Abstract
In mammals, CpG motif can stimulate B cells, NK cells, T cells and macrophages to secrete cytokines. Using head kidney macrophages of common carp ( Cyprinus carpio) as an in vivo model, we investigated the effects of synthetic oligodeoxynucleotides containing CpG on fish macrophages and analysed the expression of a number of immune-related genes. Genes analysed included cytokines and lysozyme. Both CpG-ODN B (GCTAGACGTTAACGTT) and ODN C (ATCGACTCTCGAACGTTCTC) could activate macrophages, increasing the level of production of superoxide anion and phagocytic activity. CpG-ODNs also augmented expression of interleukin-1β, CXC and CC-chemokines at 1, 5 and 7 days post-treatment. CpG-ODN C increased the lysozyme-C gene expression at 7 days post-injection.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.