Gene Encoding Research Articles

Contribution of the murI Gene Encoding Glutamate Racemase in the Motility and Virulence of Ralstonia solanacearum.

Bacterial traits for virulence of Ralstonia solanacearum causing lethal wilt in plants were extensively studied but are not yet fully understood. Other than the known virulence factors of Ralstonia solanacearum, this study aimed to identify the novel gene(s) contributing to bacterial virulence of R. solanacearum. Among the transposon-inserted mutants that were previously generated, we selected mutant SL341F12 strain produced exopolysaccharide equivalent to wild type strain but showed reduced virulence compared to wild type. In this mutant, a transposon was found to disrupt the murI gene encoding glutamate racemase which converts L-glutamate to D-glutamate. SL341F12 lost its motility, and its virulence in the tomato plant was markedly diminished compared to that of the wild type. The altered phenotypes of SL341F12 were restored by introducing a full-length murI gene. The expression of genes required for flagella assembly was significantly reduced in SL341F12 compared to that of the wild type or complemented strain, indicating that the loss of bacterial motility in the mutant was due to reduced flagella assembly. A dramatic reduction of the mutant population compared to its wild type was apparent in planta (i.e., root) than its wild type but not in soil and rhizosphere. This may contribute to the impaired virulence in the mutant strain. Accordingly, we concluded that murI in R. solanacearum may be involved in controlling flagella assembly and consequently, the mutation affects bacterial motility and virulence.

Polymorphisms within the RANK and RANKL Encoding Genes in Patients with Rheumatoid Arthritis: Association with Disease Progression and Effectiveness of the Biological Treatment

Inconsistency of the results regarding the genetic variability within genes coding for receptor activator of nuclear factor κB (RANK) and its ligand (RANKL) in rheumatoid arthritis (RA) prompted us to study the RANK and RANKL polymorphisms as potential biomarkers associated with disease predisposition and response to anti-TNF treatment in a group of Polish patients with RA. This study enrolled 318 RA patients and 163 controls. RANK (rs8086340, C > G; rs1805034, C > T) and RANKL (rs7325635, G > A; rs7988338 G > A) alleles were determined by real-time PCR with melting curve analysis and related with clinical parameters. In addition, RANKL serum levels were measured by ELISA. The RANK rs8086340-G allele was overrepresented among patients as compared to controls (OD = 1.777, p = 0.038). C-reactive protein (CRP) levels were significantly (p < 0.05) associated with RANK rs8086340 polymorphism and were higher in the CC-homozygotes at the baseline while lower in the GG-carriers at the 12th week of the treatment. At the latter time point RANKL rs7325635-GG-positive patients also showed significantly lower CRP concentrations. Higher alkaline phosphatase levels before induction of anti-TNF therapy were observed in RANK rs8086340 and RANK rs1805034 CC homozygotes (p = 0.057 and p = 0.035, respectively). The GG homozygosity of both RANKL single nucleotide polymorphisms was significantly associated with the number of swollen joints (rs7988338 and rs7325635, before and at the 12th week of therapy, respectively, p < 0.05 in both cases). These results imply that polymorphisms within the RANK and RANKL genes affect RA susceptibility and anti-TNF treatment outcome.

Molecular Detection and Characterization of the mecA and nuc Genes From Staphylococcus Species (S. aureus, S. pseudintermedius, and S. schleiferi) Isolated From Dogs Suffering Superficial Pyoderma and Their Antimicrobial Resistance Profiles.

Canine superficial pyoderma (CSP) is a bacterial infection secondary to several skin diseases of the dog. Staphylococcus pseudintermedius, which is a commensal bacterium of the dog's skin, is the leading agent found in dogs affected by CSP, which can progress to deep pyoderma. It is also of clinical significance because S. pseudintermedius strains carry antimicrobial resistance genes, mainly the mecA gene. In this descriptive longitudinal study, molecular characterization of bacterial isolates from dogs affected by CSP was performed in addition to phenotyping, antimicrobial profiling, and assessment of resistance carriage status. Fifty dogs (24 females and 26 males) attending the CES University Veterinary Teaching Hospital were included in the study. CSP was confirmed according to clinical signs and cytological examination. Swabs were taken from active skin lesions for bacterial culture, and phenotyping and antimicrobial resistance profiles were assessed using API-Staph phenotyping and the Kirby–Bauer method, respectively. We also performed molecular detection and characterization of the mecA and nuc encoding gene of coagulase-positive Staphylococci. The mecA gene frequency was established by qPCR amplification of a 131bp gene fragment. Data were evaluated by descriptive statistics. Erythema, peeling, pruritus, and alopecia were the predominant symptoms (72, 56, and 46%, respectively). We isolated bacteria compatible with Staphylococcus species from all samples tested. API phenotyping showed 83.1 to 97.8% compatibility with S. pseudintermedius. PCR-genotyping resulted in 15, 3, and 1 isolates positive for S. pseudintermedius, S. aureus, and S. schleiferi, respectively. Isolated strains showed high susceptibility to Imipenem, Ampicillin/Sulbactam, and Rifampicin (100, 94, and 92%, respectively). The highest resistance was against Vancomycin and Trimethoprim/Sulfamethoxazole (98 and 74%, respectively). S. pseudintermedius, S. aureus, and S. schleiferi isolates were cloned and shared 96% sequence homology. Finally, we found 62% carriage status of the mecA gene in isolates of CSP patients, although only 36% of the isolates were methicillin-resistant. Identification of three Staphylococcus species causing CSP, high-level resistance against conventional antimicrobials, and carriage of the mecA gene highlight the importance of performing molecular characterization of bacteria causing dermatological conditions in dogs.

Detection of Carbapenemase and CTX-M Encoding Genes Directly from Bronchoalveolar Lavage Using the CRE and ESBL ELITe MGB Assays: Toward Early and Optimal Antibiotic Therapy Management of Critically Ill Patients with Pneumonia.

The detection of carbapenemase extended-spectrum β-lactamase (ESBL)-producing Enterobacterales (EB) has become a major issue among critically ill patients, especially due to their impact on appropriate antimicrobial therapy. This study aimed at evaluating the potential contribution of molecular assays to early optimization of empirical antibiotic therapy among critically ill patients with carbapenemase- and/or CTX-M-producing EB pneumonia. The CRE and ESBL ELITe MGB® assays were evaluated directly on 197 bronchoalveolar lavage (BAL) samples obtained from 120 patients. Molecular results were then compared to routine culture-based diagnostic results, and a retrospective analysis of the therapeutic antimicrobial management was performed. Among the 197 clinical specimens, blaKPC-like and blaCTX-M-like were detected in 20 (10.2%) and 12 (6.1%) specimens belonging to 15 and 11 patients, respectively. Positive predictive value (PPV) and negative predictive value (NPV) of the CRE ELITe MGB Kit were 85% [95% confidence interval [CI]: 64.9-94.6] and 100%, respectively. PPV and NPV of the ESBL ELITe MGB Kit were 75% [95% CI: 49.4-90.2] and 100%, respectively. Retrospective analysis of the therapeutic antimicrobial management at the time of BAL collection showed that in ∼50% of patients with carbapenemase- and CTX-M-producing EB pneumonia empirical antibiotic therapy could have been optimized at least 48-72 hr earlier if positive molecular data had been used. The CRE and ESBL ELITe MGB assays might be an interesting tool for expediting optimization of empirical antibiotic therapy in critically ill patients with pneumonia, depending on local epidemiology of antibiotic resistance, patient risk stratification for EB infection, and availability of an antimicrobial stewardship team.

Prevalence, Virulence Feature, Antibiotic Resistance and MLST Typing of Bacillus cereus Isolated From Retail Aquatic Products in China.

Bacillus cereus is one of the most important foodborne pathogenic microorganisms, which can lead to gastrointestinal and non-gastrointestinal diseases. However, the potential risk of B. cereus in aquatic products in China has not been comprehensively evaluated yet. In this study, a total of 860 aquatic samples from three types of retail aquatic products were collected from 39 major cities in China from 2011 to 2016. The contamination, distribution of virulence genes, antibiotic resistance and genetic diversity of B. cereus isolates were measured and analyzed. Of all the samples, 219 (25.47%) were positive for B. cereus and 1.83% (4/219) of the samples had contamination levels of more than 1,100 most probable number (MPN)/g. Different isolates had virulence potential, within which 59.6% (164/275) contained all three kinds of enterotoxin genes (nhe, hbl, and cytK-2) and 5.1% (14/275) possessed cereulide encoding gene cesB. The antimicrobial resistance profiles revealed the universal antibiotic resistance to rifampin and most β-lactams, suggesting the necessity to continuously monitor the antibiotic resistance of B. cereus in aquatic products and to control drug use in aquaculture. In sum, our study indicates the potential hazards of B. cereus isolated from aquatic products to customers and may provide a reference for clinical treatment caused by B. cereus.

Polymorphisms of the Gene Encoding Cytochrome b-245 Beta Chain of NADPH Oxidase: Relationship with Redox Homeostasis Markers and Risk of Type 2 Diabetes Mellitus

The aim of this study was to investigate the associations of the single-nucleotide polymorphisms (SNPs) rs5917471, rs5963327 and rs6610650 of the gene encoding the beta chain of cytochrome b-245 of NADPH oxidase (CYBB gene) with the redox-homeostasis parameters of blood plasma and the risk of development of type 2 diabetes mellitus (T2D). The study included 2086 unrelated individuals of Slavic origin (1022 patients with T2D and 1064 healthy volunteers). Genotyping of SNPs was performed on a MassArray Analyzer 4 genomic mass spectrometer. Due to the localization of the CYBB gene on the X chromosome, the analysis of the effect of its single nucleotide variants on the predisposition to T2D and the parameters of the redox status of blood plasma was carried out separately in men and women by the method of linear regression analysis, adjusted for age and body mass index. In men, the association of the allele T rs5963327 (OR 1.7, 95% CI 1.06–2.75, P = 0.028) and the allele A rs6610650 (OR 1.71, 95% CI 1.05–2.78, P = 0.029) with an increased risk of T2D development was established. Genotype T/T rs5963327 (OR 1.35, 95% CI 1.05–1.73, P = 0.017) and genotype A/A rs6610650 (OR 1.34, 95% CI 1.05–1.72, P = 0.020) were also associated with the risk of T2D development in women. The T-T-A haplotype, including minor alleles of the studied rs5917471–rs5963327–rs6610650 polymorphisms, was associated with an increased risk of developing T2D in both men (OR 1.29, 95% CI 1.04–1.58, P = 0.022) and women (OR 1.27, 95% CI 1.02–1.58, P = 0.034). Patients with T2D had a significantly higher content of hydrogen peroxide in their plasma compared to the control group (P < 0.05), regardless of sex. However, the relationship between rs5963327 and rs6610650 and an increased content of oxidized glutathione (GSSG) was only found female participants. Thus, for the first time, we detected associations between the rs5963327 and rs6610650 SNPs of the CYBB gene and both the redox status of patients and the development of T2D. The studied polymorphic variants of the gene encoding the beta chain of cytochrome b-245 of NADPH oxidase may contribute to a shift in the balance of the redox homeostasis system towards the prooxidant status, which is characteristic of T2D.

Evaluating Expression of Gene Encoding Flavonol Synthase in Green TrungDu and Purple TrungDu by Real time PCR and HPLC Technique

In plants, flavonol synthase (FLS) is a multifunctional enzyme that converts dihydroflavonol into flavonols and naringenin into dihydrokaempferol. FLS from tea has been shown to metabolize dihydroquercetin to quercetin. In this study, we conducted studying on the relationship between quercetin content and the expression level of FLS in two traditional tea cultivars of Vietnam, TrungDuxanh and TrungDutim tea grown in tea garden of Thai Nguyen University of Agriculture and Forestry. Tea shoots with one apical bud and two to three young leaves using as research materials which collected in September 2017. The using of HPLC technique did not detect the quercetin content from the these tea samples. The preliminary results of quantification of FLS gene expression by real time PCR showed the expression level of FLS in green Trung Du tea is higher than purple Trung Du, although the difference is not great. Thus, at the time of collecting, the expression of FLS in green Trung Du and purple Trung Du can not synthesize quercetin but synthesize other flavonols.

Toxigenic and non-toxigenic patterns I, II and III and biofilm-forming ability in Bacteroides fragilis strains isolated from patients diagnosed with colorectal cancer

BackgroundEnterotoxigenic Bacteroides fragilis (ETBF) associated with the initiation and progression of colorectal cancer (CRC) has been alarmingly reported all over the world. In this study, simultaneous investigation of toxigenic and non-toxigenic patterns I, II and III and biofilm formation ability of Bacteroides fragilis isolated from patients with colorectal cancer was performed.MethodsThirty-one patients diagnosed with CRC and thirty-one control subjects were recruited in this study. Specimens were cultured on BBE and BBA culture media. Classical phenotypic identification tests and PCR was performed to verify Bacteroides fragilis presence. Also, biofilm-forming ability and expression of bft gene were assessed under biofilm and planktonic forms.ResultsA total of 68 B.fragilis was isolated from all colorectal tissue, of which 13 isolates (19.1%) (11 isolates from CRC and 2 from normal tissue) were positive for bft gene. The abundance patterns of I, II and III were as follow in descending order; pattern I > pattern III > pattern II in CRC subjects and pattern II > pattern III > pattern I in normal tissues. Also, pattern I showed higher biofilm formation ability compared to other patterns. Toxin expression was significantly reduced in biofilm form comparing with planktonic form.ConclusionsBased on our findings, there was a difference between the abundance of patterns I, II, and III and biofilm formation in isolates obtained from CRC and normal tissues. Biofilm formation ability and toxin encoding gene (bft) are two main virulence factors in B. fragilis pathogenicity which require more investigation to treat B. fragilis infections effectively.

Streptolysin Encoding Genes sagC and sagD as Biomarkers of Fish Pathogen Streptococcus iniae: An In Silico Study

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

SAR Images Change Detection Based on Self-Adaptive Network Architecture

In the last few years, neural networks were introduced to change detection for a better understanding of remote sensing images. However, the designs of these neural networks were time-consuming processes of trial and error, which failed to account for their validity. Thus, a simple and efficient change detection method based on network architecture search in terms of the evolutionary algorithm is proposed to deal with SAR images change detection problems. In the proposed method, an efficient gene encoding is applied to represent the unpredictable optimal depth and the number of neurons in each hidden layer. Besides, a combinatorial evaluation strategy and a self-adaptive network solution selection are designed for effective and reasonable network architectures. What is more, a hidden layer random alignment crossover operator and a drawing lots mutation operator are designed for the enhancement of diversity of network architectures. Experimental results on a few SAR image data sets demonstrate that the proposed method can generate appropriate networks to solving SAR images change detection.

Cloning and sequence analysis of leptin receptor overlapping transcript-like 1 gene from Dermatophagoides farinae

To obtain the leptin receptor overlapping transcript-like 1 encoding gene (LepROTL1 gene) from Dermatophagoides farina, investigate the molecular characteristics of the gene and construct a prokaryotic expression vector to express this gene. The LepROTL1 gene-encoding sequence fragments were captured based on the transcriptome sequencing results, and the full-length gene fragments were amplified from total RNA of D. farinae using a RT-PCR assay, and used to construct the expression plasmid pET28a(+)-LepROTL1, followed by sequencing. The plasmid was transformed into E. coli BL21 (DE3) T1R for the induction of IPTG expression. The expression product was characterized by SDS-PAGE and Western blotting. Bioinformatics analyses were performed to analyze the sequence and the molecular characteristics of its encoded protein. The amplification products of the RT-PCR assay showed a clear band on agarose gel electrophoresis, and sequencing analysis of the pET28a(+)-LepROTL1 plasmid showed 417 bp in length of the coding gene from the start codon ATG to the termination codon TAA. Following the plasmid transformation into E. coli and induction with IPTG, a specific band was seen on SDS-PAGE, indicating successful expression. Bioinformatics analysis showed that the LepROTL1 gene-encoded protein was composed of 134 amino acids, and had a relative molecular weight of 14 378.13 Da, a hydrophilicity index of 1.149, and certain hydrophobicity. The secondary structure was composed of alpha-helix (19 aa, 14.18%), extended strand (48 aa, 35.82%) and random coil (67 aa, 50.00%). The deduced amino acid sequence was used to obtain homologous genes by BLAST, and the phylogenetic tree showed that D. farinae was clustered with D. pteronyssinus. The full-length sequences and expression plasmid of the LepROTL1 gene are obtained, and the molecular features of the gene are demonstrated using bioinformatics analyses, which provide insights into further studies on the gene.

Genetic basis of sleep bruxism and sleep apnea\u2014response to a medical puzzle

Sleep bruxism (SB) and obstructive sleep apnea (OSA) are co-occurring sleep conditions. The study aimed to evaluate the association of selected single-nucleotide polymorphisms (SNPs) occurring within the genes of the serotonin and dopamine pathways in SB and OSA and investigate the relationship between them. The study group included 100 Caucasian patients. SB and OSA were diagnosed in 74 and 28 patients, respectively. In addition, 125 unrelated Caucasian healthy blood donors served as randomly selected controls to enable comparison of polymorphisms. The following SNPs were analyzed: rs2770304 and rs6313 within the serotonin receptor encoding gene (HTR2A), rs4680 polymorphism of the catechol-O-methyltransferase (COMT) gene, and rs686 within the dopamine receptor (DRD1) encoding gene. The prevalence of the DRD1 rs686 G variant (GG homozygosity) was found to be high in the study group compared to the control group. Bruxism episode index (BEI) was found to be significantly increased in the HTR2A rs6313 TT homozygotes compared to the heterozygous patients. Moreover, within a group of the HTR2A rs2770304 TT homozygous cases, a statistically significant correlation was observed between BEI and apnea–hypopnea index. These results indicate that DRD1 rs686 may potentially affect predisposition to SB, that HTR2A rs6313 SNP may be involved in SB pathogenesis, and that HTR2A rs2770304 polymorphism might contribute to the association between SB and OSA. This suggests a possible genetic contribution to the etiology of primary SB.

Prevalence, Genetic Diversity, and Temporary Shifts of Inducible Clindamycin Resistance Staphylococcus aureus Clones in Tehran, Iran: A Molecular-Epidemiological Analysis From 2013 to 2018.

The prevalence of Staphylococcus aureus as an aggressive pathogen resistant to multiple antibiotics causing nosocomial and community-acquired infections is increasing with limited therapeutic options. Macrolide-lincosamide streptogramin B (MLSB) family of antibiotics represents an important alternative therapy for staphylococcal infections. This study was conducted over a period of five years from August 2013 to July 2018 to investigate the prevalence and molecular epidemiology in Iran of inducible resistance in S. aureus. In the current study, 126 inducible methicillin-resistant S. aureus (MRSA) (n = 106) and methicillin-sensitive S. aureus (MSSA) (n = 20) isolates were characterized by in vitro susceptibility analysis, resistance and virulence encoding gene distribution, phenotypic and genotypic analysis of biofilm formation, prophage typing, S. aureus protein A locus (spa) typing, staphylocoagulase (SC) typing, staphylococcal cassette chromosome mec (SCCmec) typing, and multilocus sequence typing. Of the 126 isolates, 76 (60.3%) were classified as hospital onset, and 50 (39.7%) were classified as community onset (CO). Biofilm formation was observed in 97 strains (77%). A total of 14 sequence types (STs), 26 spa types, 7 coagulase types, 9 prophage types, 3 agr types (no agr IV), and 9 clonal complexes (CCs) were identified in this study. The prevalence of the inducible MLSB (iMLSB) S. aureus increased from 7.5% (25/335) to 21.7% (38/175) during the study period. The iMLSB MRSA isolates were distributed in nine CCs, whereas the MSSA isolates were less diverse, which mainly belonged to CC22 (7.95%) and CC30 (7.95%). High-level mupirocin-resistant strains belonged to ST85-SCCmec IV/t008 (n = 4), ST5-SCCmec IV/t002 (n = 4), ST239-SCCmec III/t631 (n = 2), and ST8-SCCmec IV/t064 (n = 2) clones, whereas low-level mupirocin-resistant strains belonged to ST15-SCCmec IV/t084 (n = 5), ST239-SCCmec III/t860 (n = 3), and ST22-SCCmec IV/t790 (n = 3) clones. All the fusidic acid–resistant iMLSB isolates were MRSA and belonged to ST15-SCCmec IV/t084 (n = 2), ST239-SCCmec III/t030 (n = 2), ST1-SCCmec V/t6811 (n = 1), ST80-SCCmec IV/t044 (n = 1), and ST59-SCCmec IV/t437 (n = 1). The CC22 that was predominant in 2013–2014 (36% of the isolates) had almost disappeared in 2017–2018, being replaced by the CC8, which represented 39.5% of the 2017–2018 isolates. This is the first description of temporal shifts of iMLSB S. aureus isolates in Iran that identifies predominant clones and treatment options for iMLSB S. aureus–related infections.

A New SNP in Rice Gene Encoding Pyruvate Phosphate Dikinase (PPDK) Associated with Floury Endosperm.

Rice varieties with suitable flour-making qualities are required to promote the rice processed-food industry and to boost rice consumption. A rice mutation, Namil(SA)-flo1, produces grains with floury endosperm. Overall, grains with low grain hardness, low starch damage, and fine particle size are more suitable for use in flour processing grains with waxy, dull endosperm with normal grain hardness and a high amylose content. In this study, fine mapping found a C to T single nucleotide polymorphism (SNP) in exon 2 of the gene encoding cytosolic pyruvate phosphate dikinase (cyOsPPDK). The SNP resulted in a change of serine to phenylalanine acid at amino acid position 101. The gene was named FLOURY ENDOSPERM 4-5 (FLO4-5). Co-segregation analysis with the developed cleaved amplified polymorphic sequence (CAPS) markers revealed co-segregation between the floury phenotype and the flo4-5. This CAPS marker could be applied directly for marker-assisted selection. Real-time RT-PCR experiments revealed that PPDK was expressed at considerably higher levels in the flo4-5 mutant than in the wild type during the grain filling stage. Plastid ADP-glucose pyrophosphorylase small subunit (AGPS2a and AGPS2b) and soluble starch synthase (SSIIb and SSIIc) also exhibited enhanced expression in the flo4-5 mutant.

The Roles of Siglec7 and Siglec9 on Natural Killer Cells in Virus Infection and Tumour Progression.

The function of natural killer (NK) cells, defending against virus infection and tumour progression, is regulated by multiple activating and inhibiting receptors expressed on NK cells, among which sialic acid-bind immunoglobulin-like lectins (Siglecs) act as a vital inhibitory group. Previous studies have shown that Siglec7 and Siglec9 are expressed on NK cells, which negatively regulate the function of NK cells and modulate the immune response through the interaction of sialic acid-containing ligands. Siglec7 and Siglec9 are very similar in distribution, gene encoding, protein sequences, ligand affinity, and functions in regulating the immune system against virus and cancers, but differences still exist between them. In this review, we aim to discuss the similarities and differences between Siglec7 and Siglec9 and analyze their functions in virus infection and tumour progression in order to develop better anti-viral and anti-tumor immunotherapy in the future.

A WD40 Protein Encoding Gene Fvcpc2 Positively Regulates Mushroom Development and Yield in Flammulina velutipes.

Ascomycota and Basidiomycota are two closely related phyla and fungi in two phyla share some common morphological developmental process during fruiting body formation. In Neurospora crassa, the Gβ-like protein CPC-2 with a seven-WD40 repeat domain was previously reported. By transforming CPC-2 ortholog encoding genes, from 7 different fungal species across Ascomycota and Basidiomycota, into the cpc-2 deletion mutant of N. crassa, we demonstrate that all tested CPC-2 ortholog genes were able to complement the defects of the cpc-2 deletion mutant in sexual development, indicating that CPC-2 proteins from Ascomycota and Basidiomycota have the similar cellular function. Using Flammulina velutipes as a model system for mushroom species, the CPC-2 ortholog FvCPC2 was characterized. Fvcpc2 increased transcription during fruiting body development. Knockdown of Fvcpc2 by RNAi completely impaired fruiting body formation. In three Fvcpc2 knockdown mutants, transcriptional levels of genes encoding adenylate cyclase and protein kinase A catalytic subunit were significantly lower and colony growth became slower than wild type. The addition of cAMP or the PKA-activator 8-Bromo-cAMP into the medium restored the Fvcpc2 knockdown mutants to the wild-type colony growth phenotype, suggesting that the involvement of cAMP production in the regulatory mechanisms of FvCPC2. Knockdown of Fvcpc2 also weakened transcriptional responses to sexual development induction by some genes related to fruiting body development, including 4 jacalin-related lectin encoding genes, 4 hydrophobin encoding genes, and 3 functionally-unknown genes, suggesting the participation of these genes in the mechanisms by which FvCPC2 regulates fruiting body development. All three Fvcpc2 overexpression strains displayed increased mushroom yield and shortened cultivation time compared to wild type, suggesting that Fvcpc2 can be a promising reference gene for Winter Mushroom breeding. Since the orthologs of FvCPC2 were highly conserved and specifically expressed during fruiting body development in different edible mushrooms, genes encoding FvCPC2 orthologs in other mushroom species also have potential application in breeding.

Compost Amendments Based on Vinegar Residue Promote Tomato Growth and Suppress Bacterial Wilt Caused by Ralstonia Solanacearum.

Tomato bacterial wilt caused by Ralstonia solanacearum (RS) is one of the most devastating soil-borne diseases, and compost is to be considered as a resource-saving and environment-friendly measure to control the disease. Herein, a pot experiment was implemented to explore the effects of vinegar residue matrix amendments on the growth performances of tomato seedlings and to examine the suppression ability against bacterial wilt under vinegar residue substrate (VRS), and peat substrate (Peat) with RS inoculation. The results revealed that VRS effectively suppressed the disease incidence of bacterial wilt, increased the number of bacteria and actinomycetes, decreased fungi populations, promoted soil microbial populations and microbial activities, enhanced the growths of tomato seedlings, and modulated defense mechanism. In addition, VRS efficiently inhibited the oxidative damage in RS inoculated leaves via the regulation of excess reactive oxide species (O2•− and H2O2) production, lessening of malondialdehyde (MDA) content, and causing less membrane injury; resulting in enhancements of antioxidants enzymes activities accompanying with modulating their encoding gene expression. The transcription levels of NPR1, PIN2, PR1b, ACO1, EDS1, PR1B, MAPK3, PIN2, and RRS1 were also modulated with the pathogens inoculated in tomato leaves both in VRS and Peat treatments, which indicated that systemic-acquired resistance possesses cross-talk between salicylic acid, jasmonic acid, and the ethylene-dependent signaling pathway. Besides, the RS inoculation significantly inhibited the growth of tomato seedlings, and all growth indices of plants grown in VRS were considerably higher than those produced in Peat. Taken together, VRS represents a new strategy to control tomato bacterial wilt through boosting the soil microbial populations and microbial activities. Furthermore, VRS promotes the plant immune response to provide a better growth environment for plants surviving in disease conditions.

Root transcriptome profiling of contrasting wheat genotypes provides an insight to their adaptive strategies to water deficit

Water deficit limits plant growth and productivity in wheat. The effect of water deficit varies considerably in the contrasting genotypes. This study attempted comparative transcriptome profiling of the tolerant (Abura) and susceptible (AUS12671) genotypes under PEG-simulated water stress via genome-wide RNA-seq technology to understand the dynamics of tolerance mechanism. Morphological and physiological analyses indicated that the tolerant genotype Abura had a higher root growth and net photosynthesis, which accounted for its higher root biomass than AUS12671 under stress. Transcriptomic analysis revealed a total of 924 differentially expressed genes (DEGs) that were unique in the contrasting genotypes under stress across time points. The susceptible genotype AUS12671 had slightly more abundant DEGs (505) than the tolerant genotype Abura (419). Gene ontology enrichment and pathway analyses of these DEGs suggested that the two genotypes differed significantly in terms of adaptive mechanism. Predominant upregulation of genes involved in various metabolic pathways was the key adaptive feature of the susceptive genotype AUS12671 indicating its energy-consuming approach in adaptation to water deficit. In contrast, downregulation the expression of genes of key pathways, such as global and overview maps, carbohydrate metabolism, and genetic information processing was the main strategy for the tolerant genotype Abura. Besides, significantly higher number of genes encoding transcription factors (TF) families like MYB and NAC, which were reported to be associated with stress defense, were differentially expressed in the tolerant genotype Abura. Gene encoding transcription factors TIFY were only differentially expressed between stressed and non-stressed conditions in the sensitive genotype. The identified DEGs and the suggested differential adaptive strategies of the contrasting genotypes provided an insight for improving water deficit tolerance in wheat.

Dual immunological and oxidative responses in Oreochromis niloticus fish exposed to lambda cyhalothrin and concurrently fed with Thyme powder (Thymus vulgaris L.): Stress and immune encoding gene expression

The present study was performed to explore the immunotoxicological effects of the lambda cyhalothrin (LCH) insecticide and evaluate the efficiency of Thyme powder (TP) as a fish supplement in attenuation of LCH impact on Oreochromis niloticus (O. niloticus) fish. Fish was sampled following 30-days exposure to LCH (1/6 LC50: 0.48 μg/L) and TP (2%) supplementation, individually or in combination. The growth performance, immune status, biochemical indices, and mRNA expression pattern changes of stress and immune-encoding genes in the liver and spleen tissues, respectively, through real-time polymerase chain reaction (RT-PCR) analysis, were evaluated. The findings showed that LCH exposure caused a significant lowering in most of the estimated variables including growth performance, hematological and immunological indices. Moreover, LCH disrupted the oxidant/antioxidant status and dysregulated the expression of stress and immune-related genes, downregulating the mRNA transcript level of Immunoglobulin M heavy chain (IgM), Interferon (IFN-γ), CXC-chemokine, and Toll-like receptors (TLR-7) in the spleen. However, mRNA expression of Myxovirus resistance (Mx) gene remained unaffected. In liver tissue, the heat shock protein (HSP-70) expression was upregulated, while that of cytochrome P450 1A (CYP 1A) was downregulated. TP (2%) supplementation elicited a significant modulation in aforementioned indices; however, their levels did not attain that of the control values. Our findings concluded that LCH affects the O. niloticus immune response through the negative transcriptional influence on genes linked to immunity and induction of oxidative injury of the immune organs. Besides, dietary TP (2%) could be a proper candidate to modulate the compromised immunity in response to LCH exposure in O. niloticus aquaculture.

Inclusion of dietary Ulva ohnoi 5% modulates Solea senegalensis immune response during Photobacterium damselae subsp. piscicida infection

Macroalgae represent valuable sources of functional ingredients for fish diets, and the influence of supplemented aquafeeds on growth performance has been studied for some fish and seaweed species. In the present work, the potential immunomodulation exerted by U. ohnoi (5%) as dietary ingredient was investigated in Senegalese sole. After feeding with the experimental diets for 90 d, fish immune response before and after challenge with Photobacterium damselae subsp. piscicida (Phdp) was assessed. In absence of infection, systemic immune response was not modified by 5% U. ohnoi dietary inclusion for 90 d. Thus, no differences in liver and head kidney immune gene transcription or serum lysozyme, peroxidase, antiprotease and complement activities were observed based on the diet received by Senegalese sole specimens. Regarding mucosal immune parameters, no changes in gene transcription were detected in the skin and gills, whilst only tnf, cd4 and cd8 were significantly up-regulated in the intestine of fish fed with U. ohnoi, compared to the values obtained with control diet. On the contrary, when S. senegalensis specimens were challenged with Phdp, modulation of the immune response consisting in increased transcription of genes encoding complement (c1q4, c3, c9), lysozyme g (lysg), tumor necrosis factor alpha (tnfα) as well as those involved in the antioxidant response (gpx, sodmn) and iron metabolism (ferrm, hamp-1) was observed in the liver of fish fed with U. ohnoi. In parallel, decreased inflammatory cytokine and complement encoding gene transcription was displayed by the spleen of fish receiving the algal diet. Though mortality rates due to Phdp challenge were not affected by the diet received, lower pathogen loads were detected in the liver of soles receiving U. ohnoi diet. Further research to investigate the effects of higher inclusion levels of this seaweed in fish diets, feeding during short periods as wells as to assess the response against other pathogens needs to be carried out.