Expression Of CC Chemokines Research Articles

Expression of inducible CC chemokines in rainbow trout ( Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8

In rainbow trout ( Oncorhynchus mykiss), at least three CXC chemokines and eighteen CC chemokine sequences have been discovered in the past years, although no studies concerning their bioactivity have been performed yet. We have studied the expression of five different CC chemokines that cluster into the group of inducible chemokines (CK5A, CK5B, CK6, CK7A and CK7B) in trout injected with a plasmid coding for the glycoprotein G gene (pMCV1.4-G) of viral haemorrhagic septicemia virus (VHSV). In a previous work, we had demonstrated that a plasmid coding for the CXC chemokine interleukin 8 (IL-8, pIL8+) when co-administered with pMCV1.4-G was able to modulate the expression of induced pro-inflammatory cytokines, therefore, we have also studied the expression of these inducible CC chemokines in fish injected with pMCV1.4-G in the presence of pIL8+, study that will also help establish the relations among the different chemokine groups. All chemokines were induced in the head kidney of fish injected with the DNA vaccine, and the co-administration of pIL8+ together with the vaccine modulated the expression of all CC chemokines studied. In this sense, expression of the inducible CC chemokines was also studied in trout head kidney leucocytes treated with supernatants from EPC cells transfected with pIL8+. In this case, all CC chemokines studied except for CK5B were significantly induced by rainbow trout IL-8.

The Effect of H1 Antagonists Carebastine and Olopatadine on Histamine Induced Expression of CC Chemokines in Cultured Human Nasal Epithelial Cells

CC chemokines have been shown to play an important role in inducing selective recruitment of inflammatory cells into local allergic inflammatory sites. CC chemokines are also known as histamine releasing factors. We previously showed that histamine enhances transcription of CC chemokines from nasal mucosa which leads to further induction of histamine release. This cyclic cascade may cause prolonged allergic inflammation. The aim of this study is to clarify the relationship between histamine and CC chemokine production by using human nasal epithelial cells (HNECs) and to examine the potential of H1 receptor (H1R) antagonists in new therapeutic approaches for the treatment of nasal allergy. HNECs were isolated from the nasal turbinates of patients diagnosed with nasal allergy. HNEC monolayers were cultured for 48 hours with or without histamine (10(-3) to 10(-5) mol/L). Furthermore, an H1R antagonist, either carebastine or olopatadine, was added to the supernatant (10(-3) to 10(-7) mol/L) 30 minutes before incubation with histamine. The expression of Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and monocyte chemotactic protein-1 (MCP-1) in the culture media were measured by ELISA. The release of RANTES and MCP-1 was significantly upregulated by histamine compared with the control group. Both carebastine and olopatadine inhibited the release of CC chemokine production to the control level in both groups. This study suggests that the interaction between histamine and CC chemokines may prolong allergic inflammation in human nasal mucosa. We also demonstrate the potential use of H1R antagonists in new therapeutic approaches to the treatment of nasal allergy through inhibiting this histamine-CC chemokine interaction.

Cytomegalovirus Accelerates Chronic Allograft Nephropathy in a Rat Renal Transplant Model With Associated Provocative Chemokine Profiles

Background Studies have shown that rat cytomegalovirus (RCMV) infection accelerates transplant vascular sclerosis (TVS) in rat heart and small bowel allotransplants. In these models, RCMV-accelerated TVS results from increased graft infiltration of inflammatory cells through up-regulation of chemokine expression. The aim of this study was to determine if RCMV infection accelerates renal transplant chronic allograft nephropathy (CAN), and the role of chemokines in this process. Methods F344 kidneys were transplanted into Lewis recipients with and without RCMV infection. To monitor CAN, serum creatinine (Cr) levels were measured starting at 4 weeks posttransplantation. At 7 and 21 days, and at terminal rejection, grafts were examined for histologic changes, inflammatory cell infiltrates, viral load, and chemokine expression profiles. Results By week 8, serum Cr showed significant elevation ( P < .01) in the RCMV-infected group vs uninfected group, and remained significantly elevated through the end of the study. RCMV+ renal allografts had significant inflammatory cell infiltration and increased CAN at postoperative day (POD) 28. The CC chemokines RANTES, MCP-1, and MIP-1α, and the CXC chemokine IP-10 were up-regulated in RCMV-infected vs uninfected allografts. IP-10 was significantly up-regulated early in the process, whereas RANTES and MCP-1 were induced at a later time. Conclusions RCMV infection accelerates CAN, with associated graft inflammatory infiltrates, which is paralleled by an increase in expression of CC and CXC chemokines. Our findings suggest that the early induction of IP-10 in the infected allografts promotes alterations in T-cell and monocyte migration to the graft, which initiates accelerated inflammatory and fibrotic changes associated with CAN.

Apolipoprotein E deficiency increased microglial activation/CCR3 expression and hippocampal damage in kainic acid exposed mice

Apolipoprotein E (apoE) down-regulates microglial activation and the secretion of inflammatory molecules in an isoform specific fashion (E2 > E3 > E4); the E4 isoform is over-represented in Alzheimer cases while E2 is under-represented. To better define the role of apoE in neurodegeneration, we contrasted apoE knockout ( n = 38) and wild-type mice ( n = 41) with respect to seizure activity, mortality, locomotion, hippocampal microglial activation/chemokine receptor expression, and damage to the hippocampus after nasal administration of kainic acid (KA) (water as controls). Mice lacking apoE demonstrated more hunching and less rearing, more damage to neurons in the CA3 region (mean histopathologic score: 3.7 vs. 1.6, p < 0.05), greater microglial activation confirmed by high levels of CD11b and CD86 expression in hippocampus (CD11b p < 0.01, CD86 p < 0.05), and a greater percentage of activated microglia expressing CC chemokine receptors 3 (CCR3) ( p < 0.05). Taken together, these findings imply that apoE modulates hippocampal damage induced by KA and found early in the sequence of human Alzheimer's brain changes, by modulating microglial activation.

CCR5 antagonists: the answer to inflammatory disease?

Chemokines and their receptors mediate the inflammatory response during infectious and non-infectious disease. However, their continued activation and disregulation are commonly associated with chronic inflammation. Frequently, affected sites are characterised by inflammatory cell infiltrates expressing CC chemokine receptor 5 (CCR5) and high levels of CCR5 ligands. Neutralisation of CCR5 decreases the incidence and pathology of these diseases in murine models, and epidemiological studies in human patients corroborate these data. CCR5-deficiency has been associated with increased risk of hepatic disease and infection, but considering the pathological effects of chronic inflammation, pharmacologically targeting CCR5 is still a desirable and feasible goal. The discovery that CCR5 is a major HIV coreceptor initiated the race to produce effective CCR5 antagonists. This review summarises the progress made in CCR5 antagonist development and assesses their potential in the treatment of inflammatory disease.

TNF family molecule LIGHT regulates chemokine CCL27 expression on mouse embryonic stem cell-derived dendritic cells through NF-κB activation

Cytokine LIGHT is a type II transmembrane protein belonging to the TNF family that was originally identified as a weak inducer of apoptosis. It plays a role in inducing maturation of dendritic cells, such as upregulating CD80, CD86 expression on dendritic cells. However, whether LIGHT induces CC chemokine expression in DC and promotes their migration remains unknown. In this study, we found that esDC express CCR7 and CCR10 (the receptor of CCL27) upon the LIGHT stimulation. LIGHT also upregulates CCL27, but not CCL19 and CCL21 expression in esDC. The esDC migration potential has been increased in LIGHT activated DCs compared with control cells. LIGHT activated DCs autocrine CCL27 which regulate their migration as Blockage of CCL27 on esDC using neutralizing antibody reduces migration potential. In signaling study, we identified that LIGHT activated NF-κB in esDC and inhibition of NF-κB activation by specific inhibitor can partly attenuate the effect of LIGHT in regulation of CCL27 expression. Moreover, Shp-2 is required in LIGHT activated NF-κB because Knockdown of Shp-2 affects the NF-κB activation induced by LIGHT and consequently influences LIGHT mediated CCL27 expression. TRAF6 is critical in DC maturation in recent reports; however, knockdown of TRAF6 expression using siRNA did not alter CCL27 expression in LIGHT matured DCs. Our study demonstrates that LIGHT stimulation enhances CCL27 expression through activation of NF-κB in DCs.

Aberrant Expression of CC and CXC Chemokines and Their Receptors in Patients with Asthma

This study further elucidates the roles of selected chemokines (IP-10, MIG, and RANTES) and their receptors (CCR3, CCR5, and CXCR3) in asthma. We compared their profiles in six groups of participants-atopic cohort and nonatopic cohort (each including controls and asthmatic patients with or without steroid therapy). Plasma concentration of IP-10 was significantly lower while that of RANTES and the expression of CCR3 were higher in asthmatic patients (all p < 0.05). Plasma RANTES correlated positively with the GINA severity score in all asthmatic patients (r=0.27, p < 0.05), and with IL-13 in nonatopic asthmatic patients (r=0.46, p < 0.05). In asthmatic patients, the ex vivo release of IP-10 and MIG was attenuated in PBMC activated with allergen, mitogens and IL-18 (p < 0.05). In conclusion, plasma RANTES may be a surrogate marker for asthma and the diminished Th1 related CXC chemokine production may contribute to Th2 predominance in asthma.

3. Cytokines and chemokines

Cytokines and chemokines are secreted proteins with growth, differentiation, and activation functions that regulate the nature of immune responses. Cytokines are involved in nearly every facet of immunity and inflammation, from induction of the innate immune response to the generation of cytotoxic T cells and the development of antibodies by the humoral immune system. The combination of cytokines that are produced in response to an immune insult determines which arm of the immune system will be activated. For this update, recent advances in our understanding of cytokines will be discussed, which includes the IL-10, IL-17, and IL-27 families.

Involvement of MAPK activation in chemokine or COX-2 productions by Toxoplasma gondii

This experiment focused on MAPK activation in host cell invasion and replication of T. gondii, as well as the expression of CC chemokines, MCP-1 and MIP-1 alpha , and enzyme, COX-2/prostaglandin E2 (PGE2) in infected cells via western blot, [3H]-uracil incorporation assay, ELISA and RT-PCR. The phosphorylation of ERK1/2 and p38 in infected HeLa cells was detected at 1 hr and/or 6 hr postinfection (PI). Tachyzoite proliferation was reduced by p38 or JNK MAPK inhibitors. MCP-1 secretion was enhanced in infected peritoneal macrophages at 6 hr PI. MIP-1 alpha mRNA was increased in macrophages at 18 hr PI. MCP-1 and MIP-1 alpha were reduced after treatment with inhibitors of ERK1/2 and JNK MAPKs. COX-2 mRNA gradually increased in infected RAW 264.7 cells and the secretion of COX-2 peaked at 6 hr PI. The inhibitor of JNK suppressed COX-2 expression. PGE2 from infected RAW 264.7 cells was increased and synthesis was suppressed by PD98059, SB203580, and SP600125. In this study, the activation of p38, JNK and/or ERK1/2 MAPKs occurred during the invasion and proliferation of T. gondii tachyzoites in HeLa cells. Also, increased secretion and expression of MCP-1, MIP-1 alpha , COX-2 and PGE2 were detected in infected macrophages, and appeared to occur via MAPK signaling pathways.

Interleukin-15 enhances the secretion of IFN-γ and CC chemokines by natural killer cells from HIV viremic and aviremic patients

Several lines of evidence documented a renewed interest in the role of natural killer (NK) cells in the innate immune control of HIV infection and disease progression. To further assess the role of NK cells as target for immunotherapy in HIV infection, we evaluated the priming effect of interleukin (IL)-15 on freshly isolated human peripheral NK cells, from viremic and aviremic HIV-infected patients, measuring the production of IFN-γ and CC chemokines. In vitro IL-15 priming induced a significant increase of IFN-γ production in both viremic and aviremic patients. IL-15 stimulated NK cells producing CC chemokine quantities that are reported to be capable of inhibiting HIV infection and replication. This priming effect is observed both in viral suppressed patients after antiretroviral therapy, and in viremic subjects with progressive HIV infection. The combination of IL-15 plus IL-12 is the most potent costimulus for CD69 expression and production of CC chemokines by NK cells. These findings indicate that NK cells are an important target for immunotherapeutic agents and provide additional pre-clinical data supporting the great potential of IL-15 in the immune-based interventions in HIV disease.

Alcohol suppresses IL-2-induced CC chemokine production by natural killer cells.

Natural killer (NK) cells are a critical component of the host innate immune system. We investigated whether alcohol impairs NK cell function, particularly production of CC chemokines induced by interleukin (IL)-2, the natural ligands for CCR5 receptor. Primary NK cells and NK cell line (YTS) were cultured with or without alcohol (10 to 80 mM) for three hours. The culture supernatants were then harvested and used to treat human peripheral blood monocyte-derived macrophages and a HeLa cell line, which expresses CD4, CCR5, and CXCR4 receptors (MAGI cells). CC chemokine expression by YTS and primary NK cells treated with or without alcohol was analyzed with the real-time RT-PCR and ELISA. [Ca(2)(+)]i and Western blot assays were used to determine calcium-mediated intracellular signaling pathway and NF-kappaB p65 expression. HIV strains (Bal and UG024) were used to infect macrophages and MAGI cells. In addition, ADA (macrophage-tropic strain) and murine leukemia virus (MLV) envelope-pseudotyped HIV infection was carried out in macrophages. HIV infectivity was determined by HIV reverse transcriptase (RT) and beta-galactosidase activity assays. Alcohol inhibited IL-2-induced CC chemokine (CCL3 and CCL4) expression by NK cells. Functional tests demonstrated that this reduced expression of CC chemokines was associated with diminished anti-HIV ability of NK cells. Alcohol also reduced the ability of NK cells to response to CCL3-mediated chemotaxis. Alcohol inhibited IL-2-induced NF-kappaB p65 protein expression and calcium mobilization by NK cells. Alcohol, through the inhibition of IL-2-induced NF-kappaB p65 protein expression and intracellular calcium mobilization, suppressed NK cell production of CC chemokines. This suppression of CC chemokine production was associated with diminished anti-HIV activity of NK cells. Thus, by inhibiting NK cell-mediated innate immunity against HIV, alcohol consumption may have a cofactor role in the immunopathogenesis of HIV disease.

Toward a Novel Experimental Model of Infection To Study American Cutaneous Leishmaniasis Caused byLeishmania braziliensis

Leishmania spp. cause a broad spectrum of diseases collectively known as leishmaniasis. Leishmania braziliensis is the main etiological agent of American cutaneous leishmaniasis (ACL) and mucocutaneous leishmaniasis. In the present study, we have developed an experimental model of infection that closely resembles ACL caused by L. braziliensis. In order to do so, BALB/c mice were infected in the ear dermis with 10(5) parasites and distinct aspects of the infection were evaluated. Following inoculation, parasite expansion in the ear dermis was accompanied by the development of an ulcerated dermal lesion which healed spontaneously, as seen by the presence of a scar. Histological analysis of infected ears showed the presence of a mixed inflammatory infiltrate consisting of both mononuclear and polymorphonuclear cells. In draining lymph nodes, parasite replication was detected throughout the infection. In vitro restimulation of draining lymph node cells followed by intracellular staining showed an up-regulation in the production of gamma interferon (IFN-gamma) and in the frequency of IFN-gamma-secreting CD4(+) and CD8(+) T cells. Reverse transcription-PCR of ears and draining lymph node cells showed the expression of CC chemokines. The dermal model of infection with L. braziliensis herein is able to reproduce aspects of the natural infection, such as the presence of an ulcerated lesion, parasite dissemination to lymphoid areas, and the development of a Th1-type immune response. These results indicate that this model shall be useful to address questions related to the concomitant immunity to reinfection and parasite persistence leading to mucocutaneous leishmaniasis.

New regulatory mechanisms for human extravillous trophoblast invasion.

Human extravillous trophoblasts (EVT) invade maternal deciduas and reconstructed maternal spiral arteries during early placentation. However, the precise regulatory mechanisms to induce EVT invasion toward arteries and/or to protect EVT from further invasion have not been well understood. Recently, it was found that EVT that had already ceased their invasion, specifically expressed cluster of differentiation (CD9) and dipeptidyl peptidaseIV (DPPIV) on their cell surface. In addition, EVT migrating to maternal spiral arteries expressed CC chemokine receptor type-1 (CCR-1), which is a chemokine receptor for regulated on activation normal T cell expressed and secreted (RANTES) and so on. CD9 is associated with integrin molecules on the cell surface and is considered to modulate integrin function. In contrast, DPPIV is a cell surface peptidase that can metabolize RANTES at extracellular sites before its accessing to the chemokine receptors. In vitro functional assay showed that CD9, DPPIV and RANTES are involved in the regulation for EVT invasion. From these findings, it can be proposed that CD9 and DPPIV, including chemokines, are new regulatory factors for human extravillous trophoblasts. (Reprod Med Biol 2005; 4: 189-195).

Central Nervous System Injury Triggers Hepatic CC and CXC Chemokine Expression that Is Associated with Leukocyte Mobilization and Recruitment to Both the Central Nervous System and the Liver

The administration of interleukin-1beta to the brain induces hepatic CXC chemokine synthesis, which increases neutrophil levels in the blood, liver, and brain. We now show that such hepatic response is not restricted to the CXC chemokines. CCL-2, a CC chemokine, was released by the liver in response to a tumor necrosis factor (TNF)-alpha challenge to the brain and boosted monocyte levels. Furthermore, a clinically relevant compression injury to the spinal cord triggered hepatic chemokine expression of both types. After a spinal cord injury, elevated CCL-2 and CXCL-1 mRNA and protein were observed in the liver by TaqMan reverse transcriptase-polymerase chain reaction and enzyme-linked immunosorbent assay as early as 2 to 4 hours. Simultaneously, we observed elevated levels of these chemokines and circulating leukocyte populations in the blood. Leukocytes were recruited to the liver at this early stage, whereas at the site of challenge in the central nervous system, few were observed until 24 hours. Artificial elevation of blood CCL-2 triggered dose-dependent monocyte mobilization in the blood and enhanced monocyte recruitment to the brain after TNF-alpha challenge. Attenuation of hepatic CCL-2 production with corticosteroids resulted in reduced monocyte levels after the TNF-alpha challenge. Thus, combined production of CC and CXC hepatic chemokines appears to amplify the central nervous system response to injury.

IFN and IL-4 regulate the expression of CC-chemokines (RANTES, MCP-4, TARC) by TLR ligands stimulated nasal fibroblasts

IFN and IL-4 regulate the expression of CC-chemokines (RANTES, MCP-4, TARC) by TLR ligands stimulated nasal fibroblasts

Differential expression of CCR3 and CXCR3 by human lung and bone marrow-derived mast cells: implications for tissue mast cell migration

The selective microlocalization of mast cells within specific airway structures, such as the airway smooth muscle and submucosal glands, in asthma is important in the pathophysiology of inflammatory lung disease. Chemokines are likely candidates mediating mast cell migration into these tissue compartments. In this study, we have defined the chemokine receptor profile of human lung mast cells (HLMC) compared with mast cells derived from human bone marrow (BM) and the human mast cell line HMC-1. CXC chemokine receptor 3 (CXCR3) was the most highly expressed chemokine receptor on ex vivo HLMC analyzed by flow cytometry, and CXCR3 expression by mast cells in the bronchial mucosa was confirmed by immuno-histochemistry. CXCR3 was functional, inducing a rise in cytosolic-free Ca2+, actin reorganization, and chemotaxis in response to the CXC ligands CXCL9, -10, and -11. CXCR3 activation did not induce degranulation or cytokine synthesis. In addition, more than 10% of ex vivo HLMC expressed CC chemokine receptor 3, CXCR1, and CXCR4. It is interesting that CXCR3 was not expressed by human BM-derived mast cells, suggesting its expression is induced during tissue maturation. As CXCR3 ligands are elevated in many pulmonary diseases, CXCR3 may be important for determining the anatomical microlocalization of mast cells within the human lung.

Oral corticosteroids decrease eosinophil and CC chemokine expression but increase neutrophil, IL-8, and IFN-γ–inducible protein 10 expression in asthmatic airway mucosa

Cytokines and chemokines have been implicated in the pathogenesis of asthma. Inhaled corticosteroids have been shown to decrease the number of eosinophils and to downregulate T H 2 cytokines but to increase neutrophils. The effect of corticosteroids on chemokine expression in asthma has not yet been investigated. We sought to investigate the effect of a 2-week course of oral corticosteroid (methylprednisolone, 40 mg/d) on the expression of CXC chemokines (IL-8 and IFN-gamma-inducible protein 10 [IP-10]) and CC chemokines (eotaxin and monocyte chemotactic proteins [MCPs] 1-4) in endoscopic biopsy specimens of 13 patients with moderate-to-severe asthma. CD3, major basic protein, and elastase immunoreactivities were monitored before and after treatment by using immunocytochemistry. Eotaxin, IL-8, IP-10, MCP-1, MCP-2, MCP-3, and MCP-4 mRNA expression in epithelium and submucosa were studied by using in situ hybridization. Corticosteroids reduced the number of CD3-positive T cells and major basic protein-positive eosinophils ( P < .05), whereas the number of neutrophils were increased ( P < .05). Corticosteroids also reduced the number of eotaxin ( P < .05), MCP-3, and MCP-4 mRNA-positive cells ( P < .001) in the epithelium and subepithelium. However, corticosteroids caused a significant increase in the epithelial expression of IL-8 ( P < .001), IP-10 ( P < .05), and MCP-2 mRNAs ( P < .01). Corticosteroids had no effects on MCP-1 mRNA expression. Our results demonstrate the dual nature of corticosteroids. Although corticosteroids can downregulate the expression of some asthma-associated chemokines, such as eotaxin, MCP-3, and MCP-4, they can also upregulate the expression of other chemokines, including IL-8, IP-10, and MCP-2. The failure of oral corticosteroids to inhibit IL-8 mRNA expression might contribute to persistent airway neutrophilia observed in patients with moderate-to-severe asthma, despite treatment with corticosteroids.

CCR1 blockade reduces interstitial inflammation and fibrosis in mice with glomerulosclerosis and nephrotic syndrome

CC chemokines mediate leukocyte infiltration into inflamed tissue. We have recently shown that blockade of the CC chemokine receptor CCR1 reduces interstitial inflammation and fibrosis in murine obstructive nephropathy. However, it is not known whether CCR 1 blockade is protective in progressive renal injury associated with severe proteinuria. We therefore studied the effect of the small-molecule CCR1 antagonist BX471 in a murine model of adriamycin-induced focal segmental glomerulosclerosis (FSGS) with nephrotic syndrome and progressive interstitial inflammation and fibrosis. Adriamycin nephropathy with persistent proteinuria was induced in male BALB/c mice by two intravenous injections of adriamycin (13 mg/kg) at day 0 and 14. BX471 treatment was started at day 14 when proteinuria and interstitial inflammation had developed. At 6 weeks, renal histology was studied by morphometry and immunohistochemistry. At week 6, adriamycin-treated mice showed FSGS, associated with tubulointerstitial injury consisting of tubular dilation and atrophy, interstitial leukocyte infiltration, and fibrosis. The mRNA expression of CCR1 and CC chemokines, including the CCR1 ligands CCL3 (MIP-1alpha) and CCL5 (RANTES), was up-regulated in diseased kidneys, with a prominent interstitial expression of CCL5. Compared to vehicle-treated controls BX471 significantly reduced the amount of macrophages and T lymphocytes in interstitial lesions by 51% and 22%, respectively. Markers of renal fibrosis such as interstitial fibroblasts (48%) and interstitial volume (23%) were significantly reduced by BX471 treatment. In contrast, the extent of proteinuria and glomerular sclerosis was not affected by BX471 treatment. Blockade of CCR1 substantially reduced interstitial leukocyte accumulation and the subsequent renal fibrosis in a murine model of nephrotic syndrome and FSGS. These findings support a role for CCR1 in interstitial leukocyte recruitment and suggest that CCR1 blockade might be a new therapeutic strategy in progressive nephropathies such as FSGS.

Expression of immune-related genes in the common carp ( Cyprinus carpio L.) after stimulation by CpG oligodeoxynucleotides

In mammals, CpG motif can stimulate B cells, NK cells, T cells and macrophages to secrete cytokines. Using head kidney macrophages of common carp ( Cyprinus carpio) as an in vivo model, we investigated the effects of synthetic oligodeoxynucleotides containing CpG on fish macrophages and analysed the expression of a number of immune-related genes. Genes analysed included cytokines and lysozyme. Both CpG-ODN B (GCTAGACGTTAACGTT) and ODN C (ATCGACTCTCGAACGTTCTC) could activate macrophages, increasing the level of production of superoxide anion and phagocytic activity. CpG-ODNs also augmented expression of interleukin-1β, CXC and CC-chemokines at 1, 5 and 7 days post-treatment. CpG-ODN C increased the lysozyme-C gene expression at 7 days post-injection.

Production of a monoclonal antibody to canine thymus and activation-regulated chemokine (TARC) and detection of TARC in lesional skin from dogs with atopic dermatitis

A monoclonal antibody to canine thymus and activation-regulated chemokine (TARC/CCL17) was developed to examine the association of TARC with the immunopathogenesis of canine atopic dermatitis (AD). Recombinant canine TARC was prepared using an E. coli expression system. Results of transwell chemotaxis assay demonstrated that the recombinant canine TARC showed chemotactic activity for canine lymphoid cells expressing CC chemokine receptor 4 (CCR4). Mice were then immunized with the recombinant canine TARC to obtain monoclonal antibodies. Among the monoclonal antibodies thereby obtained, one monoclonal antibody (CTA-1) was found to react with both recombinant and authentic canine TARC in ELISA and flowcytometric assays, respectively. Immunohistochemical analysis using the monoclonal antibody CTA-1 demonstrated that keratinocytes were major TARC producing cells in lesional skin of dogs with AD.