Fanleaf Virus Research Articles

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Prevalence of Virus Infections and GLRaV-3 Genetic Diversity in Selected Clones of Croatian Indigenous Grapevine Cultivar Plavac Mali.

The cultivar Plavac Mali (Vitis vinifera L.), the most important indigenous red grapevine cultivar in Croatia, was tested for the presence of 16 grapevine viruses. Thirty-five samples from the collection vineyard were tested for the presence of grapevine leafroll-associated viruses-1, -2, and -3 (GLRaV-1, GLRaV-2 and GLRaV-3, respectively), grapevine fanleaf virus (GFLV), arabis mosaic virus (ArMV), grapevine virus-A (GVA), -B (GVB), -G (GVG), -H (GVH), -I (GVI), -J (GVJ), grapevine fleck virus (GFkV), grapevine rupestris stem pitting associated virus (GRSPaV), and grapevine pinot gris virus (GPGV) by reverse transcription–polymerase chain reaction (RT-PCR). Furthermore, standard PCR was conducted for grapevine badnavirus 1 (GBV-1) and grapevine red blotch virus (GRBV). Mixed infections were most common and GLRaV-3, the most abundant virus found in 85.71% of the vines tested, was further molecularly characterised. Different genomic variants of the heat shock protein homologue (HSP70h) were separated by cloning, detected by single-strand conformation polymorphism (SSCP) analysis, sequenced, and phylogenetically analysed. The presence of phylogenetic groups I and II was only confirmed. This study demonstrates the high virus infection rate of Plavac Mali vines and the heterogeneity of GLRaV-3 present nowadays in a collection vineyard.

The Physiological Impact of GFLV Virus Infection on Grapevine Water Status: First Observations

In a vineyard, grapevines are simultaneously exposed to combinations of several abiotic (drought, extreme temperatures, salinity) and biotic stresses (phytoplasmas, viruses, bacteria). With climate change, the incidences of drought in vine growing regions are increased and the host range of pathogens with increased chances of virulent strain development has expanded. Therefore, we studied the impact of the combination of abiotic (drought) and biotic (Grapevine fanleaf virus (GFLV) infection) stress on physiological and molecular responses on the grapevine of cv. Schioppettino by studying the influence of drought and GFLV infection on plant water status of grapevines, on grapevine xylem vessel occlusion, and on expression patterns of 9-cis-epoxycarotenoid dioxygenase 1 (NCED1), 9-cis-epoxycarotenoid dioxygenase 2 (NCED2), WRKY encoding transcription factor (WRKY54) and RD22-like protein (RD22) genes in grapevines. A complex response of grapevine to the combination of drought and GFLV infection was shown, including priming in the case of grapevine water status, net effect in the case of area of occluded vessels in xylem, and different types of interaction of both stresses in the case of expression of four abscisic acid-related genes. Our results showed that mild (but not severe) water stress can be better sustained by GFLV infection rather than by healthy vines. GFLV proved to improve the resilience of the plants to water stress, which is an important outcome to cope with the challenges of global warming.

Grapevine fanleaf virus (grapevine court-noué virus)

Grapevine fanleaf virus (grapevine court-noué virus)

Sanitarni status tri hrvatske autohtone sorte vinove loze (Vitis vinifera L.) s područja Dalmacije uključene u postupak klonske selekcije

The research of sanitary status and virus presence was conducted on three native Croatian grapevine varieties (Kujudžuša bijela, Zlatarica vrgorska and Trnjak crni) that are grown in Dalmatia region. The investigation was done on 492 vines from 31 vineyards. Vines were tested by ELISA (Enzyme-Linked Immunosorbent Assay) on four main economic viruses: arabis mosaic virus (ArMV), grapevine fanleaf virus (GFLV), grapevine leafroll-associated virus 1 and 3 (GLRaV–1, GLRaV-3) as a first step in clonal selection of these rare native grapevine varieties. Altogether, 40 vines were free of all tested viruses. The research confirms high rate of virus infection and eroded sanitary status of all investigated varieties. The above indicates necessity of implementation clonal and sanitary selection programme.

Selected Genotypes with the Genetic Background ofVitis aestivalisandVitis labruscaAre Resistant toXiphinema index

The ectoparasitic nematode Xiphinema index transmits grapevine fanleaf virus (GFLV) during feeding on grapevine roots, causing fanleaf degeneration in the plant. Hence, resistance breeding is a key to develop novel rootstocks to overcome such threats. In past years, various grapevine species were screened, and a few candidates with partial resistance were identified. However, they were hardly sufficient for viticulture because of their many agronomical defects. To develop reliably resistant rootstocks applicable in viticulture, multiple Vitis spp. genotypes were analyzed using root inoculation with nematodes in glass vials as an early and easy evaluation test. Resistance levels were evaluated 35 days after inoculation based on nematode reproduction factors, focusing on juveniles and eggs. Infection of grapevines with GFLV was analyzed after inoculation with viruliferous X. index. With this fast screening system, putative candidates with resistances against X. index have been identified for future breeding programs. Particularly, genotypes with the genetic background of Vitis aestivalis and Vitis labrusca were found to be nematode-resistant.

Severe Stunting Symptoms upon Nepovirus Infection Are Reminiscent of a Chronic Hypersensitive-like Response in a Perennial Woody Fruit Crop.

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus–host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.

Evidence of Sexual Reproduction Events in the Dagger Nematode Xiphinema index in Grapevine Resistance Experiments Under Controlled Conditions.

The dagger nematode Xiphinema index has a major economic impact because of its transmission of Grapevine fanleaf virus to grapevines. This vector nematode, which was introduced into Western countries from the Middle East together with the domesticated grapevine, mostly reproduces by meiotic parthenogenesis, but microsatellite multilocus genotype (MLG) analysis has revealed the occurrence of rare sexual reproduction events in field conditions. In a previous 6-year study under controlled conditions, we evaluated the durability of resistance to X. index in accessions derived from a muscadine resistance source and reference accessions. In this previous study, we used an equal-proportion mixture of four lines (from Spain, Italy, Greece, and Iran) representative of X. index diversity as the inoculum, and we collected random samples in 3-, 4-, 5-, and 6-year-old vines. Here, we genotyped the individuals from these samples using the MLG technique, and we analyzed the changes in line frequency and the occurrence of sexual reproduction events between lines over time. The nematode lines differed in aggressiveness and hybrids between lines were detected at a low, but apparently increasing rate. Hybridization events were recovered in all accessions, regardless of resistance status and propagation type. Finally, our data provide the first evidence of sexual reproduction in the nematode X. index under controlled conditions.

Metagenomic analysis of nepoviruses: diversity, evolution and identification of a genome region in members of subgroup A that appears to be important for host range

Data mining and metagenomic analysis of 277 open reading frame sequences of bipartite RNA viruses of the genus Nepovirus, family Secoviridae, were performed, documenting how challenging it can be to unequivocally assign a virus to a particular species, especially those in subgroups A and C, based on some of the currently adopted taxonomic demarcation criteria. This work suggests a possible need for their amendment to accommodate pangenome information. In addition, we revealed a host-dependent structure of arabis mosaic virus (ArMV) populations at a cladistic level and confirmed a phylogeographic structure of grapevine fanleaf virus (GFLV) populations. We also identified new putative recombination events in members of subgroups A, B and C. The evolutionary specificity of some capsid regions of ArMV and GFLV that were described previously and biologically validated as determinants of nematode transmission was circumscribed in silico. Furthermore, a C-terminal segment of the RNA-dependent RNA polymerase of members of subgroup A was predicted to be a putative host range determinant based on statistically supported higher π (substitutions per site) values for GFLV and ArMV isolates infecting Vitis spp. compared with non-Vitis-infecting ArMV isolates. This study illustrates how sequence information obtained via high-throughput sequencing can increase our understanding of mechanisms that modulate virus diversity and evolution and create new opportunities for advancing studies on the biology of economically important plant viruses.

Sampling for vegetative propagation: A phytosanitary status survey of grapevines collection by One Step RT-PCR method

Purpose. Grapevines (Vitis spp.) are affected by many viral diseases which cause serious pathological problems. GLRaV-3 is among the most widespread leafroll viruses, while Grapevine Fanleaf Virus (GFLV) is a destructive pathogen which reduces the lifespan of grapevine. Considering the impact and the spread of these diseases, our objective was to analyse the presence of these two viruses in several grapevine varieties in grapevine collection at ATTC Vlore. Data gathered from plant pathogens serve to better understand and prevent the spread of pathogens, as a mandatory rule for the quality control of certified plant material during vegetative propagation. Method. The presence of two common viruses were tested using virus specific primers; LC1/LC2 primer pair designed from the hHSP70 gene for detecting Grapevine Leafroll-associated Virus-3 (GLRaV3) and C3390/H2999 primer pair, designed from coat protein coding regions for detecting Grapevine Fanleaf Virus (GFLV), in six varieties; ‘Merlot’, ‘Kallmet’, ‘Shesh i zi’, ‘Shesh i bardhё’, ‘Debinё’, and ‘Pulёz’, provided through a randomised sampling procedure. One Step Reverse Transcription Polymerase Chain Reaction assay was used to detect the viral presence. Results showed a high (100%) prevalence of GLRaV3 virus in all of analysed samples, as the most frequent among the two pathogens. Analysis for of GFLV virus showed low infection rate, being present in only one sample. Conclusions. We herein show an efficient, fast and reproducible method for detecting grapevine viruses through one step RT-PCR. Our results suggest that sampling of the infected plant material should be avoided due to the presence of viral infections.

Association of satellite RNA with Grapevine fanleaf virus in its geographical origin and sequence characteristics

The region between The Caspian Sea and Black Sea has been hypothesized as the origin of grapevine. Likewise, an extensive study on Grapevine fanleaf virus (GFLV) from this region suggests this region as a possible origin of the virus. However, as yet there is no information as to whether or not the virus variants from this region accompanied with the virus satellite RNA (satRNA) and if so, how diverse theses satRNAs can be. To answer these questions, Grapevine fanleaf virus isolates were collected from different vineyards in the northwest region of Iran for the occurrence of the satellite RNA. A total of 421 samples including Vitis vinifera , Chenopodium quinoa , Chenopodium amaranticolor , Cynodon dactylis , Medicago sativa were initially screened against GFLV by RT-PCR with the coat protein primers (Cp433, Cp912). When the GFLV-infected plants (36 samples) were screened by RT-PCR with the newly designed satRNA primers Gf750 and Gr750, three samples appeared to possess the satRNA. The satellite cDNA fragments were cloned and sequenced and when the resulting data were compared with sequences of previously-reported satRNA of GFLV and Arabis mosaic virus (ArMV), 70–98% and 69–71% similarities were found, respectively. Phylogenetic studies revealed distinctness of the satRNAs from Iran. This may suggest coevolution of the satRNA with the helper virus because GFLV isolates from this region also form a distinct branch. Among previously reported corresponding satRNA sequences to those from Slovenia and South Central Europe were the closest. This study also reports C. amaranticolor as the natural host for GFLV, which was previously reported only as an experimental host.

A single resistance factor to solve vineyard degeneration due to grapevine fanleaf virus

Grapevine fanleaf disease, caused by grapevine fanleaf virus (GFLV), transmitted by the soil-borne nematode Xiphinema index, provokes severe symptoms and economic losses, threatening vineyards worldwide. As no effective solution exists so far to control grapevine fanleaf disease in an environmentally friendly way, we investigated the presence of resistance to GFLV in grapevine genetic resources. We discovered that the Riesling variety displays resistance to GFLV, although it is susceptible to X. index. This resistance is determined by a single recessive factor located on grapevine chromosome 1, which we have named rgflv1. The discovery of rgflv1 paves the way for the first effective and environmentally friendly solution to control grapevine fanleaf disease through the development of new GFLV-resistant grapevine rootstocks, which was hitherto an unthinkable prospect. Moreover, rgflv1 is putatively distinct from the virus susceptibility factors already described in plants.

Genetic Structure and Molecular Variability of Grapevine Fanleaf Virus in Sicily

Grapevine fanleaf virus (GFLV) is one of the main causes of grapevine fanleaf degeneration disease (GFDD) and is present in almost all areas where grapevine is cultivated. In this work, we ascertained the presence and spread of GFLV in different commercial vineyards in four Sicilian provinces (Italy), and its genetic structure and molecular variability were studied. In detail, a total of 617 grapevine samples of 11 autochthonous grapevine cultivars were collected in 20 commercial vineyards. Preliminary screening by serological (DAS-ELISA) and molecular (RT-PCR) analyses for ArMV (arabis mosaic virus) and GFLV detection were conducted. Results obtained showed the absence of ArMV in all the samples analyzed, while 48 out of 617 samples gave positive results to GFLV, for a total of 9 out of 11 cultivars analyzed. Phylogenetic analyses carried out on the GFLV-CP gene of 18 Sicilian GFLV sequences selected in this study showed a certain degree of variability among the Sicilian isolates, suggesting a different origin, probably as a consequence of the continuous interchange of GFLV-infected propagating material with other Italian regions or viticultural areas located in other countries.

Distribution and Genetic Diversity of Grapevine Viruses in Russia.

Viral diseases can seriously damage the vineyard productivity and the quality of grape and wine products. Therefore, the study of the species composition and range of grapevine viruses is important for the development and implementation of strategies and tactics to limit their spread and increase the economic benefits of viticulture. In 2014–2019, we carried out a large-scale phytosanitary monitoring of Russian commercial vineyards in the Krasnodar region, Stavropol region and Republic of Crimea. A total of 1857 samples were collected and tested for the presence of Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine leafroll-associated virus-1 (GLRaV-1), Grapevine leafroll-associated virus-2 (GLRaV-2), Grapevine leafroll-associated virus-3 (GLRaV-3), Grapevine fanleaf virus (GFLV), and Grapevine fleck virus (GFkV) using RT-PCR. Out of all samples tested, 54.5% were positive for at least one of the viruses (GRSPaV, GVA, GLRaV-1, GLRaV-2, GLRaV-3, GFLV, GFkV) in the Stavropol region, 49.8% in the Krasnodar region and 49.5% in the Republic of Crimea. Some plants were found to be infected with several viruses simultaneously. In the Republic of Crimea, for instance, a number of plants were infected with five viruses. In the Krasnodar region and the Republic of Crimea, 4.7% and 3.3% of the samples were predominantly infected with both GFkV and GRSPaV, whereas in the Stavropol region, 6% of the selected samples had both GLRaV-1 and GVA infections. We carried out a phylogenetic analysis of the coat protein genes of the detected viruses and identified the presence of GVA of groups I and IV, GRSPaV of groups BS and SG1, GLRaV-1 of group III, GLRaV-2 of groups PN and H4, GLRaV-3 of groups I and III. The results obtained make it possible to assess the viral load and the distribution of the main grapevine viruses on plantations in the viticultural zones of Russia, emphasizing the urgent need to develop and implement long-term strategies for the control of viral diseases of grapes.

Identification of protein interactions of grapevine fanleaf virus RNA-dependent RNA polymerase during infection of Nicotiana benthamiana by affinity purification and tandem mass spectrometry.

The RNA-dependent RNA polymerase (1EPol) is involved in replication of grapevine fanleaf virus (GFLV, Nepovirus, Secoviridae) and causes vein clearing symptoms in Nicotiana benthamiana. Information on protein 1EPol interaction with other viral and host proteins is scarce. To study protein 1EPol biology, three GFLV infectious clones, i.e. GHu (a symptomatic wild-type strain), GHu-1EK802G (an asymptomatic GHu mutant) and F13 (an asymptomatic wild-type strain), were engineered with protein 1EPol fused to a V5 epitope tag at the C-terminus. Following Agrobacterium tumefaciens -mediated delivery of GFLV clones in N. benthamiana and protein extraction at seven dpi, when optimal 1EPol:V5 accumulation was detected, two viral and six plant putative interaction partners of V5-tagged protein 1EPol were identified for the three GFLV clones by affinity purification and tandem mass spectrometry. This study provides insights into the protein interactome of 1EPol during GFLV systemic infection in N. benthamiana and lays the foundation for validation work.

Grapevine Pinot gris virus infecting grapevines in Romania - Short Communicaiton

Grapevine Pinot gris virus (GPGV) has been identified in many grape growing countries of the world since 2012. The aim of this work was to investigate the presence of GPGV on some accessions collected from a germplasm collection, in addition to the propagation material and clonal selection samples. During 2019–2020, a total of 199 samples have been analysed by a double antibody sandwich – enzyme-linked immunosorbent assay (DAS-ELISA) for the presence of GPGV, Grapevine fanleaf virus (GFLV), Grapevine leafroll-associated virus-1+3 (GLRaV-1+3) and Grapevine fleck virus (GFkV). Among them, 107 samples (53.76%) showed a GPGV-infection, associated with or without symptoms on the leaves (deformations, chlorosis, mosaic, wrinkles) or stunting plants. The distribution of infected varieties showed a high rate of infection in old varieties (37.38%), followed by clones (32.71%), rootstocks (11.21%), clonal selections (9.35%) and new varieties (9.35%). The tests revealed the association of GPGV with GFkV (5 cases) and GLRaV-1+3 (2 cases). GPGV should be included in the rules of grapevine certification schemes for the production of virus-free mother plants.

Evaluating nematode resistance of grapevine rootstocks based on Xiphinema index reproduction rates in a fast screening assay

By feeding on grapevine roots, the ectoparasite Xiphinema index transmits grapevine fanleaf virus (GFLV), causing fanleaf degeneration in the plant. Therefore, rootstock breeding programs are considered a key to resistance to both threats. Previous screening depends on long-lasting inoculation experiments and mainly focuses on evaluating gall formation on the parasitized roots to identify potential resistance in grapevines. Since the roots of grapevine rootstocks resistant to X. index and even those of susceptible cultivars showed no reliable gall formation after parasitism, and further, root thickening was regularly found on non-inoculated control plants, nematode reproduction rates were used to validate rootstock phenotypes regarding susceptibility or resistance to X. index. For our approach, a glass vial assay was performed, and 35 days after inoculation the nematode population was determined by counting juveniles after the extraction. Reproduction rates were high on susceptible rootstock cultivars and decreased the more resistant a cultivar is considered. Besides focusing solely on root gall formation, the nematode reproduction rate should be included as a reliable indicator for resistance screening. The described assay setup enables the evaluation of resistance levels by fast screening to select promising rootstock candidates.

Studies on the Occurrence of Viruses in Planting Material of Grapevines in Southwestern Germany.

Viral diseases in viticulture lead to annual losses in the quantity and quality of grape production. Since no direct control measures are available in practice, preventive measures are taken to keep the vines healthy. These include, for example, the testing of propagation material for viruses such as Arabis mosaic virus (ArMV), Grapevine fanleaf virus (GFLV) or Grapevine leafroll-associated virus 1 (GLRaV-1) and 3 (GLRaV-3). As long-term investigations have shown, GLRaV-1 (2.1%) occurs most frequently in southwestern German wine-growing regions, whereas GLRaV-3 (<0.1%) is almost never found. However, tests conducted over 12 years indicate that there is no general decline in virus-infected planting material. Thus, it can be assumed that a spread of the viruses via corresponding vectors still takes place unhindered. Beyond the examinations regulated within the German Wine Growing Ordinance, one-time tests were carried out on Grapevine Pinot gris virus (GPGV). This analysis showed that GPGV was found in 17.2% of the samples.

Survey of five major grapevine viruses infecting Blatina and Žilavka cultivars in Bosnia and Herzegovina.

The sanitary status of grapevines has not yet been considered sufficiently in vineyards throughout Bosnia and Herzegovina (BiH). An extensive survey of five major grapevine viruses in the country was carried out in 2019. A total of 630 samples from the two dominant autochthonous cultivars, named Žilavka and Blatina, were tested by DAS-ELISA for the presence of grapevine leafroll-associated viruses (GLRaV-1 and 3), grapevine fleck virus (GFkV), grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV). Eighty-eight % of the samples were positive for at least one virus, and all five viruses were detected, thought with different incidence, i.e. GLRaV-3 (84%), GFLV (43%), GLRaV-1 (14%), GFkV (10%) and ArMV (0.2%). The majority of infected plants (about 75%) were asymptomatic. Specific virus symptoms were observed in the remaining infected plants, together with the reported GLRaV vectors, Planococcus ficus and Parthenolecanium corni, while nematodes of the Xiphinema genus were not found in the GFLV- or ArMV-infected vineyards. The GLRaV-3 CP phylogenetic analyses showed 75–100% nucleotide identity between the BiH and reference isolates, and the BiH isolates clustered into the major group. The dNS/dS ratio indicated a negative selection of the virus population, and the lack of geographical structuring within the population was observed. In addition, putative GLRaV-3 recombinants with breakpoints in the 5’ of the CP gene were detected, while no recombinant strains were identified for the other four viruses. The obtained results indicate a deteriorated sanitary status of the cultivated grapevines, the prevalence and intraspecies genetic diversity of GLRaV-3 throughout the country. The establishment of certified grapevine material and adequate virus vector control is therefore of primary importance to prevent further spread of these viruses. This study presents the results of the first molecular characterisation of grapevine viruses in Bosnia and Herzegovina.

Effect of fungicide farmayod on agrotechnical and technological indicators of grapevine, on viral diseases and oidium

The paper presents the study on the effect of Farmayod’s GR (100 g/l of iodine) spraying on vineyards of Cabernet Sauvignon and Baklanovsky varieties on the degree of viral and oidium prevalence as well as on agrobiological and technological indicators. According to the aggregate agrobiological and technological indicators, the best results on Cabernet Sauvignon variety were obtained when the drug was used at a concentration of 0.06 %. On the Baklanovsky variety the best indicators were obtained at a drug concentration of 0.04%. Testing of plant samples for the presence of Grapevine fan leaf virus, Arabis mosaic virus and Oidium tuckeri showed that after two years of applying the drug, the prevalence of infected plants (P, %) with Grapevine fanleaf virus on the Cabernet Sauvignon cultivar varied from 0% (fungicide concentration 0.04 and 0.05 %) to 0.8 % (0.06 %) and 2.65 % (control). For Baklanovsky variety: Grapevine fanleaf virus - concentration 0.04 % - 1.8; 0.05 % - 0.4; 0.06 % - 2.0; control - 2.65 %. Arabis mosaic virus – 0; 0; 3.0; 12.1 %, respectively. Oidium tuckeri was 0 % in all variants with any drug concentrations. Control variant and later 80 % for 29.09.