F-ATP Synthase Research Articles

Mitochondrial ATP synthase F1 subcomplex forms a gate of c-subunit leak channel

Mitochondrial ATP synthase F1 subcomplex forms a gate of c-subunit leak channel

Assessing the relative role of F-ATP synthase and adenine nucleotide translocator in the permeability transition

Assessing the relative role of F-ATP synthase and adenine nucleotide translocator in the permeability transition

Investigating the roles of F-ATP synthase dimerization subunits e and g in Drosophila melanogaster

Investigating the roles of F-ATP synthase dimerization subunits e and g in Drosophila melanogaster

Structures, regulation and discoveries of new drug-targets and inhibitors of the F-ATP synthase engine from drug resistant microorganisms

Structures, regulation and discoveries of new drug-targets and inhibitors of the F-ATP synthase engine from drug resistant microorganisms

TNK2/ACK1-mediated phosphorylation of ATP5F1A (ATP synthase F1 subunit alpha) selectively augments survival of prostate cancer while engendering mitochondrial vulnerability

ABSTRACT The challenge of rapid macromolecular synthesis enforces the energy-hungry cancer cell mitochondria to switch their metabolic phenotypes, accomplished by activation of oncogenic tyrosine kinases. Precisely how kinase activity is directly exploited by cancer cell mitochondria to meet high-energy demand, remains to be deciphered. Here we show that a non-receptor tyrosine kinase, TNK2/ACK1 (tyrosine kinase non receptor 2), phosphorylated ATP5F1A (ATP synthase F1 subunit alpha) at Tyr243 and Tyr246 (Tyr200 and 203 in the mature protein, respectively) that not only increased the stability of complex V, but also increased mitochondrial energy output in cancer cells. Further, phospho-ATP5F1A (p-Y-ATP5F1A) prevented its binding to its physiological inhibitor, ATP5IF1 (ATP synthase inhibitory factor subunit 1), causing sustained mitochondrial activity to promote cancer cell growth. TNK2 inhibitor, (R)-9b reversed this process and induced mitophagy-based autophagy to mitigate prostate tumor growth while sparing normal prostate cells. Further, depletion of p-Y-ATP5F1A was needed for (R)-9b-mediated mitophagic response and tumor growth. Moreover, Tnk2 transgenic mice displayed increased p-Y-ATP5F1A and loss of mitophagy and exhibited formation of prostatic intraepithelial neoplasia (PINs). Consistent with these data, a marked increase in p-Y-ATP5F1A was seen as prostate cancer progressed to the malignant stage. Overall, this study uncovered the molecular intricacy of tyrosine kinase-mediated mitochondrial energy regulation as a distinct cancer cell mitochondrial vulnerability and provided evidence that TNK2 inhibitors can act as “mitocans” to induce cancer-specific mitophagy. Abbreviations: ATP5F1A: ATP synthase F1 subunit alpha; ATP5IF1: ATP synthase inhibitory factor subunit 1; CRPC: castration-resistant prostate cancer; DNM1L: dynamin 1 like; MAP1LC3B/LC3B: microtubule associated protein 1 light chain 3 beta; Mdivi-1: mitochondrial division inhibitor 1; Mut-ATP5F1A: Y243,246A mutant of ATP5F1A; OXPHOS: oxidative phosphorylation; PC: prostate cancer; PINK1: PTEN induced kinase 1; p-Y-ATP5F1A: phosphorylated tyrosine 243 and 246 on ATP5F1A; TNK2/ACK1: tyrosine kinase non receptor 2; Ub: ubiquitin; WT: wild type

Ligand-free mitochondria-localized mutant AR-induced cytotoxicity in spinal bulbar muscular atrophy.

Spinal bulbar muscular atrophy (SBMA), the first identified CAG-repeat expansion disorder, is an X-linked neuromuscular disorder involving CAG-repeat-expansion mutations in the androgen receptor (AR) gene. We utilized CRISPR-Cas9 gene editing to engineer novel isogenic human induced pluripotent stem cell (hiPSC) models, consisting of isogenic AR knockout, control and disease lines expressing mutant AR with distinct repeat lengths, as well as control and disease lines expressing FLAG-tagged wild-type and mutant AR, respectively. Adapting a small-molecule cocktail-directed approach, we differentiate the isogenic hiPSC models into motor neuron-like cells with a highly enriched population to uncover cell-type-specific mechanisms underlying SBMA and to distinguish gain- from loss-of-function properties of mutant AR in disease motor neurons. We demonstrate that ligand-free mutant AR causes drastic mitochondrial dysfunction in neurites of differentiated disease motor neurons due to gain-of-function mechanisms and such cytotoxicity can be amplified upon ligand (androgens) treatment. We further show that aberrant interaction between ligand-free, mitochondria-localized mutant AR and F-ATP synthase is associated with compromised mitochondrial respiration and multiple other mitochondrial impairments. These findings counter the established notion that androgens are requisite for mutant AR-induced cytotoxicity in SBMA, reveal a compelling mechanistic link between ligand-free mutant AR, F-ATP synthase and mitochondrial dysfunction, and provide innovative insights into motor neuron-specific therapeutic interventions for SBMA.

Atomic solution structure of Mycobacterium abscessus F-ATP synthase subunit ε and identification of Ep1MabF1 as a targeted inhibitor.

Mycobacterium abscessus (Mab) is a nontuberculous mycobacterium of increasing clinical relevance. The rapidly growing opportunistic pathogen is intrinsically multi-drug-resistant and causes difficult-to-cure lung disease. Adenosine triphosphate, generated by the essential F1 FO ATP synthase, is the major energy currency of the pathogen, bringing this enzyme complex into focus for the discovery of novel antimycobacterial compounds. Coupling of proton translocation through the membrane-embedded FO sector and ATP formation in the F1 headpiece of the bipartite F1 FO ATP synthase occurs via the central stalk subunits γ and ε. Here, we used solution NMR spectroscopy to resolve the first atomic structure of the Mab subunit ε (Mabε), showing that it consists of an N-terminal β-barrel domain (NTD) and a helix-loop-helix motif in its C-terminal domain (CTD). NMR relaxation measurements of Mabε shed light on dynamic epitopes and amino acids relevant for coupling processes within the protein. We describe structural differences between other mycobacterial ε subunits and Mabε's lack of ATP binding. Based on the structural insights, we conducted an in silico inhibitor screen. One hit, Ep1MabF1, was shown to inhibit the growth of Mab and bacterial ATP synthesis. NMR titration experiments and docking studies described the binding epitopes of Ep1MabF1 on Mabε. Together, our data demonstrate the potential to develop inhibitors targeting the ε subunit of Mab F1 FO ATP synthase to interrupt the coupling process.

The mitochondrial chaperone TRAP1 regulates F-ATP synthase channel formation

Binding of the mitochondrial chaperone TRAP1 to client proteins shapes bioenergetic and proteostatic adaptations of cells, but the panel of TRAP1 clients is only partially defined. Here we show that TRAP1 interacts with F-ATP synthase, the protein complex that provides most cellular ATP. TRAP1 competes with the peptidyl-prolyl cis-trans isomerase cyclophilin D (CyPD) for binding to the oligomycin sensitivity-conferring protein (OSCP) subunit of F-ATP synthase, increasing its catalytic activity and counteracting the inhibitory effect of CyPD. Electrophysiological measurements indicate that TRAP1 directly inhibits a channel activity of purified F-ATP synthase endowed with the features of the permeability transition pore (PTP) and that it reverses PTP induction by CyPD, antagonizing PTP-dependent mitochondrial depolarization and cell death. Conversely, CyPD outcompetes the TRAP1 inhibitory effect on the channel. Our data identify TRAP1 as an F-ATP synthase regulator that can influence cell bioenergetics and survival and can be targeted in pathological conditions where these processes are dysregulated, such as cancer.

Shoot rot of Zizania latifolia and the first record of its pathogen Pantoea ananatis in China

The aquatic grass Zizania latifolia grows symbiotically with the fungus Ustilago esculenta producing swollen structures called Jiaobai, widely cultivated in China. A new disease of Z. latifolia was found in Zhejiang Province, China. Initial lesions appeared on the leaf sheaths or sometimes on the leaves near the leaf sheaths. The lesions extended along the axis of the leaf shoots and formed long brown to dark brown streaks from the leaf sheath to the leaf, causing sheath rot and death of entire leaves on young plants. The pathogen was isolated and identified as the bacterium Pantoea ananatis, based on 16S ribosomal RNA (rRNA) gene sequencing, multilocus sequence analysis (atpD (β-subunit of ATP synthase F1), gyrB (DNA gyrase subunit B), infB (translation initiation factor 2), and rpoB (β‍-subunit of RNA polymerase) genes), and pathogenicity tests. Ultrastructural observations using scanning electron microscopy revealed that the bacterial cells colonized the vascular tissues in leaf sheaths, forming biofilms on the inner surface of vessel walls, and extended between vessel elements via the perforated plates. To achieve efficient detection and diagnosis of P. ananatis, species-specific primer pairs were designed and validated by testing closely related and unrelated species and diseased tissues of Z. latifolia. This is the first report of bacterial sheath rot disease of Z. latifolia caused by P. ananatis in China.

Mitochondrial ATP synthase inhibitory factor 1 interacts with the p53–cyclophilin D complex and promotes opening of the permeability transition pore

The mitochondrial permeability transition pore (PTP) is a Ca2+-dependent megachannel that plays an important role in mitochondrial physiology and cell fate. Cyclophilin D (CyPD) is a well-characterized PTP regulator, and its binding to the PTP favors pore opening. It has previously been shown that p53 physically interacts with CyPD and opens the PTP during necrosis. Accumulating studies also suggest that the F-ATP synthase contributes to the regulation and formation of the PTP. F-ATP synthase IF1 (mitochondrial ATP synthase inhibitory factor 1) is a natural inhibitor of F-ATP synthase activity; however, whether IF1 participates in the modulation of PTP opening is basically unknown. Here, we demonstrate using calcium retention capacity assay that IF1 overexpression promotes mitochondrial permeability transition via opening of the PTP. Intriguingly, we show that IF1 can interact with the p53–CyPD complex and facilitate cell death. We also demonstrate that the presence of IF1 is necessary for the formation of p53–CyPD complex. Therefore, we suggest that IF1 regulates the PTP via interaction with the p53–CyPD complex, and that IF1 is necessary for the inducing effect of p53–CyPD complex on PTP opening.

Mitochondrial ATP synthase c-subunit leak channel triggers cell death upon loss of its F1 subcomplex

Mitochondrial ATP synthase is vital not only for cellular energy production but also for energy dissipation and cell death. ATP synthase c-ring was suggested to house the leak channel of mitochondrial permeability transition (mPT), which activates during excitotoxic ischemic insult. In this present study, we purified human c-ring from both eukaryotic and prokaryotic hosts to biophysically characterize its channel activity. We show that purified c-ring forms a large multi-conductance, voltage-gated ion channel that is inhibited by the addition of ATP synthase F1 subcomplex. In contrast, dissociation of F1 from FO occurs during excitotoxic neuronal death suggesting that the F1 constitutes the gate of the channel. mPT is known to dissipate the osmotic gradient across the inner membrane during cell death. We show that ATP synthase c-subunit knock down (KD) prevents the osmotic change in response to high calcium and eliminates large conductance, Ca2+ and CsA sensitive channel activity of mPT. These findings elucidate the gating mechanism of the ATP synthase c-subunit leak channel (ACLC) and suggest how ACLC opening is regulated by cell stress in a CypD-dependent manner.

Effects of dietary L-citrulline supplementation on nitric oxide synthesis, immune responses and mitochondrial energetics of broilers during heat stress

L-Citrulline is a non-protein amino acid that promotes arginine recycling and muscle protein synthesis. This study investigated whether L-citrulline can exert these functions in heat-stressed chickens. Arbor acre broilers were fed either basal diets (Control) or basal diets supplemented with 1% L-citrulline (L-Cit). At 28 d old, broilers were subjected to two environmental temperatures, 35 °C for 8 h/d (HS) or 24 °C for 24 h/d (TNZ) for 2 weeks. The experiment was designed as a 2 by 2 factorial arrangement. Results showed that HS increased the core body temperature (CBT) and rectal temperature of broilers compared to the TNZ condition. The CBT and mean CBT decreased by ∼0.5oC in TNZ + L-Cit broilers compared to the TNZ + Control group (P < 0.05). L-Cit supplementation at TNZ significantly (P < 0.05) lowered the plasma malondialdehyde content but this was increased during HS. Exposure to HS significantly (P < 0.05) elevated plasma malondialdehyde compared to TNZ condition. Plasma immunoglobulin A, G, and M were increased (P < 0.05) by TNZ + L-Cit compared to the TNZ + Control group. Plasma nitric oxide and endothelial nitric oxide synthase (NOS) activity was increased during HS, whereas the total and inducible NOS enzymes were decreased. In addition, L-Cit supplementation increased both the inducible and endothelial NOS isoforms (P < 0.05). The mRNA expression of peroxisome proliferator-activated receptor γ coactivator 1-α, avian uncoupling protein, cytochrome C oxidase subunit 3, and ATP synthase F1 subunit beta (ATP5β) in the breast muscle were downregulated (P < 0.05) during HS. However, L-Cit supplementation upregulated the mitochondrial transcription factor A and during HS, L-Cit increased ATP5β expression similar to TNZ housed broilers. Therefore, this study demonstrates that dietary L-Cit can lower the body temperature, decrease lipid peroxidation and promote the immune status of broilers under thermoneutrality. Also, L-Cit would act to promote muscle ATP generation during heat stress in broilers.

Mutational Analysis of Mycobacterial F-ATP Synthase Subunit δ Leads to a Potent δ Enzyme Inhibitor.

While many bacteria are able to bypass the requirement for oxidative phosphorylation when grown on carbohydrates, Mycobacterium tuberculosis is unable to do so. Differences of amino acid composition and structural features of the mycobacterial F-ATP synthase (α3:β3:γ:δ:ε:a:b:b':c9) compared to its prokaryotic or human counterparts were recently elucidated and paved avenues for the discovery of molecules interfering with various regulative mechanisms of this essential energy converter. In this context, the mycobacterial peripheral stalk subunit δ came into focus, which displays a unique N-terminal 111-amino acid extension. Here, mutants of recombinant mycobacterial subunit δ were characterized, revealing significant reduction in ATP synthesis and demonstrating essentiality of this subunit for effective catalysis. These results provided the basis for the generation of a four-feature model forming a δ receptor-based pharmacophore and to identify a potent subunit δ inhibitor DeMF1 via in silico screening. The successful targeting of the δ subunit demonstrates the potential to advance δ's flexible coupling as a new area for the development of F-ATP synthase inhibitors.

A Markov model for rotary catalysis of F1-ATPase

Understanding how F1Fo-ATP synthase (F-ATP synthase) synthesizes ATP from ADP and phosphate is essential for understanding how life on the earth converts and utilizes energy. Studies on isolated F1-ATPase, the soluble sector of F-ATP synthase, which catalyzes ATP hydrolysis in aqueous solution, provide promising insights about the mechanism of F-ATP synthase. A paradigm named rotary catalysis, or binding-change mechanism, has been established to explain ATP hydrolysis mechanism of F1-ATPase, where rotation of the γ-subunit, conformational transition of the β-subunits and nucleotide exchange at catalytic sites are delicately coordinated to maintain a high chemo-mechanical coupling efficiency.

First Report of Late Blight Caused by Phytophthora infestans in Potato in Tibet, China.

Late blight caused by Phytophthora infestans (Mont.) De Bary is the most destructive diseases in the potato field. Although it has been studied worldwide, it has not been reported in Tibet Autonomous Region of China, lying on the world's highest plateau. To investigate whether the disease caused by P. infestans occurred in such region, a survey on potato disease was conducted in the summer in 2020. In August, potato (Solanum tuberosum) of the cultivar 'Longshu 10' with diseased leaves was observed in a potato field in Shigatse city in Tibet Autonomous Region (29.3N,88.8E). The necrotic brown lesions were shaped in round or irregularly with whitish growth of sporangium-producing structures on the underleaf surface, similar to typical late blight symptom. Affected leaves were collected for pathogen isolation. The abaxial side of the decayed leaves showed grey zones of sporulation. Upon isolation, three isolates were used for further investigation. The mycelium grew averagely at a linear rate of 4.35 mm per day at 19oC on Rye B agar (RBA, containing 50 g/L rye and 12 g/L agar), forming white colony. The opaque and lemon-shaped spores with a papilla at the distal end (Figure S1) had an average size of 36.2ⅹ20.3 µm, the shape and size consistent with P. infestans (Cardenas et al. 2011; Winton et al. 2007). The ribosomal ITS1-5.8S-ITS2 region was amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4 (Glass and Donaldson 1995). The sequences with 829 bp in size obtained from three isolates were identical, among which one of the sequences from Tibet isolate RKZ_27 was submitted to GenBank with Accession No. of MW559423. A BLAST search in NCBI (National Center for Biothchnology Information) revealed MW559423 had the highest similarity (100%) to P. infestans sequences (GenBank Accession No. of MK507866, MH401206 and KU992300). In addition, a partial nucleus DNA sequence from elongation factor 1-α (EF1-α) was amplified using primer set of EF_F/ EF_R (EF_F: 5'GGCCTTGACGACATCCAGAA3'; EF_R: 5'TAGCAGCTCAACCCGAAGTG3'), and a partial mitochondria DNA sequence (P2 region) including partial ATP synthase F1 subunit α gene (atp1), tRNA-Glu gene and partial NADH dehydrogenase subunit 4 (ND4) was amplified using primer set of P2F/P2R (P2F: 5'TTCCCTTTGTCCTCTACCGAT3'; P2R: 5'TTACGGCGGTTTAGCACATACA3') (Vargas et al. 2009). The EF1-α and P2 region for three isolates were all identical and one of each sequence was submitted to GenBank with Accession No. of MZ189257 and MZ399710, respectively, which had 99.78% (XM_002998924.1) and 100% (MG869098) similarity with P. infestans, respectively. Phylogenetic analyses showed that the RKZ_27 was close to P. infestans (Figure S2). Pathogenicity was confirmed by inoculating ten potato leaves cv. 'Favorita' for each isolate with a 5 mm in diameter mycelium plug on each leaf. After 3 days of incubation at 19 oC in air-tight plastic bags, the inoculated leaves developed typical symptoms of late blight. All control leaves treated with distilled water remained healthy. The pathogenicity of three isolates were also confirmed by inoculating potato seedlings cv. 'Favorita' with sporangia suspension. The pathogen re-isolation on inoculated symptomatic leaves and seedlings were confirmed to be P. infestans by the morphological characteristics, which was fulfilled Koch postulates. The pathogenicity test both on leaves and seedlings were conducted twice. To our knowledge, this is the first report of P. infestans in potato field in Tibet Autonomous Region of China. The finding of potato late blight in this region have important epidemiological implications for the growers especially under favorable environmental conditions.

Binding properties of the anti-TB drugs bedaquiline and TBAJ-876 to a mycobacterial F-ATP synthase.

Tuberculosis (TB), the deadly disease caused by Mycobacterium tuberculosis (Mtb), kills more people worldwide than any other bacterial infectious disease. There has been a recent resurgence of TB drug discovery activities, resulting in the identification of a number of novel enzyme inhibitors. Many of these inhibitors target the electron transport chain complexes and the F1FO-ATP synthase; these enzymes represent new target spaces for drug discovery, since the generation of ATP is essential for the bacterial pathogen's physiology, persistence, and pathogenicity. The anti-TB drug bedaquiline (BDQ) targets the Mtb F-ATP synthase and is used as salvage therapy against this disease. Medicinal chemistry efforts to improve the physio-chemical properties of BDQ resulted in the discovery of 3,5-dialkoxypyridine (DARQ) analogs to which TBAJ-876 belongs. TBAJ-876, a clinical development candidate, shows attractive in vitro and in vivo antitubercular activity. Both BDQ and TBAJ-876 inhibit the mycobacterial F1FO-ATP synthase by stopping rotation of the c-ring turbine within the FO domain, thereby preventing proton translocation and ATP synthesis to occur. While structural data for the BDQ bound state are available, no structural information about TBAJ-876 binding have been described. In this study, we show how TBAJ-876 binds to the FO domain of the M. smegmatis F1FO-ATP synthase. We further calculate the binding free energy of both drugs bound to their target and predict an increased affinity of TBAJ-876 for the FO domain. This approach will be useful in future efforts to design new and highly potent DARQ analogs targeting F-ATP synthases of Mtb, nontuberculosis mycobacteria (NTM) as well as the M. leprosis complex.

Single-molecule FRET combined with electrokinetic trapping reveals real-time enzyme kinetics of individual F-ATP synthases.

Single-molecule Förster resonance energy transfer (smFRET) is a key technique to observe conformational changes in molecular motors and to access the details of single-molecule static and dynamic disorder during catalytic processes. However, studying freely diffusing molecules in solution is limited to a few tens of milliseconds, while surface attachment often bears the risk to restrict their natural motion. In this paper we combine smFRET and electrokinetic trapping (ABEL trap) to non-invasively hold single FOF1-ATP synthases for up to 3 s within the detection volume, thereby extending the observation time by a factor of 10 as compared to Brownian diffusion without surface attachment. In addition, we are able to monitor complete reaction cycles and to selectively trap active molecules based on their smFRET signal, thus speeding up the data acquisition process. We demonstrate the capability of our method to study the dynamics of single molecules by recording the ATP-hydrolysis driven rotation of individual FOF1-ATP synthase molecules over numerous reaction cycles and extract their kinetic rates. We argue that our method is not limited to motor proteins. Instead, it can be applied to monitor conformational changes with millisecond time resolution for a wide range of enzymes, thereby making it a versatile tool for studying protein dynamics.

Targeting Mycobacterial F-ATP Synthase C-Terminal α Subunit Interaction Motif on Rotary Subunit γ.

Mycobacteria regulate their energy (ATP) levels to sustain their survival even in stringent living conditions. Recent studies have shown that mycobacteria not only slow down their respiratory rate but also block ATP hydrolysis of the F-ATP synthase (α3:β3:γ:δ:ε:a:b:b’:c9) to maintain ATP homeostasis in situations not amenable for growth. The mycobacteria-specific α C-terminus (α533-545) has unraveled to be the major regulative of latent ATP hydrolysis. Its deletion stimulates ATPase activity while reducing ATP synthesis. In one of the six rotational states of F-ATP synthase, α533-545 has been visualized to dock deep into subunit γ, thereby blocking rotation of γ within the engine. The functional role(s) of this C-terminus in the other rotational states are not clarified yet and are being still pursued in structural studies. Based on the interaction pattern of the docked α533-545 region with subunit γ, we attempted to study the druggability of the α533-545 motif. In this direction, our computational work has led to the development of an eight-featured α533-545 peptide pharmacophore, followed by database screening, molecular docking, and pose selection, resulting in eleven hit molecules. ATP synthesis inhibition assays using recombinant ATP synthase as well as mycobacterial inverted membrane vesicles show that one of the hits, AlMF1, inhibited the mycobacterial F-ATP synthase in a micromolar range. The successful targeting of the α533-545-γ interaction motif demonstrates the potential to develop inhibitors targeting the α site to interrupt rotary coupling with ATP synthesis.

Abstract 14460: Mitochondrial Dysfunction is Involved in Diabetic Cardiomyopathy

Introduction: Diabetes is a strong risk factor not only for cardiovascular disease (CVD) but also for the development of chronic kidney disease (CKD) and represents a large and threatening public health challenge. We previously reported the deficiency of heat shock proteins and translocase of inner mitochondrial membrane (TIM) proteins are involved in the pathogenesis of hypertensive and uremic cardiomyopathy. Hypothesis: In this study, we further study the mechanism of mitochondrial dysfunction in the development of CVD and diabetic cardiomyopathy in CKD. Methods: Commercially available primary human atrial and ventricular cardiac myofibroblast and primary human aortic endothelial cells from 3 different age-matched sources were used in our type 2 diabetic cell model, in vitro. Immunohistochemistry, western blotting, Next-Generation RNA Sequencing, and real-time polymerase chain reaction (qPCR) were used in our proposed study. Results: Our data show that ATP5F1E (ATP Synthase F1 Subunit Epsilon), and cAMP regulator, Phosphodiesterase 8B are significantly (P&lt;0.01) preserved in the normal cardiac myofibroblast and aortic endothelial cell. In addition, gene expression of the key ATP synthesis: OPA1, MFN1, TIM, and inflammation marker: MSR1, WNT5 were also significantly (p&lt;0.05) increased in the non-diabetic cardiac myofibroblast and aortic endothelial cell. We next showed that key PPAR pathway regulators, Perilipin 1 (PLIN1) and PPARγ were significantly (p&lt;0.05) increased in our in vitro diabetic cell model. Furthermore, PPARγ inhibitor, FABP4 (fatty acid binding protein-4) which functions as an atherosclerosis promoter was significantly up-regulated in (p&lt;0.05) the non-diabetic cardiac myofibroblast and aortic endothelial cell. Conclusions: Mitochondrial ATP production is the main energy source for intracellular metabolic pathways and our study shows that mitochondrial dysfunction and down-regulation of ATP production may inhibit the hydrolysis of the second messenger cAMP that promotes the development of CVD and diabetic cardiomyopathy in CKD.

The mitochondrial permeability transition: Recent progress and open questions.

Major progress has been made in defining the basis of the mitochondrial permeability transition, a Ca2+ -dependent permeability increase of the inner membrane that has puzzled mitochondrial research for almost 70 years. Initially considered an artefact of limited biological interest by most, over the years the permeability transition has raised to the status of regulator of mitochondrial ion homeostasis and of druggable effector mechanism of cell death. The permeability transition is mediated by opening of channel(s) modulated by matrix cyclophilin D, the permeability transition pore(s) (PTP). The field has received new impulse (a) from the hypothesis that the PTP may originate from a Ca2+ -dependent conformational change of F-ATP synthase and (b) from the reevaluation of the long-standing hypothesis that it originates from the adenine nucleotide translocator (ANT). Here, we provide a synthetic account of the structure of ANT and F-ATP synthase to discuss potential and controversial mechanisms through which they may form high-conductance channels; and review some intriguing findings from the wealth of early studies of PTP modulation that still await an explanation. We hope that this review will stimulate new experiments addressing the many outstanding problems, and thus contribute to the eventual solution of the puzzle of the permeability transition.