOXA-58-like. We demonstrate the potential utility of these assays for the direct detection of blaNDM-, blaOXA-23-like-, blaOXA-40-like-, blaOXA-51-like-, and blaOXA-58-like-positive CRA in clinical specimens. Primers were specifically designed, and two multiplex real-time PCR assays were developed: multiplex real-time PCR assay1 for the detection of Acinetobacter baumannii 16S–23S rRNA internal transcribed spacer sequence, the Acinetobacter recA gene, and class-B-metalloenzyme-encoding gene blaNDM; and multiplex real-time PCR assay2 to detect class-D-oxacillinase-encoding genes (blaOXA-23-like, blaOXA-40-like, blaOXA-51-like,and blaOXA-58-like). The assays were performed on an ABI Prism 7500 FAST Real-Time PCR System. CRA isolates were used to compare the assays with conventional PCR and sequencing. Known amounts of CRA cells were added to sputum and fecal specimens and used to test the multiplex real-time PCR assays. The results for target and nontarget amplification showed that the multiplex real-time PCR assays were specific, the limit of detection for each target was 10 copies per 20 μL reaction volume, the assays were linear over six log dilutions of the target genes (r2 > 0.99), and the Ct values of the coefficients of variation for intra- and interassay reproducibility were less than 5%. The multiplex real-time PCR assays showed 100% concordance with conventional PCR when tested against 400 CRA isolates and their sensitivity for the target DNA in sputum and fecal specimens was 102 CFU/mL. Therefore, these novel multiplex real-time PCR assays allow the sensitive and specific characterization and differentiation of blaNDM-, blaOXA-23-like-, blaOXA-40-like-, blaOXA-51-like-, and blaOXA-58-like-positive CRA, making them potential tools for the direct detection of CRA in clinical specimens and the surveillance of nosocomial infections.

Evaluation of Systems for Nopaline Synthase Terminator in Fast and Standard Real-Time PCR to Screen Genetically Modified Organisms

The increasing number and diversity of genetically modified organisms (GMOs) developed and commercialised forces laboratories to apply many different methods of analysis. Matrix-based approach helps to minimize analytical effort reducing the number of identifications. However, the correctness of screening phase needs efficient methods. In this paper, 15 systems for the nopaline synthase terminator (T-nos) from Agrobacterium tumefaciens, a genetic element present in several genetically modified (GM) plants, were tested. The systems were obtained from three methods, and their primers and probes were combined and tested in real-time polymerase chain reaction (PCR) in fast and standard mode. The results have showed that the fast mode presented the lowest mean quantification cycle (Cq) and the highest ∆Rn, that is, the difference between normalized reporter and baseline. These parameters of system efficiency prove that the fast real-time PCR is a possible approach to obtain good data in less than half the time compared to standard mode. The proposed approach allows a practical way to evaluate the most efficient set of oligonucleotides (e.g., primers and probe) in fast and standard real-time PCR before validation. This article describes also in-house validation of the best set oligonucleotides.

Identification and differentiation of PDX1 β-cell progenitors within the human pancreatic epithelium

To minimize the expansion of pancreatic mesenchymal cells in vitro and confirm that β-cell progenitors reside within the pancreatic epithelium. Due to mesenchymal stem cell (MSC) expansion and overgrowth, progenitor cells within the pancreatic epithelium cannot be characterized in vitro, though β-cell dedifferentiation and expansion of MSC intermediates via epithelial-mesenchymal transition (EMT) may generate β-cell progenitors. Pancreatic epithelial cells from endocrine and non-endocrine tissue were expanded and differentiated in a novel pancreatic epithelial expansion medium supplemented with growth factors known to support epithelial cell growth (dexamethasone, epidermal growth factor, 3,5,3'-triiodo-l-thyronine, bovine brain extract). Cells were also infected with a single and dual lentiviral reporter prior to cell differentiation. Enhanced green fluorescent protein was controlled by the rat Insulin 1 promoter and the monomeric red fluorescent protein was controlled by the mouse PDX1 promoter. In combination with lentiviral tracing, cells expanded and differentiated in the pancreatic medium were characterized by flow cytometry (BD fluorescence activated cell sorting), immunostaining and real-time polymerase chain reaction (PCR) (7900HT Fast Realtime PCR System). In the presence of 10% serum MSCs rapidly expand in vitro while the epithelial cell population declines. The percentage of vimentin(+) cells increased from 22% ± 5.83% to 80.43% ± 3.24% (14 d) and 99.00% ± 0.0% (21 d), and the percentage of epithelial cells decreased from 74.71% ± 8.34% to 26.57% ± 9.75% (14 d) and 4.00% ± 1.53% (21 d), P < 0.01 for all time points. Our novel pancreatic epithelial expansion medium preserved the epithelial cell phenotype and minimized epithelial cell dedifferentiation and EMT. Cells expanded in our epithelial medium contained significantly less mesenchymal cells (vimentin(+)) compared to controls (44.87% ± 4.93% vs 95.67% ± 1.36%; P < 0.01). During cell differentiation lentiviral reporting demonstrated that, PDX1(+) and insulin(+) cells were localized within adherent epithelial cell aggregates compared to controls. Compared to starting islets differentiated cells had at least two fold higher gene expression of PDX1, insulin, PAX4 and RFX (P < 0.05). PDX1(+) cells were confined to adherent epithelial cell aggregates and not vimentin(+) cells (mesenchymal), suggesting that EMT is not a mechanism for generating pancreatic progenitor cells.

MC4R rs17782313 gene polymorphism was associated with glycated hemoglobin independently of its effect on BMI in Japanese: the Shimane COHRE study

Background: Type 2 diabetes (T2D) is among the leading public health problems in Japan, and glycated hemoglobin (HbA1c) can be used to screen the population for T2D. Gene polymorphisms, known to be associated with obesity, may predispose individuals to T2D. Rs17782313 the melanocortin 4 receptor (MC4R) has shown one of the strongest associations with body mass index (BMI). We conducted a study to investigate whether rs17782313 (TT versus TC + CC) was associated with HbA1c. Method: We conducted a cross-sectional study including 1142 Japanese adults (446 men: 64.9 ± 14.4 years and 696 women: 66.7 ± 12.3 years). MC4R rs17782313 was genotyped using fast real-time polymerase chain reaction. Results: TC + CC genotype group showed significantly greater BMI (p = 0.039) and HbA1c (p = 0.001) than TT genotype group after adjustment for gender, age and, for HbA1c, BMI. Further analysis using linear regression analysis confirmed that the effect of MC4R rs17782313 on HbA1c (β = 0.08; p = 0.003) was independent of the effect age, gender, BMI, low density lipoprotein cholesterol, homeostasis model assessment of insulin resistance and of beta cell function. This significant independent association was similarly noticed in non-obese (β = 2.82; p = 0.005) subgroups. Conclusion: MC4R rs17782313 was associated with obesity and could confer a certain susceptibility to T2D that could be independent of its pro-obesity effect.

Detection of the FCGR3a polymorphism using a real-time polymerase chain reaction assay

The fragment crystallizable (Fc) region of the immunoglobulin G, low affinity III A receptor (FCGR3a, also known as CD16) belongs to the Fc gamma receptor family (FCGR), which plays an important role in immunoinflammatory processes. It is a low affinity, transmembrane receptor that is mainly expressed in monocytes, natural killer cells, and macrophages. It has been implicated in various inflammatory conditions, and recently a polymorphism (rs396991) in this gene has been shown to influence response to rituximab (anti-CD20) therapy in various disorders. We evaluated two molecular methods to genotype this polymorphism. Archived, formalin-fixed, paraffin-embedded samples from 26 biopsies of diffuse large B-cell lymphoma were retrieved and DNA was extracted. The samples were tested for the FCGR3a polymorphism using real-time polymerase chain reaction (PCR) followed by melt curve analysis or by a standard TaqMan allelic discrimination assay using the ABI 7500 FAST real-time PCR instrument. With the TaqMan allelic discrimination assay, we found that 16 cases were the wild type genotype, homozygous phenylalanine (F/F), for the FCGR3a receptor, whereas two cases had the homozygous valine (V/V) polymorphism and eight cases were heterozygous with a V/F genotype. Results with the real-time PCR followed by melt curve analysis were similar for 25 cases; however, four samples did not have sufficient DNA for the melt curve analysis method, and the result from one sample was discordant. The new TaqMan assay offers several advantages over previously published assays, such as faster turnaround time and ease of interpretation. These performance characteristics make it highly suitable for use in a clinical laboratory.

Altered expression of Bcl-2 , c-Myc , H-Ras , K-Ras , and N-Ras does not influence the course of mycosis fungoides

IntroductionData about genetic alterations in mycosis fungoides (MF) are limited and their significance not fully elucidated. The aim of the study was to explore the expression of various oncogenes in MF and to assess their influence on the disease course.Material and methodsSkin biopsies from 27 MF patients (14 with early MF and 13 with advanced disease) and 8 healthy volunteers were analyzed by real-time polymerase chain reaction (PCR) to detect Bcl-2, c-Myc, H-Ras, K-Ras and N-Ras expression. All PCR reactions were performed using an Applied Biosystems 7900HT Fast Real-Time PCR System and interpreted using Sequence Detection Systems software which utilizes the comparative delta Ct method. The level of mRNA was normalized to GAPDH expression. All data were analyzed statistically.ResultsAll evaluated oncogenes were found to be expressed in the skin from healthy controls and MF patients. Bcl-2 (–4.2 ±2.2 vs. –2.2 ±1.1; p = 0.01), H-Ras (–3.0 ±3.3 vs. 0.6 ±2.6; p = 0.01) and N-Ras (–3.6 ±2.0 vs. –1.1 ±2.4; p = 0.03) were expressed at significantly lower levels in MF. No relationships between oncogene expression and disease stage, presence of distant metastases and survival were observed (p > 0.05 for all comparisons).ConclusionsThe pathogenic role and prognostic significance of analyzed oncogenes in MF seem to be limited and further studies are needed to establish better prognostic factors for patients suffering from MF.

Authentication of male beef by multiplex fast real-time PCR

Meat is a significant source of high-quality nutrients, which are very important in the diet. Among meat products, one of the most prized is bovine meat, of which male beef has been designated to be of a higher quality. However, because of its similarity with female beef, deliberate or unintentional substitutions can occur. To avoid this, methodology based on the fast real-time polymerase chain reaction has been developed to authenticate the species and gender origin of beef. This technique consists of two polymerase chain reactions: one bovine-specific reaction and another Y-chromosome–specific multiplex reaction. This methodology has been validated for all kinds of beef products, including those subjected to intensive processing treatments, and it has subsequently been applied to 10 commercial samples labelled as ox to determine whether they are properly labelled. This assay has been shown to have high specificity, sensitivity and rapidity, with the potential to be a powerful tool in enforcing food labelling regulations.

Alteration of lipids and the transcription of lipid-related genes in myelodysplastic syndromes via a TP53-related pathway

Myelodysplastic syndromes (MDS) are clonal stem cell diseases of the bone marrow characterized by abnormalities in maturation of hematopoietic cells of all lineages. MDS patients frequently have lower lipids and high rates of apoptosis and p53 (TP53) expression. An association between the reduced lipids in MDS and the expression of lipid-related genes was sought. We further evaluated whether 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGcoAR) and low-density lipoprotein receptor (LDL-R) are regulated by TP53 invivo and invitro. Gene expression was measured using real-time reverse transcription polymerase chain reaction on RNA extracted from bone marrow and peripheral blood from eight newly diagnosed MDS patients and eight controls and from mice livers. Serum lipid profile was measured using colorimetric enzymatic procedures. Total- and LDL cholesterol were lower in MDS patients in comparison to controls (p = 0.04 and p = 0.01, respectively). HMGcoAR messenger RNA increased in peripheral blood and bone marrow of MDS patients compared to controls (p = 0.04 and p = 0.01, respectively). LDL-R messenger RNA was higher only in the peripheral blood of MDS patients (p = 0.05). Comparable results were obtained invivo. The transcription of these genes correlates with TP53 activation as documented by p21 messenger RNA elevation, a surrogate for TP53 activation and by using TP53 temperature-sensitive cells treated with adriamycin. To conclude, an association between reduced lipids in MDS and expression of HMGcoAR and LDL-R genes was documented. The transcription of these genes can be regulated by TP53.

KRAS Detection in Colonic Tumors by DNA Extraction From FTA Paper

DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

Development of a rapid and simple molecular identification methodology for true sardines (Sardina pilchardus) and false sardines (Sardinella aurita) based on the real-time PCR technique

Sardines are a small pelagic species belonging to the Clupleidae family and have high commercial value because of the properties of their meat. One of the most valuable fish in this family is Sardina pilchardus, which in addition to its high commercial value is the one that should be labeled on canned sardines, the other species being labeled as sardines X. In this study, a fast real-time polymerase chain reaction (PCR) assay based on TaqMan probe technology, which amplifies a fragment of the internal transcribed spacers (ITS1 and ITS2) and the 5.8 S rRNA region, was developed for the authentication of two commercially important species of sardines, S. pilchardus and S. aurita. This methodology can be applied to a variety of products, including those that have been subjected to intensive processing treatments such as canning. The present methodology was validated and subsequently applied to 50 commercial samples in order to determine whether correct labeling is being carried out in the market. This assay combines the high specificity, sensitivity, and rapidity of fast real-time PCR with the advantages of using two different probes in the same reaction, making it a powerful tool for verifying the correct application of food labeling regulations.

Screening for vancomycin-resistant enterococci: an efficient and economical laboratory-developed test

A laboratory-developed test (Lab Assay), combining enrichment broth and real-time polymerase chain reaction (PCR) for vancomycin-resistant enterococci (VRE) screening, was developed and evaluated in this study. A total of 1,765 faecal or rectal swabs sent to the laboratory for VRE screening were investigated in parallel by Lab Assay and the Roche LightCycler VRE detection kit-based method. The diagnostic values for Lab Assay were as follows: 100% sensitivity, 79.92% specificity, 1.94% positive predictive value and 100% negative predictive value, which were comparable to the results from the LightCycler kit-based assay. The detection limit of Lab Assay was 10(0) to 10(1)colony-forming units (CFU)/ml of inoculum in broth for both VanA-type and VanB-type VRE. The PCR method developed in this study was approved to be applicable on both the Applied Biosystems 7500 Fast Real-Time PCR System and the LightCycler(®) 480 Real-Time PCR System. The flexibility in choosing PCR systems makes it possible that the PCR assay could be fully compatible with the DNA extraction's platform, providing an integrated workflow. Furthermore, the material cost is saved at 7EUR per sample when Lab Assay replaces the commercial kit-based method in our routine screening for VRE. Therefore, the laboratory-developed broth-PCR method is an efficient and economical assay for VRE screening.

Rs710521[A] on chromosome 3q28 close to TP63 is associated with increased urinary bladder cancer risk

Single nucleotide polymorphism (SNP) rs710521[A], located near TP63 on chromosome 3q28, was identified to be significantly associated with increased bladder cancer risk. To investigate the association of rs710521[A] and bladder cancer by new data and by meta-analysis including all published data, rs710521 was studied in 1,425 bladder cancer cases and 1,740 controls that had not been included in previous studies. Blood samples were collected from 1995 to 2010 in Germany (n=948/1,258), Hungary (n=262/65), Venezuela (n=112/190) and Pakistan (n=103/227) supplemented by a meta-analysis of 5,695 cases and 40,187 controls. Detection of a A/G substitution (rs710521) on chromosome 3q28, position 191128627 was done via fast real-time polymerase chain reaction (rt-PCR). Rs710521[A] is associated with increased risk in the unadjusted analysis (OR=1.21; 95% Cl=1.04-1.40; P=0.011) and in the recessive model adjusted for age, gender, smoking habits and ethnicity (OR=1.23; 95% Cl=1.05-1.44; P=0.010). No difference between individuals occupationally exposed versus not occupationally exposed to urinary bladder carcinogens was observed concerning the relevance of rs710521[A]. Similarly, rs710521[A] did not confer different susceptibility in smokers and non-smokers. Performing a meta-analysis of 5,695 cases and 40,187 controls including all published studies on rs710521, a convincing association with bladder cancer risk was obtained (OR=1.18; 95% Cl=1.12-1.25; P<0.0001). However, the odds ratio is relatively small.