Entire Leaf Research Articles

Composition and localization of the leaf waxes in seven epiphytic Tillandsia species

Air plants (Tillandsia) rely on leaves to absorb water and nutrients, and waxy trichomes on the leaf surface play an important role in this process. However, there is no definite information on the waxy components of air plant leaves or whether they are located on the trichomes. In this study, SEM and GC-MS were used to analyze the leaf surface structure and waxy components in seven Tillandsia species. The results showed that the waxy components included hydrocarbons, alcohols, ketones, and esters. Only T. brachycaulos contained low levels of acids. There were significant differences in the levels of leaf waxy components among different species and differences in the levels of specific components. The amount of waxy component in the seven air plant species was ordered as follows: T. ionantha > T. brachycaulos > T. velutina > T. usneoides > T. medusa > T. stricta > T. streptophylla. Correlation analysis revealed that the total waxy component level was significantly positively correlated with the total trichome area. After trichome wing cells were manually removed from T. brachycaulos and T. velutina, the levels of various chemical components significantly decreased. The levels of various chemical components in trichomes accounted for more than 50% of the total corresponding level in the entire leaf. These results indicated that the waxy components in air plant leaves were mainly located on trichomes.

Promoter variations in a homeobox gene, BrLMI1, contribute to leaf lobe formation in Brassica rapa ssp. chinensis Makino.

Key message BrLMI1 is a positive regulatory factor of leaf lobe formation in non-heading Chinese cabbage, and cis-regulatory variations lead to the phenotype of lobed or entire leaf margins.Abstract Leaves are the main consumed organ in leafy non-heading Chinese cabbage (Brassica rapa L. ssp. chinensis Makino), and the shape of the leaves is an important economic trait. However, the molecular regulatory mechanism underlying the lobed-leaf trait in non-heading Chinese cabbage remains unclear. Here, we identified a stable incompletely dominant major locus, qLLA10, for lobed leaf formation in non-heading Chinese cabbage. Based on map-based cloning strategies, BrLMI1, a LATE MERISTEM IDENTITY1 (LMI1)-like gene, was predicted as the candidate gene for qLLA10. Genotyping analysis showed that promoter variations of BrLMI1 in the two parents are responsible for elevating the expression in the lobed-leaf parent and ultimately causing the difference in leaf shape between the two parents, and the promoter activity of BrLMI1 was significantly affected by the promoter variations. BrLMI1 was exclusively localized in the nucleus and expressed mainly at the tip of each lobe. Leaf lobe development was perturbed in BrLMI1-silenced plants produced by virus-induced gene silencing assays, and ectopic overexpression of BrLMI1 in Arabidopsis led to deeply lobed leaves never seen in the wild type, which indicates that BrLMI1 is required for leaf lobe formation in non-heading Chinese cabbage. These findings suggested that BrLMI1 is a positive regulatory factor of leaf lobe formation in non-heading Chinese cabbage and that cis-regulatory variations lead to the phenotype of lobed or entire leaf margins, thus providing a theoretical basis for unraveling the molecular mechanism underlying the lobed leaf phenotype in Brassica crops.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

First Report of Pseudoidium santalacearum Causing Foliar Powdery Mildew on Santalum album in Guangdong Province, China.

Santalum album Linn is an evergreen and facultative root hemiparasitic tree. It is attached to host roots through haustorium to withdraw water and nutrients. Its aromatic heartwood, honored as "Green Gold", is widely used in perfumes, incense, medicine, and skin cancer prevention (Sandeep and Manohara 2019, Polaiah et al. 2020). From February to June 2022, powdery mildew was observed on over 80% of S. album in the nursery with a mean temperature and relative humidity of 30/22°C (day/night) and 55/82% (day/night) at the Research Institute of Tropical Forestry, Chinese Academy of Forestry, Guangdong, China (23°11'N, 113°23'E). Initial symptoms were circular to irregular white colonies on the leaf surface (Fig. 1). As the disease progressed, white mycelia covered the entire leaf surface and premature defoliation of the infected leaf was observed. Then a bare stem remained and subsequently desiccated (Sundararaj et al. 2022). Infected leaves with mycelia were collected and observed under a Zeiss AX10 microscope. Foot cells of conidiophores (n = 30) were straight to slightly curved cylindrical, and the length and width of foot cells were up to 24.8 to 44.6 × 8.2 to 11.7 μm. Conidiophores (n = 30) were straight, 83.5 to 127.3 μm long × 6.6 to 7.6 μm wide and produced three immature conidia in chains. Conidia (n = 30) were elliptical to cylindrical, measured 31.3 to 41.2 μm × 11.3 to 13.7 μm. The sexual stage was not found. The morphological characterization of our samples was consistent with powdery mildew of S. album in India, termed Pseudoidium santalacearum (Patel et al. 2015). However, the molecular identification was not performed. In this study, we carefully collected the mildew and extracted the genomic DNA. The internal transcribed spacer (ITS) region of rDNA was amplified using universal primers ITS1 and ITS4 (White et al. 1990). The ITS sequences of the three samples (GenBank Accession No. OQ746371, OQ746372, and OQ746373) were all more than 99% identical with the sequence of Erysiphe palczewskii on Caragana arborescens (GenBank Accession No. LC010048) (Takamatsu et al. 2015). It is known that Erysiphe containing chasmothecia belongs to teleomorph, whereas Pseudoidium is an asexual morph of Erysiphe, belonging to anamorph (Hsiao et al. 2022, Meeboon and Takamatsu 2016). In our samples, there was no chasmothecia, and the morphological characterization was consistent with P. santalacearum (Patel et al. 2015). Therefore, we classified it as P. santalacearum. Phylogenetic analysis showed that P. santalacearum had a closer relationship with the E. palczewskii (Fig. 2). Pathogenicity tests were conducted by gently pressing the infected leaves onto five healthy S. album plants. Five non-inoculated plants were used as controls. The plants were placed in a growth chamber (Light/Dark: 16 h/8 h, temperature: 25 ± 2°C). Inoculated leaves developed powdery mildew symptoms after 7-12 days, whereas the control plants remained symptomless (Fig. 1). Morphological and molecular characters of the fungus on the inoculated plants were identical to those on naturally infected S. album, fulfilling Koch's postulates. To our knowledge, this is the first report of P. santalacearum on S. album in Guangdong, China. Powdery mildew can generally result in a high mortality of S. album seedlings. Therefore, identification of the pathogen provides a scientific basis for effective diagnosis and prevention of the disease and contribute to an appropriate nursery management of S. album seedlings.

First Report of Colletotrichum siamense Causing Leaf Spot on Jasminum sambac in China.

Jasmine (Jasminum sambac (L.) Aiton) is cultivated as a commercial floricultural crop in many countries around the world (Gao et al., 2020). From June to August 2020, leaf spots on jasmine were observed on a jasmine plantation in Hengzhou of Guangxi province. Over 40% of the plants in 6 ha fields were infected. This disease was prevalent in jasmine production area of China (Chen et al., 2012; Du et al., 2020). Symptoms began as chlorotic regions (from 5 to 10 mm in diameter) with light brown necrotic centers, which gradually expanded to the entire leaf. Eventually, the disease leaded to defoliation and dieback. The edges of the affected parts from diseased leaves were cut into pieces (3 mm2). Pieces were treated with 75% ethanol for 10 s, soaked in 2% NaClO solution for 1 min, washed three times with sterile water, and then incubated on potato dextrose agar (PDA) plates at 28℃ for 5 days in the dark. Fungal cultures that showed similar morphological characteristics were isolated, and three representative isolates (HL6-1 to HL6-3) were purified following Mo et al. (2018). The cultures on PDA changed from white to dark grey after 7 days and produced conidiomata after 14 days. Conidia were hyaline, one-celled, guttulate, cylindrical, of 12.07 to 18.09 × 4.04 to 8.05 μm, 13.17 to 16.35 × 4.22 to 6.13 μm and 10.11 to 22.17 × 3.65 to 8.1 μm for HL6-1, HL6-2 and HL6-3, respectively. Gray-brown or dark brown appressoria formed from conidia were subglobose or elliptical. Conidial appressoria and mycelial appressoria were 5.53 to 13.96 × 3.58 to 13.95 μm and 4.24 to 14.01 × 2.4 to 10.86 μm. Genomic DNA was extracted from three isolates and the partial internal transcribed spacer (ITS) regions, intergenic region of apn2 and MAT1-2-1 (ApMAT), and fragments of actin (ACT), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), chitin synthase (CHS-1), and β-tubulin (TUB2) genes were amplified, sequenced and submitted to GenBank (ITS, ON115173 to ON115175; ApMat, ON156517 to ON156519; ACT, ON146469 to ON146471; GAPDH, ON156502 to ON156504; CHS-1, ON156507 to ON156509; TUB-2, ON156512 to ON156514). Phylogenetic tree was constructed with MrBayes v. 3.2.6 and MEGA v. 10.1.5 based on the concatenation of multiple sequences. Three isolates were grouped with strain C. siamense ICMP 18578. Results indicated three isolates were identified as Colletotrichum siamense Prihastuti, L. Cai & K.D. Hyde. To confirm the pathogenicity of the three isolates, four sets (five plants per set) of 160 healthy leaves of 2-year-old plants (J. sambac, eight leaves per plant) were slightly scratched with a sterilized toothpick at each of eight locations. Conidial suspension (1×106 conidia/mL) in 0.1% Tween 20 were inoculated onto each wounded spot of three sets as the treatment groups, while wounded leaves treated with sterile water as the control. All plants were covered with plastic bags and cultivated in phytotron (12 h/12 h light/dark, 28°C). After 7 days, irregular chlorotic regions with brown lesions were observed on inoculated leaves while no symptoms on controls. The same fungi were reisolated from inoculated leaves and confirmed by morphological and molecular identification, fulfilling Koch's postulates. Colletotrichum siamense has been associated with leaf anthracnose of J. sambac in Vietnam (Wikee et al., 2011) and J. mesnyi in China (Zhang et al., 2019). To our knowledge, this is the first report of C. siamense causing jasmine anthracnose in China, which provides a reference for the management of this disease.

The First Study of White Rust Disease Recognition by Using Deep Neural Networks and Raspberry Pi Module Application in Chrysanthemum

Growth factors affect farm owners, environmental conditions, nutrient adaptation, and resistance to chrysanthemum diseases. Healthy chrysanthemum plants can overcome all these factors and provide farms owners with a lot of income. Chrysanthemum white rust disease is a common disease that occurs worldwide; if not treated promptly, the disease spreads to the entire leaf surface, causing the plant’s leaves to burn, turn yellow, and fall prematurely, reducing the photosynthetic performance of the plant and the appearance of the flower branches. In Korea, chrysanthemum white rust disease most often occurs during the spring and autumn seasons, when temperature varies during the summer monsoon, and when ventilation is poor in the winter. Deep neural networks were used to determine healthy and unhealthy plants. We applied the Raspberry Pi 3 module to recognize white rust and test four neural network models. The five main deep neural network processes utilized for a dataset of non-diseased and white rust leaves include: (1) data collection; (2) data partitioning; (3) feature extraction; (4) feature engineering; and (5) prediction modeling based on the train–test loss of 35 epochs within 20 min using Linux. White rust recognition is performed for comparison using four models, namely, DenseNet121, ResNet50, VGG-19, and MobileNet v2. The qualitative white rust detection system is achieved using a Raspberry Pi 3 module. All models accomplished an accuracy of over 94%, and MobileNet v2 achieved the highest accuracy, precision, and recall at over 98%. In the precision comparison, DenseNet121 obtained the second highest recognition accuracy of 97%, whereas ResNet50 and VGG-19 achieved slightly lower accuracies at 95% and 94%, respectively. Qualitative results were obtained using the Raspberry Pi 3 module to assess the performance of the four models. All models had accuracies of over 91%, with ResNet50 obtaining a value of 91%, VGG19 reaching a value of 93%, and DenseNet121 reaching 95%. The highest accuracy rate was 97% (MobileNet v2). MobileNet v2 was validated as the most effective model to recognize white rust in chrysanthemums using the Raspberry Pi 3 system. Raspberry Pi 3 module was considered, in conjunction with the MobileNet v2 model, to be the best application system. MobileNet v2 and Raspberry Pi require a low cost for the recognition of chrysanthemum white rust and the diagnosis of chrysanthemum plant health conditions, reducing the risk of white rust disease and minimizing costs and efforts while improving floral production. Chrysanthemum farmers should consider applying the Raspberry Pi module for detecting white rust, protecting healthy plant growth, and increasing yields with low-cost.

An Efficient Segmented Random Access Scan Architecture with Test Compression

Integrated circuit (IC) chip designs relying on Random Access Scan (RAS) architecture for post-production structural tests typically provide lower test power dissipation, test data volume, and test application time compared to the classical serial scan-based Design for Test (DFT) methodology. However, previous RAS schemes incur high signal routing and test area overheads relative to the serial scan way. Unlike serial scan schemes, previous RAS schemes have not been effectively combined with test compression to further reduce test application time and test data volume. Authors have already formally documented a locally addressed (segmented) and compressed Segmented RAS (SRAS) architecture with low area overhead and test application time. This paper describes the SRAS architecture in more detail and provides comparative experimental results. Area overhead is reduced using test access hierarchy (segmented), while adding compression to RAS lowers the test application time. Also presented is another enhancement to incorporate a scan channel multiplex block at hierarchy segments which helps drastically decrease the area and routing overhead of the original architecture to practically implementable levels on commercial circuits. The extra Segment Data Multiplexor (SDM) blocks reduce the area overhead of other components by the multiplexing factor, and the reduction in overall area is significant based on experimental data. Test data compression and auto addressing of segments are achieved by transmitting a seed address to select segments with auto-increment or auto-decrement capability followed by either single cell selection or entire leaf cell segment selection. To further reduce the area overhead and test power, this architecture is enhanced to contain multiple channels at a cost of increased overall test application time with no increase in test data volume. Results of applying the enhancements to a large circuit with one level of intermediate segments with each of them having 256 leaf segments are presented in the paper with and without multichannel multiplexing for comparison.

Fungal succession in decomposing ash leaves colonized by the ash dieback pathogen Hymenoscyphus fraxineus or its harmless relative Hymenoscyphus albidus.

The ascomycete Hymenoscyphus fraxineus, originating from Asia, is currently threatening common ash (Fraxinus excelsior) in Europe, massive ascospore production from the saprotrophic phase being a key determinant of its invasiveness. To consider whether fungal diversity and succession in decomposing leaf litter are affected by this invader, we used ITS-1 metabarcoding to profile changes in fungal community composition during overwintering. The subjected ash leaf petioles, collected from a diseased forest and a healthy ash stand hosting the harmless ash endophyte Hymenoscyphus albidus, were incubated in the forest floor of the diseased stand between October 2017 and June 2018 and harvested at 2-3-month intervals. Total fungal DNA level showed a 3-fold increase during overwintering as estimated by FungiQuant qPCR. Petioles from the healthy site showed pronounced changes during overwintering; ascomycetes of the class Dothideomycetes were predominant after leaf shed, but the basidiomycete genus Mycena (class Agaricomycetes) became predominant by April, whereas H. albidus showed low prevalence. Petioles from the diseased site showed little change during overwintering; H. fraxineus was predominant, while Mycena spp. showed increased read proportion by June. The low species richness and evenness in petioles from the diseased site in comparison to petioles from the healthy site were obviously related to tremendous infection pressure of H. fraxineus in diseased forests. Changes in leaf litter quality, owing to accumulation of host defense phenolics in the pathogen challenged leaves, and strong saprophytic competence of H. fraxineus are other factors that probably influence fungal succession. For additional comparison, we examined fungal community structure in petioles collected in the healthy stand in August 2013 and showing H. albidus ascomata. This species was similarly predominant in these petioles as H. fraxineus was in petioles from the diseased site, suggesting that both fungi have similar suppressive effects on fungal richness in petiole/rachis segments they have secured for completion of their life cycle. However, the ability of H. fraxineus to secure the entire leaf nerve system in diseased forests, in opposite to H. albidus, impacts the general diversity and successional trajectory of fungi in decomposing ash petioles.

LeafSpec-Dicot: An Accurate and Portable Hyperspectral Imaging Device for Dicot Leaves.

Soybean is one of the world's most consumed crops. As the human population continuously increases, new phenotyping technology is needed to develop new soybean varieties with high-yield, stress-tolerant, and disease-tolerant traits. Hyperspectral imaging (HSI) is one of the most used technologies for phenotyping. The current HSI techniques with indoor imaging towers and unmanned aerial vehicles (UAVs) suffer from multiple major noise sources, such as changes in ambient lighting conditions, leaf slopes, and environmental conditions. To reduce the noise, a portable single-leaf high-resolution HSI imager named LeafSpec was developed. However, the original design does not work efficiently for the size and shape of dicot leaves, such as soybean leaves. In addition, there is a potential to make the dicot leaf scanning much faster and easier by automating the manual scan effort in the original design. Therefore, a renovated design of a LeafSpec with increased efficiency and imaging quality for dicot leaves is presented in this paper. The new design collects an image of a dicot leaf within 20 s. The data quality of this new device is validated by detecting the effect of nitrogen treatment on soybean plants. The improved spatial resolution allows users to utilize the Normalized Difference Vegetative Index (NDVI) spatial distribution heatmap of the entire leaf to predict the nitrogen content of a soybean plant. This preliminary NDVI distribution analysis result shows a strong correlation (R2 = 0.871) between the image collected by the device and the nitrogen content measured by a commercial laboratory. Therefore, it is concluded that the new LeafSpec-Dicot device can provide high-quality hyperspectral leaf images with high spatial resolution, high spectral resolution, and increased throughput for more accurate phenotyping. This enables phenotyping researchers to develop novel HSI image processing algorithms to utilize both spatial and spectral information to reveal more signals in soybean leaf images.

First Report of Powdery Mildew Caused by Golovinomyces latisporus on Helianthus annuus in the Arizona.

Helianthus annuus, known as the common sunflower, is an annual plant indigenous to the United States. The crop is grown for its edible oil, seeds, and as an ornamental. In November 2021, powdery mildew-like signs and symptoms were observed on sunflower in a house garden located at Fortuna Foothills, Yuma County, AZ (32.6725°N, 114.4329°W). Signs of powdery mildew included white blotches of amphigenous and caulicolous mycelia. Initially, signs appeared as circular spots that expanded over the entire leaf and were also observed later on petioles and stems. Fungal hyphae were branched, septate, and with nipple-shaped appressoria. Foot cells of conidiophores were erect, cylindrical, and followed by one to three short cells bearing conidia. The conidiophores were hyaline, straight, cylindrical and produced short chains of up to four immature conidia. Conidia were ovoid to ellipsoid, seldom cylindrical, without-fibrosin bodies and measured 25 to 40 μm in length (mean= 34 μm) and 16 to 24 μm in width (mean= 18.6 μm) (n = 10), with an average length: width ratio of 1.8. The germination of conidia was Euoidium type with short germ tube. Chasmothecium formation was not detected. As the disease progressed, the infected leaves became wilted and senesced. The morphological characteristics of this fungus were in accordance with those described for G. latisporus (Braun and Cook, 2012; Qiu et al., 2020). For molecular identification, genomic DNA was isolated from fungal colonies using the DNeasy Plant kit (Qiagen). The internal transcribed spacer (ITS), large ribosomal subunit (28S), intergenic spacer (IGS), beta- tubulin (TUB2) and chitin synthase 1 (CHS1) regions were amplified using the primer sets, ITS5/ITS4 (White et al., 1990), LSU1/LSU2 (Scholin et al., 1994), IGS-12a/NS1R (Carbone and Kohn, 1999), TubF1/TubR1 and gCS1a1/gCS1b (Qiu et al., 2020). Sequences were submitted in the GenBank under accession numbers OP160535 (ITS), OP153874 (28S rDNA), OP160534 (IGS), OP168959 (TUB2) and OP168960 (CHS1). A BLAST search revealed 98.7 to 100-% identity to G. latisporus sequences (MK452603, NG_068877, MK452520, MK452476, and MK452428). Phylogenetic analysis based on the combined sequence datasets of ITS+28S rDNA+IGS+TUB2+CHS1 also grouped Yuma isolate in a monophyletic clade with G. latisporus accessions from Qiu et al. (2020). A pathogenicity test was carried out by inoculating four sunflower varieties (Velvet queen, Evening sun, Skyscraper and Mammoth). Conidia from infected leaves were dusted on the leaves of 10 individually potted, five-week-old seedlings of each variety. Four seedlings of each variety were not inoculated and served as controls. The inoculated and control plants were then kept in two separate greenhouses at 25-28°C at the Yuma Agricultural Center, Yuma, AZ. Inoculated plants started showing symptoms of powdery mildew within 7 days of inoculation, while the control plants stayed healthy and disease-free. The morphological characteristics of powdery mildew fungus on the inoculated plants were identical to the isolate collected from the garden, with the same sequence following PCR as above, thus fulfilling Koch's postulates. G. latisporus has been previously reported on common sunflower from Washington and California states (Qiu et al., 2020), however, this is a first report from Arizona. Although sunflower is not a major crop in Arizona, the wild sunflower population could serve as reservoir for the spread of the disease.

A Robust Approach for Identification and Classification of Turmeric Plant Leaf Diseases Using LDA-ANFIS Algorithm

Abstract: Agriculture is the backbone of a country and it plays a very important role in the economy. In the field of agriculture, it is very important to identify the disease of crops and its nature. Turmeric plant is a significant plant used in turmeric production, and turmeric powder is used as medicine for certain diseases and as an antiseptic. There are several pests and diseases with significant effects on turmeric yields and leaf spot disease (Curcuma longa) among the most significant ones. Leaf spot disease leads to large damages to the leaves. The disease initially emerges as small circular spots, then evolves instantly and spreads over the entire leaf surface. The disease ultimately ends up with complete die out of the leaves. The data base of different leaf images was created and processed using SFCM segmentation, and leaf images textural analysis was carried out using GLCM. The LDA-ANFIS classifier is used for classification method and it helps to improve the detection rate and reduce the entropy loss. It is highly efficient and accurate to detect the disease image with different number of categories (Leaf Spot, Leaf Blotch Disease and Bacterial Wilt Disease etc.). Experimental analysis is done to calculate the performance metric like as Accuracy, Precision, F measure, Recall, Sensitivity and Specificity. Then, the comparative analysis of the existing parameters is compared to the proposed algorithm parameters. The proposed system LDA-ANFIS algorithm performance value of accuracy is 98%.

First report of Cladosporium cladosporioides causing leaf blight on Sambucus chinensis in China.

Sambucus chinensis, belonging to the Caprifoliaceae family, is an economically large herb plant that is widely cultivated in southern China for its good ornamental characteristics, edible properties, and medicinal values. In July 2021, symptoms of leaf spot were observed on Sambucus chinensis plants in two fields of Chongqing Medicinal Botanical Garden (29º8'26" N, 107º13'23" E) in Nanchuan city, Chongqing, China. Disease incidence was approximately 35 and 50% for each field. The symptoms were initially yellow or black irregular spots on leaves, and then increased to larger dark brown lesions. Finally, the entire infected leaf was blighted, withering, curl and abscission. Ten blight leaves were randomly sampled from fields. Tissues were cut into small pieces and surface sterilized with 75% ethanol for 30 s and sterilized in 2% sodium hypochlorite for 2 min, rinsed thrice with sterile distilled water, plated on potato dextrose agar (PDA) plates, and incubated at 25°C for 7 days in the dark. Later, 20 isolates were obtained from the infected leaves and had similar characteristics. Three isolates were randomly selected (CQ81, CQ82, CQ83) for the further study. Colonies on PDA were olive-green to brown with a velvety texture. Conidia (n=30) were pale- to olive-brown, smooth to verruculose and produced in long, branched chains which were easily disarticulate, single celled, and elliptical to limoniform, and measured as 2.51~4.29 × 1.63~2.14 μm. Conidiophores were solitary, straight or flexous, often unbranched. The DNA of three isolates were extracted and the internal transcribed spacer (ITS) region and translation elongation factor 1-alpha (TEF1-α) were sequenced using primer pairs ITS1/ITS4 (White et al. 1990) and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. The sequences of three isolates were 100% identical, and one representative isolate CQ82 were deposited in GenBank (ON387641, ITS; and ON409522, TEF). BLASTn analysis of these sequences showed 99 to 100% nucleotide identity with the sequences of C. cladosporioides CPC 14705 in Korea (Bensch et al. 2010). Phylogenetic analysis using Neighbor-joining method and concatenated sequences (ITS +TEF1) with MEGA7 placed isolate CQ82 in C. cladosporioides with 99% bootstrap support. On the basis of morphological and molecular characteristics, the isolates were identified as C. cladosporioides (Bensch et al. 2010; Nam et al. 2015). A total of sixteen healthy potted plants of S. chinensis were conducted for the pathogenicity test. Eight plants were selected and one shoot of each plant was randomly used for inoculation. Leaves from the shoot of each plant were brushed with 106 conidia/ml suspension of isolate CQ82. Another 8 plants were performed in the same procedure, inoculated with sterile distilled water as control. All plants were covered with plastic bags for two days and then arranged in a greenhouse with 80% relative humidity at 25°C. The pathogenicity test was repeated thrice. After 15 days inoculation, the similar symptoms were observed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from blight tissue and identified as C. cladosporioides by the methods described above. Although this fungus was previously reported to cause leaf disease on many plants (Meneses et al. 2018; Sun et al. 2017), this is the first report of C. cladosporioides causing leaf blight on S. chinensis in China. This study will establish a foundation for controlling the disease.

First Report of Fusarium falciforme Causing Leaf Blight in Acacia mangium in China.

Acacia mangium Willd. is an important economic tree species with diverse uses and high ecological value, used in agriculture, restoration of degraded lands, for ornamental purposes, and commercial forestry (Leroy et al. 2009). This tree is widely cultivated in tropical and subtropical regions of China, such as Hainan, Guangdong, and Guangxi Provinces. In July 2021, a leaf blight of A. mangium saplings was observed with widespread distribution in the cultivation base of Hainan University (20° 3' 33″ N, 110°18' 56″ E) in Hainan Province, China. The initial symptoms were brown-to-black, irregular-shaped lesions on the leaf margin or tip. The entire leaf wilted and turned brown, leading to death and defoliation in the later periods of the disease (Fig. 1A-C). Of the 50 trees surveyed, the incidence rate was 68%. Small pieces of diseased tissue were collected from six different infected trees. The tissue surface was disinfested with 75% ethanol for 30 s, and 1% mercury chloride for 1 min, then rinsed three times with sterile distilled water. Infected tissues were placed onto potato dextrose agar (PDA) containing 0.01% streptomycin and incubated at 25°C for 7 days. Seventeen isolates were obtained by single-spore isolation on fresh PDA plates, and 15 isolates were identified morphologically as Fusarium spp. (Leslie et al. 2006). The colony surface was white, and the reverse side yellowish (Fig. 1D-E). Microconidia were oval or kidney-shaped, 6.2 to 9.6 × 2.5 to 6.3 μm (n=60). Macroconidia were sickle-shaped, with three to five septa, 19.5 to 41.2 × 3.7 to 6.8 μm (n=60) (Fig. 1F). For molecular identification, genomic DNA of three isolates (HNKFS01, HNKFS02, and HNKFS03) was extracted using E.Z.N.A.® HP Plant DNA kit (Omega Bio-Tek) and the internal transcribed spacer of rDNA (ITS), translation elongation factor 1-α (EF1-α), RNA polymerase II beta subunit (RPB2), and β-tubulin (TUB) regions were amplified and sequenced using primers ITS1F/ITS4, EF-1/EF-2, RPB2-5F2/11aR, and T1/T2, respectively (O'Donnell et al. 2010; O'Donnell and Cigelnik 1997; White et al. 1990). Sequences were deposited in GenBank for ITS (OM289152 to OM289154), EF1-α (OM289155 to OM289157), RPB2 (ON193365 to ON193367), and TUB (ON193314 to ON193316). Using BLASTn, ITS sequences matched 98.88% (532/538 bp) to F. falciforme (MT114705), EF1-α sequences matched 99.58% (703/706 bp; MK752502), RPB2 sequences matched 98.31% (988/1005 bp; MW691193), and TUB gene sequences matched 99.10% (332/335 bp; OK087483). Polyphasic identification with ITS, EF1-α, RPB2, and TUB sequences revealed a 98.51% match with F. falciforme (NRRL 32729) sequences in Fusarium-ID databases. Pathogenicity of 15 isolates was determined by using healthy one-year-old A. mangium seedlings. Three leaves from each seedling were selected to test. Mycelial plugs of each isolate were inoculated on one leaf (three plugs per leaf). An agar plug without the fungus was placed on a leaf as a control. The pathogenicity tests were repeated twice. After 7 days of incubation in a greenhouse, all leaves inoculated with the pathogen showed black lesions with white flocculent hyphae (Fig. 1H), while control leaves were asymptomatic (Fig. 1G). Typical colonies of F. falciforme were isolated from all inoculated leaves, and identified by morphology and ITS, EF1-α, RPB2, and TUB sequence analysis, fulfilling Koch´s postulates. To our knowledge, this is the first report of F. falciforme causing leaf blight in A. mangium in China and the world. This disease can lead to death of A. mangium, which seriously restricts commercialization, requiring that management strategies be adopted.

First Report of Leaf Spot on Cherry Tomatoes Caused by Exserohilum rostratum in Hainan Province, China.

Cherry tomatoes (Lycopersicon esculentum var. cerasiforme) is the main tomato variety planted in Hainan Province, China and is prized for its nutritional value and sweet taste (Zheng et al. 2020). During October 2020 to February 2021, a leaf spot disease was observed on cherry tomatoes (cultivar Qianxi) in Chengmai, Hainan Province. The disease incidence was approximately 40% in each of three fields in Yongfa (19°76'-21°08'N, 110°21'-110°51'E). Leaves were initially chlorotic before developing black, irregular-shaped lesions on the leaf margins or tips. After several days, lesions expanded along the mid-vein to encompass the entire leaf. Then, the affected leaves turned gray-brown, leading to defoliation. Severely affected leaves became dry and necrotic. Leaf tissues of 10 diseased plants samples collected from the fields were surface sterilized in 70% ethanol for 30 s, 0.1% HgCl2 for 30 s, rinsed thrice with sterile distilled water for 30 s, placed on a modified potato dextrose agar (PDA) with 30 mg/liter of kanamycin sulfate, and incubated at 28°C in the dark for 3 to 5 days. Three fungal isolates were obtained from the diseased leaves by single-sporing. The mycelia on PDA were white and later became gray or dark gray after 3 to 4 days. Conidia were rostrate, straight to slightly curved, ellipsoidal to narrowly obclavate, dark brown, protuberant with a darker and thicker wall at the basal end. Conidia were 4 to 12 distoseptate and measured 63.92 ± 5.77 × 13.47 ± 1.22 µm (n= 50) Conidiophores were single, cylindrical, dark brown, geniculate, with swollen conidiogenous cells containing a acircular conidial scar. Morphological characteristics of the isolates were similar to those of Exserohilum rostratum (Cardona et al. 2008). A representative isolate (FQY-7) was used for pathogenicity and genomic studies. Genomic DNA was extracted from the mycelium of a representative isolate (FQY-7). The internal transcribed spacer (ITS) region, actin (act), translation elongation factor 1-alpha (tef1-α), glyceraldehydes 3-phos-phate dehydrogenase (gapdh) and β-tubulin (tub2) genes were amplified with primers ITS1/ITS4 (White et al. 1990), Act1/Act4 (Voigt and Wöstemeyer 2000), EF1-728F/EF1-986R (Carbone and Kohn 1999), Gpd-1/Gpd-2 (Berbee et al. 1999) and T1 (O'Donnell and Cigelnik 1997) + Bt2b (Glass and Donaldson 1995). The consensus sequences (GenBank Accession No. MW036279 for ITS, MW133266 for act, MW133268 for tef1-α, MW133267 for gapdh, and MW133269 for tub2) were aligned using BLAST in GenBank obtaining 100%, 100%, 99%, 100%, and 99% identity to E. rostratum strain CBS706 (LT837842, LT837674, LT896663, LT882546, LT899350). Maximum likelihood analysis based on the combined five gene sequences was conducted under 1,000 bootstrap replicates. The Phylogenetic tree showed that FQY-7 and E. rostratum were located in one clade supported with 99% bootstrap values. Pathogenicity test was performed by depositing 10-µl droplets of a conidial suspension (1 × 106 per ml) into 5 noninoculated leaves (using a sterile needle) of 10 healthy 5-month-old cherry tomato (cv. Qianxi) plants. An equal number of artificially control leaves were received only sterile water to serve as a negative control. The test was conducted three times. Plants were kept at 28°C with 80% humidity and observed for symptoms every day. Two weeks after inoculation, all the inoculated plants showed symptoms of black spots similar to those observed in the field. No symptoms were observed on the controls. FQY-7 was successfully re-isolated from the inoculated leaves and confirmed by morphological characterization and molecular assays as described herein. To the best of our knowledge, this is the first report of leaf spot of cherry tomatoes caused by E. rostratum in China. Confirming the existence of this pathogen in this area will be useful to adopt effective field management measures to control this disease on cherry tomatoes.

Leaf vein disease in Nelumbo nucifera caused by Nigrospora pyriformis infection in China.

Nelumbo nucifera (Nymphaeaceae) has both ornamental and nutritional uses in China. In July 2021, a novel disease was observed on plants in the White Lotus Science and Technology Expo Park in Guangchang county, Fuzhou city, Jiangxi province (26.79° N, 116.31° E). Infection was visible as nearly round black spots on the leaves in the early stages of infection. At later stages, the spots spread along the veins forming reticular necrosis until the entire leaf was infected, and the disease caused approximately 20% of leaves to die. To identify the pathogenic organism, 5×5 mm samples were taken from affected tissue adjoining healthy tissue, sterilized in 75% ethanol for 30 s, and immersed in 0.1% mercury chloride for a further 30 s, before washing in sterile water and transfer to potato glucose agar (PDA) plates. After culturing at 28℃±1℃ for five days, white regularly shaped round colonies were visible that after 10 days turned black with fluffy hyphae. The individual conidia produced by the conidiophore were initially a light-brown color which changed to black as the pigment accumulated; conidia were globose to subglobose, 17.10 (14.77-21.66) ×14.70 (12.08-16.93) μm in size (n=50), with glossy even surfaces lacking in septa, suggestive of Nigrospora. To verify this, PCR amplification was conducted using ITS1/ITS4 primers for the 5.8S rRNA gene. The primers EF1-728F and EF-2 were used for amplifying translation elongation factor 1α (O'Donnell et al. 1998, Carbone and Kohn 1999), and Bt-2a and Bt-2b (Glass and Donaldson 1995) for amplifying β-tubulin. The sequences were found to be 99% to 100% identical to those of Nigrospora pyriformis in GenBank (accession numbers NR153469.1, KY019290.1, and KY019457.1, respectively). The sequences were uploaded to GenBank (accession numbers OK605048, OL362197, and OK662966), with lengths of 522 bp, 475 bp, and 410 bp, respectively. A maximum-likelihood phylogenetic tree was created in MEGA5. Pathogenicity was tested by four isolates hyphal inoculation and conducted in an experimental field of the White Lotus Science and Technology Expo Park. Five-millimeter discs were taken from infected and uninfected PDA plates and inoculated into five 1-month-old healthe lotus leaves using inoculations, three with the pathogen and an uninfected sample as the control every leaf. The discs were covered with moisturized sterile cotton and fixed with transparent tape. The wounds were moistened with sterile water and sealed with adhesive tape. After 14 days, spots were visible at the infected sites while the control sites showed no symptoms. The same pathogen was recovered from the infected leaves, fulfilling Koch's requirements. Leaf spot diseases resulting from N. pyriformis infection or infection with other Nigrospora species include infection of Chenopodium album by N. pyriformis (Chen et al. 2020), Eclipta prostrata by N. sphaerica (Qiu et al. 2022), Nicotiana tabacum by N. oryzae (Wang et al. 2022), and Oxalis corymbosa by N. hainanensis (Zheng et al. 2021). This investigation appears to be the first identification of Nelumbo nucifera vein disease resulting from Nigrospora pyriformis infection. The present results are useful for the management and avoidance of the disease caused by Nigrospora pyriformis.

The Basic Experimental Setup for the Vacuum-assisted, Agrobacterium-mediated Transient Expression in Tomato

Several methods are available for use, to deliver the gene of interest into plants. Among these, Agrobacterium-mediated transformation utilizes binary vector systems to achieve the stable transformation of plants. Alas, this process is labor-intensive and time-consuming as several months are needed to obtain a true transgenic plant. Transient gene expression (e.g., vacuum-infiltration) systems were offered as an alternative over stable transformation, specifically to overcome time-related drawbacks. However, this method requires expensive equipment such as vacuum chambers. In this study, we report a vacuum-infiltration protocol for the transient expression of a reporter gene, modified green fluorescent protein (mGFP), in tomato seedling. With a basic experimental setup (including a custom-built growth chamber) with affordable equipment, we showed that the entire leaf can be infiltrated by applying a mere 200 millibar vacuum for 6 minutes, and thus the transient expression can be achieved in tomato plant, evidenced by PCR-based detection of the T-DNA, detection of mGFP both analytically with SDS-page analysis, and visually by the images acquired by fluorescence microscopy. Furthermore, different Agrobacterium tumefaciens strains were tested for their transformation efficiency, and we showed that LBA4404 was the most effective strain to use in the vacuum-assisted transient expression.

Сollection of melon crops: identification of homologous series in hereditary variability

The law of homologous series in variation has important significance for disclosing the potential hereditary variability in plants. The use of the law in studies of cucurbit cropcollections, hybrid populations, mutants, and breeding lines made it possible to discover valuable and previously unknown forms of watermelon, muskmelon and different squash species for their use in practical breeding. For example, these are bushy and short vine forms for breeding cultivars suitable for mechanized cultivation. This work resulted in creating cultivars of bushy watermelon ‘Svaytoslav’, short vine watermelon ‘Podarok Solntsa’, bushy Cucurbita pepo L. ‘Kustovaya oranzhevaya’ and Cucurbita maxima Duch. ‘Kustovaya Zolotaya’, ‘Malyshka’, and ‘Matrieschka’, short vine Cucurbita maxima Duch. ‘Lechebnaya’ and Cucurbita moschata Duch. ex Poir ‘Mariya’, and also of a short vine muskmelon ‘Stanislava’. The mentioned cultivars have been included in the State Register of Selection Achievements. Watermelon genetic marker lines with the nonlobed (entire) leaf (TsL), namely TsL 656, TsL 662, TsL 784, TsL 752, have been identified and used for crerating entire leaf cultivars ‘Blagodatnyi’, ‘Lubimchik’, and ‘Krasavchik’. A watermelon cultivar ‘Surpriz’ with high quality, delicately colored bright yellow flesh, and cultivar ‘Solyaris’ with fruits combining yellow color of rind with yellow flesh, have been created for cultivation by amateur gardeners. Of interest is an ornamental form of watermelon with yellow-green mosaic leaf and bright yellow fruits (the yellowgreen bushy line) ZhZKL 870, as well as the yellow-green muskmelon line ZhZL 487 and yellow-green pumpkin (Cucurbita maxima) line ZhZL 692. Bushy lines KL 648, KL 652 and short vine KPL 648, KPL 652 of pumpkin (Cucurbita moschata) have been created. Improved female lines (ZhL) of muskmelon (ZhL 415, ZhL 421, ZhL 423, and ZhL 427) have been identified for heterosis breeding. It follows from the above that the law in question found practical application in breeding cucurbit crops.

Nondestructive testing and visualization of compound heavy metals in lettuce leaves using fluorescence hyperspectral imaging

This study evaluated the feasibility of nondestructive testing and visualization of compound heavy metals (cadmium and lead) in lettuce leaves using fluorescence hyperspectral imaging. In addition, a method involving wavelet transform and stepwise regression (WT-SR) was proposed to perform dimensionality reduction of fluorescence spectral data. Fluorescent hyperspectral image acquisition and mathematical analysis were carried out on lettuce leaf samples processed with different compound heavy metal concentrations. The entire lettuce leaf sample was selected as a region of interest (ROI). Savitzky-Golay (SG) algorithm, multivariate scatter correction (MSC), standard normalized variable (SNV), first derivative (1st Der) and second derivative (2nd Der) were used to preprocess the ROI fluorescence spectra. Further, the successive projections algorithm (SPA), the competitive adaptive reweighted sampling (CARS), the iteratively retaining informative variables (IRIV) and variable iterative space shrinkage approach (VISSA), and the wavelet transform combined with stepwise regression (WT-SR) were used to reduce the dimension of spectral data. Finally, the multiple linear regression (MLR) algorithm was used to build the compound heavy metal content detection models. The results showed that the MLR models based on the feature data obtained by 1st Der-WT-SR achieved reasonable performance with Rp2 of 0.7905, RMSEP of 0.0269 mg/kg and RPD of 2.477 for Cd content under wavelet fifth layer decomposition, and with Rp2 of 0.8965, RMSEP of 0.0096 mg/kg and RPD of 3.211 for Pb content under wavelet first layer decomposition. The distribution maps of cadmium and lead contents in lettuce leaves were established using the optimal prediction models. The results further confirmed the great potential of fluorescence hyperspectral technology combined with optimization algorithm for the detection of compound heavy metals.

提高航空喷雾雾滴穿透性的方法和自动系统研究

When UAVs apply a pesticide at different speeds, droplet deposition area and canopy vortex area are not at the same location, which prevents droplets from depositing on the backside of leaves and lower part of plants in canopy vortex, and affects spray quality and pests and diseases control effect. To shorten the distance between the two areas and improve droplet penetration, a method for adjusting nozzle inclination angle based on droplet force analysis and tests was proposed in this paper. According to the obtained model, an automatic nozzle angle adjustment system was developed from hardware and software. The experimental results showed that the number of droplets deposited on the entire leaf increased by 21.58% when UAV spraying with the system mounted. The average number of droplets on the front side of the leaf increased by 14.44% while 66.05% was on the backside of the leaf with the system mounted. This indicates that the method and system proposed have a significant impact on improving the UAV spray penetration.

Plant Disease Detection using Advanced Convolutional Neural Networks with Region of Interest Awareness

The advent of deep learning has paved way for more efficient computer vision applications. In agricultural crop monitoring with technology driven approaches, it is indispensable to have plant disease identification. Recent research reveals that Convolutional Neural Network (CNN) is most suitable deep learning method to process leaf images for detecting diseases. As symptoms of leaf disease appear in specific area, considering entire leaf for processing incurs more computational cost and time besides deteriorating performance due to inadequate quality of training. To overcome this problem, we proposed a framework that considers extraction of ROI using deep CNN prior to prediction of pre-trained deep learning models such as VGG13, Res Net34, Dense Net19, Alex Net, Sqeezenet1_1 and Inception_v3. An algorithm named ROI Feature Map Creation (ROI-FMC) is defined to extract ROI for given input image. This will be given as input to another algorithm proposed namely ROI based Deep CNN with Transfer Learning for Leaf Disease Prediction (ROIDCNN-LDP). The latter is used to predict leaf diseases. Plant Village dataset is used for empirical study. The experimental results revealed that with ROI awareness, all models could perform well. However, Inception_v3 is the deep CNN model that outperforms other models