Individual Egg Research Articles

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Simultaneous resistance to multiple anthelmintic classes in nematode parasites of cattle in New Zealand

Resistance to the benzimidazole and macrocyclic lactone anthelmintics is widespread in Cooperia spp. on cattle farms in New Zealand. Since this was first documented in 2006 little has changed in cattle farming systems except for the widespread use of levamisole to control Cooperia spp. in young cattle (i.e., parasite control has maintained an almost total reliance on use of anthelmintics). Here we report the emergence of simultaneous resistance to the benzimidazole, macrocyclic lactone and levamisole anthelmintics in Cooperia spp. and in Ostertagia spp. Anthelmintic efficacy against nematode parasites of cattle was investigated on four commercial farms following reports of poor animal growth rates and welfare, and positive faecal egg counts, despite routine treatment with combination anthelmintics, which included levamisole. Faecal egg count reduction tests involved 15 animals per treatment group, individual egg counts (paired samples) conducted pre- and post-treatment, with eggs counted to ≤ 15 eggs per g faeces and larval cultures for morphological identification. Actives tested varied between farms but always included levamisole alone and several combination products containing levamisole. Of the 20 tests conducted (i.e., 5 products on each of 4 farms) only 3 exceeded 90% efficacy against Cooperia spp. even though 8 of the products tested were combinations containing levamisole and at least one other broad-spectrum anthelmintic. Levamisole used alone achieved efficacies between 44% and 71% against Cooperia spp. across the four trials. The only product to exceed 95% efficacy against Cooperia spp. was a combination of monepantel + abamectin which was 100% effective against all parasites. Resistance to oxfendazole in Ostertagia spp. was indicated on 3 farms, while on one farm efficacy of all the tested products was ≤75% against this parasite. All the farms involved in this study were farming intensive cattle operations with an almost total reliance on anthelmintics to control parasitism. The results clearly demonstrate the emergence of simultaneous resistance to oxfendazole, levamisole and the macrocyclic lactone anthelmintics. Despite years of advice and recommendations to change farming practices away from intensive monocultures, many farmers have continued with the practice, and some are now faced with the very real possibility of being unable to control cattle parasites on their farms.

Basophil activation test with progressively less heated forms of egg distinguishes egg allergic from tolerant children.

Diagnosis of egg allergy through basophil activation testing (BAT) has been mainly performed with an egg white extract or individual egg allergens rather than clinically more representative whole-egg extracts. Impact of heating on whole-egg extract allergenicity remains unassessed.Validating BAT with gradually less heated whole-egg extracts in egg allergy diagnosis and as tolerance marker. CD63-based BAT was performed with five progressively less heated extracts from cake, hard-boiled egg, omelet, soft-boiled, and raw egg in 10 egg allergic (EA), 10 complete egg tolerant (ET) and 12 non-egg-sensitized non-allergic (NEA) children. Cutoffs and diagnostic accuracy measures were established through ROC analysis. Changes in basophil response were assessed in 12 baked egg tolerant children undergoing an 8-month gradual egg reintroduction protocol with BAT and oral food challenges prior to each reintroduction step. Basophil responses to all egg extracts were increased in EA, but not in ET and NEA children. Responses decreased progressively with more heated egg extracts. Compared to ET children, EA children showed higher basophil sensitivity for all egg extracts. Negative BAT responses predicted clinical tolerance with a 90-100% sensitivity, 100% specificity, and false positive rate of 2.78%. In comparison, egg sIgE's (<0.35 kUA/L) had a lower specificity of 50-78% with a false positive rate of 40%. Basophil reactivity and sensitivity tended to decrease in baked egg tolerant children undergoing gradual egg reintroduction, concurrent with tolerance development. BAT with progressively less heated egg preparations is a sensitive and highly specific tool to discriminate EA from ET children.

The British Ixworth: individual growth and egg production of a purebred dual-purpose chicken

ABSTRACT 1. Killing male one-day-old chicks, especially from layer lines, is banned in some European countries. Therefore, dual-purpose chickens, where each sex is used for meat and egg production, respectively, offer an alternative production solution. This study evaluated the British purebred breed Ixworth as a dual-purpose chicken for meat and egg production. 2. Ixworth chicks (n = 167) were hatched and reared mixed-sex in a floor housing system, with two groups receiving a commercial pullet diet (treatment 1) and two groups receiving a diet composed for males of layer lines (treatment 2). Individual chick performance data were recorded. Males were slaughtered at 12 weeks of age, and their growth rate and carcase variables were analysed. All hens were continuously reared on the pullet diet and kept in a free-range system from 20 weeks old for one laying period (52 weeks). In addition, group-based feed consumption and mortality were recorded. 3. Cockerels in treatment 1 and 2 showed significantly different [T(88) = −2.846, P = 0.003] growth rates (25.3 vs. 27.4 g/day) and average final weights (2166 g vs. 2344 g). The hens in treatment 1 (n = 41) laid an average of 193 eggs per hen housed (mean egg weight: 56.9 g), whereas those in treatment 2 (n = 35) laid 195 eggs per hen housed (mean egg weight: 56.5 g). Nest acceptance was >97.5% and feed consumption was up to 140 g/bird/day. 4. The results showed that the Ixworth may be a suitable breed for dual-purpose use and could be improved through selective breeding, offering potential for preservation of this local breed as well as general biodiversity in poultry farming.

Evidence for direct oviposition into substrates by the New Zealand stick insect Spinotectarchus acornutus

ABSTRACT Stick insects (Phasmatodea) have many different oviposition strategies, reflecting a range of adaptive behaviours and morphologies to best place and secure eggs in their environments. Oviposition strategies in Aotearoa New Zealand phasmids are not well documented, but the literature so far suggests that they drop individual eggs to the ground from their position in the foliage. Here, we present evidence for an oviposition strategy unique among the Rō stick insects of Aotearoa New Zealand. Individual female Spinotectarchus acornutus were observed inserting their eggs in a range of substrates, in particular the bark of trees and in spaces within the textured surfaces of tree fern trunks. We also highlight how the specific morphology of their eggs may be an adaptation to assist in substrate attachment, while their elongated secondary ovipositor could aid in egg insertion into substrates.

Direct Analysis of Micro-biopsy Samples by Polarity Gradient Focusing Dip-and-Go Mass Spectrometry.

Direct analysis of micro-biopsy samples by mass spectrometry at single-cell level still faces major challenges. In this work, we developed a polarity gradient focusing dip-and-go strategy (PGF-Dip&Go) during induced electrospray ionization mass spectrometry (iESI-MS) analysis for real-time enrichment and spatial separation of compounds such as lipids, alkaloids, fatty amines, and drugs. Compared with direct iESI-MS analysis, enrichment of analytes (enrichment factor of 5.0-100.0) and spatial separation between different analytes were achieved. Owing to the enrichment effect and salt cleanup effect, the sensitivity of PGF-Dip&Go has been improved by 25-10,000 times compared with direct iESI-MS. PGF-Dip&Go has been successfully applied for the analysis of lipids in a 200 pL micro-biopsy section from an individual fish egg. Lysophosphatidylcholine (LPC), phosphatidylcholine (PC), and triglyceride (TG) were significantly enriched and separated according to their polarity differences, proving the potential of PGF-Dip&Go to be a noninvasive and powerful analytical tool for in situ analysis of complex small volumes in the future.

Standard- and large-sized eggs of Trichuris trichiura in the feces of schoolchildren in the Yangon Region, Myanmar: Morphological and molecular analyses.

Standard- and large-sized eggs of Trichuris trichiura were found in the feces of schoolchildren in Yangon, Myanmar during epidemiological surveys and mass deworming with albendazole in 2017-2019. The standard-sized eggs were identified as those of T. trichiura, but it was necessary to exclude the possibility of the large-sized eggs belonging to Trichuris vulpis, a dog whipworm. We conducted morphological and molecular studies to determine the species of the 2 types of Trichuris eggs. Individual eggs of both sizes were isolated from Kato-Katz fecal smears (n=20) and mechanically destroyed using a 23G injection needle. Nuclear DNA was extracted, and the 18S rRNA region was sequenced in 15 standard-sized eggs and 15 large-sized eggs. The average size of standard-sized eggs (T. trichiura) was 55.2×26.1 μm (range: 51.7-57.6×21.3-28.0 μm; n=97), whereas the size of large-sized eggs was 69.3×32.0 μm (range: 65.1-76.4×30.1-34.5 μm; n=20), slightly smaller than the known size of T. vulpis. Regarding standard-sized eggs, the 18S rRNA nucleotide sequences exhibited 100% homology with T. trichiura deposited in GenBank and 88.6-90.5% homology with T. vulpis. Regarding large-sized eggs, the nucleotide sequences showed 99.8-100% homology with T. trichiura in GenBank and 89.6-90.7% homology with T. vulpis. Both standard- and large-sized eggs of Trichuris spp. found in Myanmar schoolchildren during 2017-2019 were morphologically and molecularly confirmed to belong to T. trichiura. The conversion of eggs from smaller to large sizes might be due to anthelmintic treatments with albendazole.

Efficacy of a fixed-dose combination injectable (0.2 mg/kg doramectin + 6.0 mg/kg levamisole hydrochloride) in New Zealand cattle against naturally acquired gastrointestinal nematode populations with demonstrated resistance to doramectin

Intensive farming practices and heavy reliance on anthelmintics have contributed significantly to the problem of macrocyclic lactone (ML) resistance in New Zealand. Farmers now have few options for effectively controlling cattle gastrointestinal nematodes (GINs) and regularly experience sub-optimal efficacy against economically important species. We present a novel fixed-dose combination injectable (FDCI) that simultaneously delivers 0.2 mg/kg doramectin and 6 mg/kg levamisole hydrochloride (HCl) to target a broad spectrum of cattle GINs in a single dose, providing an additional solution to endoparasite control in an environment of anthelmintic resistance. A dose confirmation study was conducted using naturally acquired infections of GINs in beef cattle in New Zealand. Cattle with GIN infections confirmed by fecal egg count (FEC) were randomly allocated (n = 12 per group) to the control (saline-treated), FDCI-treated or doramectin-treated group. On Day 0, cattle were weighed and administered a single subcutaneous injection of saline or endectocide. Rectal fecal samples were collected from each animal on Day 7 for individual duplicate fecal egg count (FEC) analysis, and coprocultures were conducted on pooled fecal samples within each treatment group. All animals were euthanized and necropsied for worm recovery on Days 14 through 16. Treatment efficacy was calculated based on reduction in FECs and worm burdens. All enrolled cattle were positive for GINs based on Day −5 FECs, with geometric mean (GM) FECs ranging from 337 to 521 eggs per gram (EPG). All saline-treated cattle remained positive for GIN infections for the study duration (Day 7 GM FEC = 427 EPG). Necropsy and worm recoveries revealed the presence of doramectin-resistant Cooperia oncophora, C. surnabada and Trichostrongylus longispicularis, as evidenced by ≤ 72.3 % efficacy of doramectin against these species. The new FDCI was ≥ 99.8 % effective against all GIN species, including ML-resistant C. oncophora, C. surnabada and T. longispicularis, providing broad-spectrum efficacy and eliminating economically important cattle GINs, including ML-resistant populations.

A case study assessing the impact of mating frequency on the reproductive performance of the Hawaiian bobtail squid Euprymna scolopes

BackgroundThe symbiosis between the Hawaiian bobtail squid Euprymna scolopes and bacterium Vibrio fischeri serves as a model for investigating the molecular mechanisms that promote the initial formation of animal-bacterial symbioses. Research with this system frequently depends on freshly hatched E. scolopes, but the husbandry factors that promote hatchling production in a mariculture facility remain underreported. Here we report on the reproductive performance of E. scolopes in response to decreased mating frequency.ResultsOne animal cohort was maintained in a mariculture facility for 107 days, with females assigned to either a control group (mating once every 14 days) or an experimental group (mating once every 21 days). No differences between the groups were observed in survival, the number of egg clutches laid, or hatchling counts. Each group featured multiple females that were hyper-reproductive, i.e., they generated more than 8 egg clutches while in captivity. Examination of the distributions for daily hatchling counts of individual egg clutches revealed significant variation in the hatching patterns among clutches that was independent of mating frequency. Finally, an assessment of hatchling production showed that 93.5% of total hatchlings produced by the cohort were derived from egg clutches laid within the first 70 days.ConclusionsThese results suggest a lower mating frequency does not impede hatchling production. Furthermore, the variation in hatchling production among egg clutches provides new insight into the reproductive performance of E. scolopes as a lab animal for microbiology research.

Effects of energy restriction during growing phase on the productive performance of Hyline Brown laying hens aged 6 to 72 wk

The aim of this study was to assess the effects of energy-restricted feeding during growing phase on the productive performance of Hyline Brown laying hens aged 6 to 72 wk. A total of 720 six-week-old layer chicks were allocated equally to 3 groups with 6 replicates of 40 pullets each, and were fed 1 of 3 diets that were nutritionally similar except for the apparent metabolizable energy corrected for nitrogen (AMEn) content. At the age of 6 to 17 wk, the pullets in the control group were given diet with 2,850 kcal/kg AMEn, and were fed ad libitum. The levels of AMEn in diet of pullets in the experimental groups were 90% (2,565 [2,850×90%] kcal/kg) and 80% (2,280 [2,850×80%] kcal/kg) of that in control group, and the daily amount of feed was restricted to the absolute quantity of the diet consumed by pullets in control group. At the age of 18 to 72 wk, all the hens were fed with the same diets ad libitum. As energy restriction increased in the growing phase, body weight (BW) dropped at the ages of 12 and 15 to 23 wk (at 23 wk: P=0.001; at other ages: P < 0.001), but it showed no significant difference at 24 wk (P=0.071). At 20 wk, restricting energy induced a delay in the development of sexual organs, including the ovary stroma, oviduct, and small yellow follicle (P < 0.05), as well as a delay in sexual maturity (P < 0.05). Consequently, the laying rate in the first and second periods dropped linearly (P=0.046, 0.030, and 0.038, P < 0.001, respectively). The coefficient of variation (CV) in the BW at 19, 20, and 21 wk (P=0.040, 0.023, and 0.042, respectively), the CV of age at first egg (P < 0.001), and CV of individual egg number at age 18 to 72 wk (P < 0.001) decreased linearly. There was a linear increase in the laying rate of hens in the later periods (at age 32-72 wk, P < 0.05), as well as in the average total egg number per hen and average laying rate at the age of 18 to 72 wk (P=0.006). The average egg mass also showed a linear increase with increasing levels of energy restriction (P < 0.001). In summary, although appropriate energy restriction during growing phase delayed sexual maturity and sexual organ development in early-laying Hyline Brown pullets, it improved uniformity of BW, age at first egg laying, and individual egg number, and increased egg number per hen, laying rate, average egg mass, and number of settable eggs from 18 to 72 wk of age.

Research Note: Genetic parameters for egg production and clutch-related traits in indigenous Beijing-You chickens

Egg products from indigenous chickens have growing market shares as consumers are pursuing differentiation in egg consumption. The genetic improvement in egg production performance of those breeds is crucial for increasing the economic profit. This study aimed to estimate genetic parameters for egg production and clutch-related traits in indigenous Beijing-You chickens for understanding the genetic architecture and exploring proper biological traits for selection. Data on traits including age at first egg (AFE), egg number (EN), average clutch length (ACL), maximum clutch length (MCL), number of clutches (NC) and pauses (NP), and average pause length (APL) were collected from 4 generations of purebred Beijing-You chickens based on the 43-wk and 66-wk of individual egg production record. The heritabilities, genetic and phenotypic correlations were analyzed by the DMU software with the restricted maximum likelihood method in a multivariate animal model. The results showed that the AFE of Beijing-You chickens was 174.45 d of age, and its heritability was as high as 0.62. The heritability was 0.26 for EN43 and 0.18 for EN66. The clutch traits including ACL, MCL, NC, and NP were moderate to high heritable (h2=0.15-0.39), but APL was very low heritable (h2=0.05). Genetic correlations were high between AFE and EN (rG(AFE, EN43)=-0.79, rG(AFE, EN66)=-0.39), whereas low between AFE and ACL (rG(AFE, ACL43)=-0.08, rG(AFE, ACL66)=0.01) and MCL (rG(AFE, MCL)=-0.07). EN had higher correlations with ACL (rG(EN43, ACL43)=0.59, rG(EN66, ACL66)=0.40) than that with MCL (rG(EN43, MCL43)=0.56, rG(EN66, MCL66)=0.32). The heritability for ACL43 (h2=0.38) was higher than that for MCL43 (h2=0.33). ACL43 had a positive correlation with EN66 (rG(ACL43, EN66)=0.62). These results indicated that the egg production of whole laying period could be improved by early selection for AFE and ACL at the same time in Beijing-You chickens.

Effects of Commercial Sunscreens on Survival, Reproduction and Embryonic Development of the Aquatic Snail Biomphalaria glabrata (SAY, 1818).

Over the past few years, there has been a significant increase in the use of sunscreens. Consequently, the occurrence in aquatic environments of ultraviolet filters has also increased. The present study aims to evaluate the toxicity of two commercial sunscreens to the aquatic snail Biomphalaria glabrata. Acute assays were performed with adult snails exposed to solutions of the two products in synthetic soft water. Reproduction and development assays were carried out, involving individual adult and egg masses exposure to assess fertility and embryonic development. Sunscreen A showed a LC50-96h of 6.8g/L and reduction in number of eggs and egg masses per individual in the concentration of 0.3g/L. Sunscreen B presented higher malformation rates in 0.4g/L with 63% of malformed embryos. Results indicate that the formulation used in sunscreens is an important factor in aquatic toxicity and needs to be evaluated before the final product is commercialized.

Long‐term series of measurements of eggs and chicks of Caspian terns (Hydroprogne caspia) breeding in Lake Chany, Western Siberia, Russia, during 1985 and 2011

AbstractCaspian terns (Hydroprogne caspia Pallas, 1770) present a sub‐cosmopolitan but scattered distribution, and many of its colonies are in a vulnerable state. The species has been listed in the Red Data Book of the Russian Federation and is covered by the Agreement on the Conservation of African‐Eurasian Migratory Waterbirds. We observed the colonies of Caspian terns repeatedly in the breeding season from May to June on the islands of Lake Chany from 1985 to 2011. We recorded clutch size, eggshell coloration and measured egg length and width to the nearest 0.1 mm with a caliper. Furthermore, we recorded the fate and hatching date of individual eggs and determined the clutch initiation date. Head, bill, tarsus length, and body weight of newly hatched chicks were measured. Caspian tern colony size changed between years from 50 nests in 1985 to 513 in 1999; therefore, the sample size of measured eggs varied from 90 to 1045. A total of 4137 eggs and 570 chicks were measured. We provide new information for this species nesting in west Siberia, which is important to compare with other local results. The presented data set is a novel long‐term data set on an isolated population of this species in center of Eurasian continent. The complete data set for this abstract published in the Data Article section of the journal is available in electronic format in MetaCat in JaLTER at http://db.cger.nies.go.jp/JaLTER/metacat/metacat/ERDP-2023-02.1/jalter-en.

Protected fish spawning aggregations as self-replenishing reservoirs for regional recovery.

Dispersal of eggs and larvae from spawning sites is critical to the population dynamics and conservation of marine fishes. For overfished species like critically endangered Nassau grouper (Epinephelus striatus), recovery depends on the fate of eggs spawned at the few remaining aggregation sites. Biophysical models can predict larval dispersal, yet these rely on assumed values of key parameters, such as diffusion and mortality rates, which have historically been difficult or impossible to estimate. We used in situ imaging to record three-dimensional positions of individual eggs and larvae in proximity to oceanographic drifters released into egg plumes from the largest known Nassau grouper spawning aggregation. We then estimated a diffusion-mortality model and applied it to previous years' drifter tracks to evaluate the possibility of retention versus export to nearby sites within 5 days of spawning. Results indicate that larvae were retained locally in 2011 and 2017, with 2011 recruitment being a substantial driver of population recovery on Little Cayman. Export to a nearby island with a depleted population occurred in 2016. After two decades of protection, the population appears to be self-replenishing but also capable of seeding recruitment in the region, supporting calls to incorporate spawning aggregation protections into fisheries management.

Residue depletion of toltrazuril and its metabolites in egg after an authorised application in hens

Toltrazuril is effective against all coccidial parasites in most animal species. Pharmacological studies showed that toltrazuril was well absorbed in the gastrointestinal tract and rapidly metabolised to toltrazuril sulfoxide and toltrazuril sulfone (ponazuril), the latter being considered as marker residue for toltrazuril residues. The maximum residue limits (MRLs) for toltrazuril sulfone in edible tissues from poultry range from 100 μg/kg in muscle to 600 μg/kg in liver. The substance is currently not allowed for use in poultry producing eggs for human consumption. However, several veterinary medicinal products containing the active substance are authorised in the European Union for use in pullets. According to product literature, withdrawal periods for edible tissues from chickens of 12 up to 18 days as well as restrictions for use before the onset of laying must be observed. Depending on the chicken breed, the start of the laying activity can vary between the 17th and 20th week of age. In monitoring programs, certain cases of residues in eggs were detected although zero tolerance was applicable at that time. The objective of the presented study was to evaluate the residue depletion profiles of toltrazuril and its major metabolites after the treatment of 15-week-old laying hens with an authorised toltrazuril-containing veterinary medicinal product. The pullets were treated on two consecutive days with TOLTRA-K (25 mg/ml) oral solution via drinking water at a dosage of 7 mg of toltrazuril per kg of body weight per day according to the recommended posology. Individual egg samples were collected after the beginning of the laying activity and were analysed in duplicate by LC-MS/MS to determine residues of toltrazuril and its metabolites. Residues of toltrazuril sulfone in egg samples were detected for several weeks and a statistical model was established to determine the time span needed to meet the zero tolerance.

Tyraminergic control of vitellogenin production and release in the blood-feeding insect, Rhodnius prolixus

In insects, the biogenic amine tyramine (TA) has been shown to control several physiological processes. Recently, the involvement of the type 1 tyramine receptor (TAR1) in reproductive processes has been demonstrated in different insects. Here, we investigate the putative role of Rhodnius prolixus TAR1 (RpTAR1) in reproduction in female R. prolixus. RpTAR1 transcript was highly expressed in tissues associated with egg development. Moreover, after a blood meal, which is the stimulus for full egg development, RpTAR1 transcript was upregulated in the ovaries and in the fat body. After RNAi-mediated RpTAR1 knockdown, an ovarian phenotype characterized by the absence or reduction of egg production was observed. Furthermore, protein and Vg accumulation in the fat body was observed, suggesting an impairment in protein release from the fat body into the hemolymph. However, even though fewer eggs were produced and laid, there was no difference in hatching ratio of those laid, in comparison to the controls, indicating that the overall low protein uptake by the ovaries did not influence the viability of individual eggs produced. Interestingly, the eggs from dsTAR1-treated insects appeared more red, indicating a higher content of RHBP compared to the control. A higher colocalization between Vg and Rab11, a marker for the recycling endosome pathway, was observed after dsTAR1 injection, suggesting that a more active lysosome degradation pathway in response to the Vg accumulation may occur. In addition to the Vg accumulation in the fat body, dsTAR1 treatment altered JH pathway. However, it remains to be elucidated whether this event is either directly related to the RpTAR1 downregulation or for a consequence to the Vg accumulation. Lastly, the RpTAR1 action on Vg synthesis and release in the fat body was monitored in the presence or absence of yohimbine, the antagonist of TAR1, in an ex-vivo experiment. Yohimbine antagonises the TAR1 stimulated release of Vg. These results provide critical information concerning the role of TAR1 in Vg synthesis and release in R. prolixus. Furthermore, this work opens the way for further investigation into innovative methods for controlling R. prolixus.

Shika kahverengi yumurtacı tavuklarda yumurta ağırlığı üzerine iç ve dış kalite özelliklerinin doğrudan ve dolaylı katkılarının Path Katsayısı Analizi kullanılarak belirlenmesi

Path analysis procedure is a statistical procedure that can be applied to evaluate direct and indirect contributions of independent variables to the dependent variables for better understanding of the relationships between egg quality traits. One hundred and twenty (120) eggs, collected from Shika Brown layers, were used to evaluate the direct and indirect effects of internal and external egg quality parameters on egg weight of Shika Brown layers using Path analysis procedure. Data obtained on individual egg include the following; egg weight (EWT), egg length (ELT), egg width (EWD), shell thickness (STK), shell weight (SWT), albumen weight (AWT) and yolk weight (YWT). Correlation coefficient results show that EWT had a positively significant correlation (P&amp;lt;0.05) with ELT (0.715), EWD (0.758), SWT (0.460) and AWT (0.785). ELT had the greatest direct effect (0.360; P&amp;lt;0.05) on EWT followed by EWD (0.345; P&amp;lt;0.05) while the least of the direct effects on EWT (0.012; P&amp;lt;0.05) was from STK. However, the highest total indirect effect (0.487) on EGW was realised largely via EWD. Therefore, EWT of Shika Brown layer strain had a high positive relationship with ELT, EWD and AWT. The path coefficient analysis revealed that ELT, along with EWD contributed highest direct effect on the EWT. This information could be used in selection programme for the improvement of EWT of Shika Brown layer chickens.

Do non-direct heterospecific cues of avian predator activity alter reproductive modes of a passerine bird?

Predators affect prey by killing them or inducing changes in their physiology and behaviour through a fear effect associated with predation risk. In birds, perceived predation risk influences reproductive decisions, such as the reduction of parental investment in offspring during both egg production and nestling rearing. Visual and vocal cues of predator presence have been widely used to test the direct effects of predation risk. However, few studies have examined the indirect cues of predator activity such as dead avian prey or their remains. In this study, for the first time, we experimentally studied whether piles of feathers, simulating the remains of avian prey, induce changes in the reproductive decisions of adult birds. Before and during egg laying, great tit, Parus major, pairs were exposed to piles of bright down and cover feathers from domestic goose (treatment), woodchips (procedural control), or were not exposed (control). Our experiment affected maternal investment in individual eggs, but did not influence other reproductive parameters. Females from the treatment group laid larger and more asymmetrical (pointed) eggs than control females. Moreover, females from the procedural control group laid larger eggs than those from the control group, but without differences in egg shape. However, the eggs from the treatment and procedural control groups did not differ. This indicates that great tit females can perceive feathers and woodchips as informative cues, such as potential predation risk or habitat suitability, or as novel items in the environment. Importantly, females respond to such cues by changing their maternal investment in eggs, which may result from an adaptive mechanism aimed at increasing offspring fitness in the face of specific environmental conditions experienced by a female. Our study contributes to the understanding of how female songbirds adjust their maternal reproductive investment in response to publicly available social and environmental cues.

Eggshell biometrics for individual egg identification based on convolutional neural networks

Individual egg identification technology has potential applications in breeding, product tracking/tracing, and anti-counterfeit. This study developed a novel method for individual egg identification based on eggshell images. A convolutional neural network-based model, named Eggshell Biometric Identification (EBI) model, was proposed and evaluated. The main workflow included eggshell biometric feature extraction, egg information registration, and egg identification. The image dataset of individual eggshell was collected from the blunt-end region of 770 chicken eggs using an image acquisition platform. The ResNeXt network was then trained as a texture feature extraction module to obtain sufficient eggshell texture features. The EBI model was applied to a test set of 1,540 images. The testing results showed that when an appropriate Euclidean distance threshold for classification was set (17.18), the correct recognition rate and the equal error rate reached 99.96% and 0.02%. This new method provides an efficient and accurate solution for individual chicken egg identification, and can be extended to eggs of other poultry species for product tracking/tracing and anti-counterfeit.

Role of SNPs located in the exon 9 of ATAPA1 gene on goose egg production

The meat and egg of goose is one of the main components of human food supply. The improvement of goose egg production is particularly important for the increasing human population. However, limited information is available about the effective molecular markers and mechanisms of egg production in goose. In this study, we jointly utilized the data of genome resequencing in different egg production Sichuan white goose and transcriptome at different follicle development stages to identified the molecular markers and mechanisms of egg production. The coefficient of variation of individual egg production in Sichuan white goose population is 0.42 to 0.49. Fifty individuals with the highest (laying 365 days egg number, LEN365=79-145) and 50 individuals with the lowest (LEN365=8-48) egg production were divided into high and low egg production groups. Based on whole-genome sequencing data of the selected samples, 36 SNPs (annotation novel.12.470, CELF2, ATP1A1, KCNJ6, RAB4A, UST, REV3L, DHX15, CAVN2, SLC5A9, Cldn5, MRPS23, and Tspan2) associated with the LEN365 were identified, involving multiple pathways such as metabolism and endocrinology. Notably, 5 SNPs located in the exon9 of ATP1A1 were identified by GWAS analysis. The association analysis with LEN365 showed the phenotypic variance explained of this haplotype consisting of 5 SNPs is 20.51%. Through transcriptome data analysis, we found the expression of ATP1A1 in the granular layers was increased in the stage of small yellow follicle to large yellow follicle (LYF) and LYF to F5, while decreased in F2 to F1. For the first time, we report the haplotype region formed by 5 SNPS on exon9 of ATP1A1 is associated with egg production in goose and involved in follicle selection and maturation processes.