Egg Mass Research Articles

New Record of the Egg-larval Parasitoid, Chelonus formosanus Sonan of Fall Armyworm, Spodoptera frugiperda (J.E. Smith) in the Philippines

The egg-larval parasitoid on fall armyworm (FAW), Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) have not reported in the Philippines. This paper summarizes the global biological information on two species of Chelonus and their role in the regulation of FAW. The FAW egg masses and larvae were collected in the corn plantations inside the Lipa Agricultural Research Station, Marawoy, Lipa City, Batangas. The collected egg masses and larvae were reared at the Entomology Laboratory of the Department of Agriculture-Regional Crop Protection Center IVA. The larvae of FAW were observed for the emergence of parasitoids. Two cocoons of the parasitoid from the rearing cages were obtained for species determination. Three adults from the emerged parasitoids, each male and female, were initially preserved and labeled. Color images of habitus and other morphological characters of the parasitoid were taken using a DSLR camera attached to an Olympus SZ61-60 microscope. This research found two species that emerged from FAW: Chelonus formosanus and the new record of C. semihyalinus. We also highlight the need for more research in the Philippines on exploring the diversity of indigenous natural enemies, the development of mass-rearing techniques, and their utilization to manage fall armyworms.

Using low-protein diet in egg production for win-win of productivity and environmental benefits should be prudent: Evidence from pilot test

A shortage of feed protein resources restricts poultry productivity. Key strategies to alleviate this problem include improvements to the structure of the gut microbiota by the appropriate intake of high-quality protein, improvements to the comprehensive protein utilization rate, and reducing the consumption of protein raw materials. In addition, damage to the environment caused by nitrogen emissions needs to be reduced. The aim of the study was to evaluate the effects of dietary protein levels on laying performance, host metabolism, ovarian health, nitrogen emissions, and the gut microbial structure and function of laying hens. In total, 360 hens at the age of 38 weeks were randomly allotted four treatments. Each of the groups consisted of nine replicates, with 10 birds per replicate, used for 12 weeks of study. Dietary protein levels of the four groups were 13.85 %, 14.41 %, 15.63 %, and 16.30 %. Results revealed that, compared with the 13.85 % crude protein (CP) group, the 15.63 % CP group experienced significantly enhanced final body weight, average daily gain, egg production, and egg mass. Compared with the 16.30 % CP group, the other groups' serum concentrations of immunoglobulin G (IgG) and immunoglobulin M (IgM) were significantly reduced. Compared with the 16.30 % CP group, the 13.85 % and 15.63 % groups had increased CP utilization rates but reduced nitrogen emission rate, and daily per egg and per kilogram egg nitrogen emissions rose with increased dietary protein levels. Compared to the 13.85 % and 14.41 % CP groups, the 16.30 % CP group exhibited a significant increase in the expression of genes related to amino acids and carbohydrate metabolic pathways. According to the linear discriminant analysis effect size diagram, the predominant bacteria in the 15.63 % CP group (e.g., Subdoligranulum, and Ruminococcaceae_UCG-013) were significantly related to CP utilization. The results of this study emphasize that production performance is significantly reduced when protein levels are too low, whereas too high protein levels lead to gut microbiota imbalance and a reduction in the utilization efficiency of nutrients. Therefore, on the premise of ensuring the health of hens, the structure of the gut microbiota can be improved by appropriately reducing protein levels, which helps to balance the relationships among host health, productivity, resources, and the environment.

Laying performance, genetic parameters, and the expression of FSHβ, LHβ, FSHR, and LHR genes in Japanese quails selected for early egg production

Investigating the impact of early egg production selection (the first 90 d of laying) on egg production features, cumulative selection response (CSR), and the mRNA expression of gonadotropins (FSHβ and LHβ), and their receptors (FSHR and LHR), in Japanese quails was the goal. The selection experiment involved 1293 females in all, 257 from the base group and 1036 from the 4 selected generations. Age and body weight at sexual maturity (ASM, BWSM), weight of the first egg (WFE), days to the first 10 eggs (DF10E), egg mass for the first 10 eggs (EMF10E), egg weight (EW), egg number at the first 90 d of laying (EN90D), and egg mass at the first 90 d of laying (EM90D) were all recorded. Most egg production traits had heritability estimates that were low to moderate and ranged from 0.17 to 0.33., where the highest estimates were reported for EN90D (0.33) and BWSM (0.32). With the exception of EN90D, low to moderate positive genetic correlations were observed between ASM and other egg production traits (0.17-0.44). The fourth generation showed significantly (P < 0.05) lower ASM and DF10E but higher BWSM, WFE, EN90D, EM10E, and EM90D when compared with the base generation. CSR were significant (P < 0.05) for ASM (-6.67 d), BWSM (27.13 g), WFE (0.93 g), DF10E (-1.25 d), EN90D (7.24 egg), EM10E (10.57 g), and EM90D (140.0 g). FSHβ, LHβ, FSHR, and LHR gene mRNA expression was considerably (P < 0.05) greater in the fourth generation compared to the base generation. In conclusion, selection programs depending on the efficiency of egg production (EN90D) could improve the genetic gain of egg production traits and upregulate the mRNA expression of FSHβ, LHβ, FSHR, and LHR genes in selected quails (fourth generation). These findings might help to enhance breeding plans and create commercial lines of high egg production Japanese quails.

Dietary supplementation with β-mannanase and probiotics as a strategy to improve laying hen performance and egg quality.

The objective of this study was to assess the impact of β-mannanase and probiotic on the performance, serum biochemistry, gut morphometric traits, and fresh egg quality of laying hens. A total of 120 cages, housing light-weight laying hens (36 weeks old), were randomly assigned to four different treatments. These treatments included a control group fed non-supplemented diets; diets supplemented with 300 g/ton of beta-mannanase; diets supplemented with 50 g/ton of probiotic; or diets containing both 300 g/ton of β-mannanase and 50 g/ton of probiotics. The trial spanned a duration of 26 weeks and was divided into three productive phases, each lasting 28 days. The inclusion of β-mannanase resulted in a significant improvement in the laying rate by 11% (p < 0.05) compared to the control treatment. Similarly, the addition of probiotics also enhanced the laying rate by 7% (p < 0.05), as well as the supplementation with combined additives (11.5%). Combined additives showed an increase in egg masses, and additive association improved by 13.9% (p < 0.001) in contrast to the control treatment. Overall, β-mannanase and combined additives used during the supplementation period resulted in improvements in the weight of fresh eggs. These benefits were observed after a period of 14 weeks without supplementation (p < 0.05). Furthermore, significant differences were observed in the serum biochemistry and egg masses of birds that were fed diets containing both additives (β-mannanase + probiotics) compared to the control group. Parameters such as uric acid, total cholesterol, and triglycerides displayed notable variations. The villi height: crypt depth showed differences with combined additives (β-mannanase + probiotics). The β-mannanase improved specific gravity, yolk height, length, and pH, and yolk color traits compared to the control treatment. The use of probiotics helped to improve yolk height, pH, and color score. Besides, combined additives (β-mannanase + probiotics) improve yolk height, length, weight, pH, and better traits in yolk color. Hence, incorporating β-mannanase and probiotics into laying hen diets proves to be a highly effective strategy for enhancing laying rate and overall health status, while simultaneously elevating certain quality attributes of fresh eggs.

Complexed amino acid minerals vs. bis-glycinate chelated minerals: Impact on the performance of old laying hens

The present study was to evaluate the effect of trace minerals (Zn, Mn, and Cu) from complexed amino acid minerals (ZMCAA) and bis-glycinate chelated minerals (ZMCGly) in laying hen diets on performance, internal and external egg quality, yolk mineral deposition, intestinal morphometry, and bone characteristics. From 78 to 98 weeks of age, 400 White LSL-Lite strain laying hens were distributed in a randomized design with 4 treatments with 10 replicates per treatment. Treatments were distributed in a 2 × 2 factorial arrangement using either Zn, Mn, and Cu of ZMCAA or ZMCGly source at 2 levels: low (20, 20, and 3.5 mg/kg of Zn, Mn, and Cu, respectively) or high (40, 40, and 7 mg/kg of Zn, Mn, and Cu, respectively). The analysis of variance was performed, and in cases where differences were observed, the means were compared using Tukey's test (P < 0.05). The source and level of trace mineral supplementation had a significant impact on the performance of laying hens. Hens fed ZMCAA had higher egg production (P = 0.01), egg weight (P = 0.02), egg mass (P = 0.01), and lower feed conversion ratio (P = 0.05) compared to those fed ZMCGly. The ZMCAA supplementation showed higher albumen height (P = 0.01), albumen weight (P = 0.01), and eggshell thickness (P < 0.01). The deposition of Zn (P < 0.01), Mn (P < 0.01), and Cu (P < 0.01) in the egg yolk was greater for hens received ZMCAA. Tibia weight (P = 0.04) and bone densitometry (P < 0.01) in the tibia were higher with ZMCAA supplementation. In the small intestine, ZMCAA resulted in longer villi (P = 0.02) and shorter crypt depth (P = 0.01) in the duodenum. Jejunum and ileum measurements were influenced by the level and source of trace minerals (P < 0.05). Laying hens fed ZMCAA exhibited superior performance, egg quality, deposition of trace minerals in the egg yolk, and bone density compared to hens fed ZMCGly. In this study, older laying hens supplemented with ZMCAA at lower levels demonstrated adequate levels of supplementation.

The Order of Limiting Amino Acids in a Wheat–Sorghum-Based Reduced-Protein Diet for Laying Hens

Understanding the order of limiting amino acids (AA) in reduced-protein (RP) diets for laying hens will facilitate precise feed formulation and ensure that AA requirements are met cost-effectively. The order of the first three limiting AAs—lysine (Lys), methionine (Met), and threonine (Thr)—has been well established in RP laying hen diets. This study aimed to determine the priority order of eight additional limiting AAs (critically important AAs) when formulating wheat–sorghum-based RP diets for laying hens: tryptophan (Trp), valine (Val), isoleucine (Ile), arginine (Arg), leucine (Leu), histidine (His), phenylalanine (Phe), and glycineequivalent (Gly). A total of 330 Hy-Line Brown laying hens were randomly assigned to 11 dietary treatments (30 replicates of individual birds per treatment) from 20 to 39 weeks of age (WOA). Treatments were a standard-protein (17.24% CP) diet as the control (SP); a reduced-protein (15.00% CP) diet with sufficient levels of Lys, Met, and Thr but insufficient levels of the eight experimental essential AA (RP); a reduced-protein diet with sufficient levels of all essential AAs (RP-EAA); and eight subsequent dietary treatments of the RP-EAA diet with one of the experimental essential AAs removed: Trp (RP-EAA-Trp), Val (RP-EAA-Val), Ile (RP-EAA-Ile), Arg (RP-EAA-Arg), Leu (RP-EAA-Leu), His (RP-EAA-His), Phe (RP-EAA-Phe), and Gly (RP-EAA-Gly). Eggs were collected and weighed daily, and feed intake and feed conversion ratio (FCR) were calculated weekly. External and internal egg quality was measured at 29 and 39 WOA. Nutrient digestibility, serum uric acid concentration, caecal microbiota composition, and tibia parameters were measured at 40 WOA. Overall, hens fed the RP-EAA-Val, RP-EAA-Ile, and RP diets presented significantly lower egg mass compared to hens fed the SP, RP-EAA-His, and RP-EAA-Gly diets (p &lt; 0.001). Hens fed the RP diet and RP-EAA-Val diet had a higher FCR compared to those offered the RP-EAA, RP-EAA-Leu, RP-EAA-Phe, and RP-EAA-Gly diets (p = 0.046). Lower protein intake and excretion were observed in hens offered the RP diets compared to hens fed the SP diet (p = 0.001 and 0.018, respectively). Based on the egg mass, Ile may be considered the fourth and Val the fifth limiting AA, after Lys, Met, and Thr, in laying hens fed wheat–sorghum-based RP diets during peak lay. However, if ranked based on FCR, Val may be considered the fourth limiting AA, followed by Trp, Ile, Arg, and His as the co-fifth limiting AAs. Leu, Phe, and Gly may be considered as non-essential AAs for laying hens fed RP diets.

Feeding Programs and Addition High Levels of Calcium, Phosphorus and Vitamin D3 to Aged Laying Hens’ Diets on Productive Performance

This study was conducted in poultry farm belong to Department of Animal Production/College of Agriculture/University of Anbar from 15/3/2022 to 6/6/2022 (84) days, 3 periods (28 days/period). The aim of studying was studying effect of feeding programs and addition high levels of Calcium, phosphorous and vitamin D3 to aged laying hens’ diets on productive performance. In this study, 150-layer hens of Lohmann Brown breed, aged 52 weeks were used in this experiment. Laying hens were distributed randomly to ten treatments with five replicates per treatment (3 hens/replicate) in close system (cages). A completely randomized experimental design with a 2x2x2 factorial arrangement consisting Morning feeding with once time (A1), Evening feeding with twice times equal half (A2) 6 hours difference between the first and second period. Feed Additives (B) included: B1(3000 IU vitamin D3, 3.5% Ca and 0.5% P). B2(5000 IU vitamin D3, 4% Ca and 0.6% P.), B3(5000 IU vitamin D3, 4.5% Ca and 0.7% P), B4 (7000 IU vitamin D3, 4% Ca and 0.6% P), B5 (7000 IU vitamin D3, 4.5% Ca and 0.7% P). During the experimental periods hen’s performance traits included egg production H.D%, egg weights, egg mass, feed consumption, and feed conversion ratio were recorded. The results of statistical analysis showed that no effect of feeding programs A1 and A2 on productive performance which included egg production (H.D %), egg weight, egg mass, feed consumption and feed conversion ratio.

Assessment Performance Across Generations of Iraqi Indigenous Brown Chickens Under Selection for High Egg Production

A study was conducted to evaluate sexual and productive performance of Iraqi indigenous brown chickens. Data were descended from 2234 females across six-generation of selection for high egg production. Data of age at first egg [AFE], body weight at first egg [BWFE], first egg weight [FEWT], egg weight [EW], egg number [EN], and egg mass [EM] were recorded individually. The average of AFE, BWFE, FEWT, EW, EN and EM was 149.31d, 1489.59g, 35.7g, 44.44g, 110.39 egg\\hen, and 4895.01g, respectively. Monthly gg number was 10.07, 20.35, 21.16, 20.12, 19.36, 18.13 egg\\hen from moth 1 to 6 respectively. Monthly egg weights were 37.69, 41.51, 44.23, 45.78, 47.46, 48.72 g from moth 1 to 6 respectively. Monthly egg mass was 379.91, 849.78, 935.46, 921.31, 918.84, and 882.43 g from moth 1 to 6 respectively. The effect of generation, hatch and season showed highly significant effect on sexual and productive traits. The higher FEWT and BWFE shown in the second generation compared to other generations. The cumulative EN and EM from the onset of lay to 43 weeks of age varied between generations where the highest EN and EM was recorded in the six-generation compared to the first generation. EW achieved better values in the second generation [47.60g] while the lowest was recorded in the third to the sixth generations [ca 43.0g]. EW increased with age-progressive. The hatch effect had a significant effect on FEWT, BWFE, AFE, EN, EW, and EM. Hens hatched first achieved better performance compared to the second hatch. The effect of season was significant on FEWT, BWFE, AFE, EN, EW, and EM. Birds hatched in the spring season achieved higher FEWT, BWFE, EW, and greater days to reach maturity. The overall EN for the hens hatched in the spring season was significantly lower than their counterparts hatched in the other season times. Birds hatching in the winter season achieved higher EN than in other seasons. Results suggest that Iraqi brown local chickens shown in the current work have good potential for egg-productive traits and could be used as a gene pool for enhancing egg production through selection approaches.

Genetic and Phenotypic Trend and Inbreeding Effects for Sexual and Egg Production Traits of Iraqi Local Chickens

A study was conducted to estimate genetic and phenotypic trend and inbreeding effect on a sexual and egg production trait in Iraqi brown local chickens. Data on 2234 hens raised in poultry research stations from successive 6 generations of selection for high egg production during the first 24 weeks of production were used. Data of age at sexual maturity (ASM), body weight at sexual maturity (BWSM), first egg weight (FEWT), egg weight (EW), egg number (EN), and egg mass (EM) were recorded individually. The univariate animal models under Average Information Restricted Maximum Likelihood (AI-REML) of Wombat package were applied to estimate the heritability, BLUP-breeding value and inbreeding rate. The heritability estimates based on individual animal model was 0.39±0.05, 0.42±0.05, 0.17±0.04, 0.68±0.04, 0.40±0.05 and 0.40±0.05 for the traits mentioned above respectively. Average breeding values across generation tend to be positive in productive traits but it was negative in ASM, BWSM and FEW. The overall predicted genetic gains, after 6 generations of selection, estimated by the regression coefficients of the breeding value on generation number were equal to -0.010, 0.029, 0.033, -0.397, -1.514, and -41.541, for ASM, BWSM, FEWT, EW, EN and EM, respectively. In conclusion, the moderate to high heritability estimated for egg production traits suggested that these traits could be improved through selection. The effect of the inbreeding rate negatively on some traits and positively on other traits suggested that both traits could not be improved simultaneously using additive selection. The inconsistency between phenotypic and genetic trends suggests that genetic progress was not achieved in a higher magnitude.

The Effect of Adding Moringa Leaf Powder to the Adapted Quail Diet During the Egg Production Stage on the Productive Performance and some Biochemical Blood Characteristics

The current experiment was carried out at the poultry farm of the Animal Production department, College of Agriculture, University of Kirkuk from 5/12/2021 until 1/2/2022. To study the effect of different levels of Moring leaves powder (2.5, 5.0, and 7.5)% on the production diet. Forty-eight quail were used at 30 days old and randomly allocated to four treatment groups with each treatment three replication with 4 birds each. The egg weight of the birds was weighed daily with a sensitive electronic balance (0.01) g. The feed intake was determined by weighing the bucket and feed before and after consumption before the next refilling of the bucket. Egg production was monitored daily and recorded for each replicate. The external egg traits were measured by using a clipper vernier (0.01) mm. and the internal egg traits were measured by using an electronic balance (0.01) g. General linear model (GLM) within the SAS program was used to calculate mean, standard error, and significance. Duncan’s multiple range test was used to test the differences between the means. The egg production and feed intake significantly differed between the treatments, it was highest in treatment four and lower production in the control group. The egg weight, egg mass, and feed conversion were non-significant between the treatments. All the external and internal egg traits were non-significant between the groups.

Impact of Glycetin Injection on Productive Traits in local Iraqi Chickens

This study aimed to investigate the impact of implementing Glycetin by injection on the productive features of local Iraqi chickens. 100 female hens and 20 roosters from a local Iraqi chicken population, at age 26 weeks. The sample was divided into three groups, in addition to a control group. Each experimental group had 25 female hens, with the same procedure being performed for each individual hen, and 20 roosters, which were reared separately for the purpose of artificial insemination. The avian specimens were housed in separate enclosures, and the experimental conditions were allocated as follows: the initial condition (Control Group) did not receive any injections, whereas conditions T2, T3, and T4 were administered with varying doses of Glycetin at concentrations of 5, 10, and 15 milligrams per kilogram of body weight, respectively. The results showed improve significant (P<0.05) many aspects such as egg production rate, cumulative egg count, egg mass, egg weight, and feed conversion ratio.

Physiological Changes Caused by Dietary Proanthocyanidin Supplementation at Varying Doses in Laying Hens

The research was carried out at the college of Agriculture/Al-Qasim Green University’s Department of Animal Production farm. Beginning on March 19, 2022, and ending on July 2, 2022, the experimental field trial lasted a total of 16 weeks (four intervals of four weeks each). The purpose of this study was to determine the impact of supplementing chicken diets with varying concentrations of the Proanthocyanidin chemical on egg production, quality, and oxidation markers. During the experiment’s breeding phase, which lasted for 50 weeks, 105 Lohmann brown laying hens were split into four groups: those aged 57-60 weeks, 61-64” weeks, and 65-68 weeks. A total of 21 birds were randomly assigned to one of five experimental treatments, with three replicates per 7 birds in each treatment (as per the standard standards outlined in the Lohmann Brown Layer Managements Guide). This is what we found to work in our clinical trials: The initial procedure: a no-additions control group. Second, 100 milligrammes of proanthocyanidin per kilogramme of feed was given to a standard diet. Third, we have a standard diet with 200 milligrammes of proanthocyanidin per kilogramme of feed. Fourthly, a standard diet with 300 milligrammes of Proanthocyanidin per kilogramme of feed was used. In the sixth treatment, 400 milligrammes of proanthocyanidin per kilogramme of feed is given to a standard diet. The study found mostly these results: Compared to the control group, the third, fourth, and fifth treatments significantly increased (p≤0.05) egg production rate, total eggs laid, egg weight, egg mass, and feed conversion coefficient. - The shell’s relative weight and thickness were found to be optimal for treatments three, four, and five, while albumin height (mm) and hu units improved significantly (p≤0.05) for treatments four and five compared to the control treatment.

Effect of Methods of Adding Red Ginseng on some Productive Traits of Laying Hens

For 12 weeks, from October 15, 2022, to January 7, 2023, researchers at Al-Muthanna University’s Agricultural Research and Experiment Station examined the impact of different methods for administering red ginseng root on a selection of laying hens’ blood parameters. Sixty 43-week-old ISA Brown laying hens were split into four treatments, each with fifteen hens. Each treatment’s pens were three metres by three metres, and each pen was divided into thirds so that each third included five hens. The following procedures were used: In T1 (the placebo group), the regular diet was served without any alterations. T2: Combine 1 gramme of alcoholic extract with 1 litre of water. T3: The diet included 1 gramme of powdered red ginseng root per kilogramme of feed. T4: Ten millilitres of red ginseng root aqueous extract per one litre of water was added to the supply. The results show that compared to the control treatment, all treatments in which ginseng root powder was administered significantly increased the egg production ratio, egg weight, egg mass, and feed conversion factor of the laying hens tested. The best outcomes, by a wide margin, were achieved with the addition of alcoholic extract to drinking water.

Effect of Adding Different Levels of Proanthocyanidin in Laying Hens Diet on Productive Performance

The research was carried out at the college of Agriculture/Al-Qasim Green University’s Department of Animal Production farm. The experimental field trial ran for 16 weeks, from March 19, 2022, to July 2, 2022 (divided into four 4-week phases). The purpose of this study was to determine the impact of supplementing chicken diets with varying concentrations of the Proanthocyanidin chemical on egg production, quality, and oxidation markers. During the experiment’s breeding phase, which was split into four experimental periods (ages 53–56 weeks, 57–60 weeks, 61–64 weeks, and 65–68 weeks), 105 Lohmann brown laying hens were used.15 pens were set up with 5 experimental treatments for each treatment of 21 birds, and each treatment contained 3 duplicates per 7 birds, all fed according to the standards outlined in the Lohmann Brown Layer Managements Guide. The following procedures were used in the pilot programme:In the first phase, a non-experimental group served as a control. Second, 100 milligrammes of proanthocyanidin per kilogramme of feed was given to a standard diet. Third, we have a standard diet with 200 milligrammes of proanthocyanidin per kilogramme of feed. Fourthly, a standard diet with 300 milligrammes of Proanthocyanidin per kilogramme of feed was used. Fifthly, we have a standard diet with 400 milligrammes of proanthocyanidin per kilogramme of feed. Key findings from the research include: Compared to the control group, the third, fourth, and fifth treatments significantly increased (p0.05) egg production rate, cumulative number of eggs, egg weight, egg mass, and feed conversion coefficient. - Shell thickness (in millimetres) and relative weight (in percent) were best for treatments three through five. In contrast, albumin height (in millimetres) and hu units improved significantly (p 0.05) for treatments four and five compared to the control therapy (treatment one).

The Effect Different Levels of Protein, with Two Sources of the Synthetic and Herbal for Methionine and Lysine and Synethetic Threonine on Serum Biochemical Parameters Egg Quality Traits and Chemical Composition of the Eggs

This study aimed to determine effect of various levels of protein, with two formulations and herbal sources of methionine and lysine. and synthetic threonine on serum biochemical properties, egg quality traits and egg chemical composition of 160 45-week-old Lyman Brown hens. It was randomly distributed to 8 treatments with five replications in (cages in the battery system), each repetition containing four birds, and the food treatments were, T1: basal diet (control) that contained 16.32% Cruz Protein (CP) with Synthetic 0.41% Methionine (S. T3: Basic Diet (16.18% CP) with (0.42% S.Mthionine), (0.05% Herbal Lysine: HL) and (0.106% S.Therionine) T4: Basic diet (16.18% CP) with (0.42% H.methionine), (0.05% lysine) and (0.106% threonine), T5: Basic diet (15.45% CP) with (o.42% S.methionine), 0.12% S.Lysine) and (0.116% S. threonine) T6: basic diet (15.46% CP) with (0.42% H.methionine), (0.045% H.Lysine and S. threonine), T7: diet Basal Diet (15.12% C.P) with (0.148% S.methionine, (0.150% S.lysine) and (0.130% S.thrionine), T8: Basal Diet (15.12% CP) with (0.148% H.methionine), (0.150% H.lysine) and (0.130% S.thrionine). The results of the statistical analysis in this experiment showed that there were no significant differences in the rate of egg production, the rate of egg mass, and the feed conversion coefficient, while significant differences were found in the rate of egg weight, the rate of feed consumption, and the rate of conversion of each of Protein, methionine, lysine and threonine.

Protective scale variation on Spodoptera egg masses can potentially support the cost-effective use of Trichogramma parasitoids

Protective scale variation on Spodoptera egg masses can potentially support the cost-effective use of Trichogramma parasitoids

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Effects of dietary supplementation with tea polyphenols and probiotics on laying performance, biochemical parameters intestinal morphology and microflora of laying hens

This study was conducted to investigate the effects of tea polyphenols (TP) and probiotics (PB) on the production performance, biochemical indices, and gut health of laying hens. A total of 400 Hy-line Brown layers (45 weeks old) were randomly assigned to 8 diet groups for 8-week feeding trial. Compared with the control basal diet (CT), dietary high dosage of TP and PB (HTP-PB) increased egg mass (P < 0.05). Supplementation with HTP-PB improved the levels of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) and decreased the malonic dialdehyde (MDA) content (P < 0.05) without affecting the contents of immunoglobulins in the serum. The combination of HTP and PB supplementation promoted the secretion of estradiol (E2) and progesterone (PROG) compared with treatment with TP or PB alone (P < 0.05). The combined use of HTP and PB induced higher jejunal villus height (VH) than the CT group (P < 0.05). Dietary TP and PB could optimize the functional network of intestinal microflora and the interactions between the intestinal microflora and the host. Therefore, the combined use of the high dosage of TP and PB affected laying performance, improved antioxidant capacity, and promoted intestinal health, which may be associated with regulation of the intestinal microbiota.

Orychophragmus violaceus and/or chicory forage affects performance, egg quality, sensory evaluation and antioxidative properties in native laying hens

Orychophragmus violaceus (OV) and chicory (Cichorium intybus L., CC) can be used as fresh or dry forage for animals. To determine whether OV and/or CC have beneficial effects on performance and egg quality, a total of 1212 28-wk-old Beijing You Chicken (BYC) laying hens with similar performance were randomly allocated to 4 groups with 3 replicate pens per group, and 101 birds per pen. The birds were fed a basal diet (control), the basal diet + OV (3.507 kg/d/pen), the basal diet + CC (2.525 kg/d/pen), and the basal diet + OV + CC (OVC, 1.7535 kg/d/pen OV + 1.2625 kg/d/pen CC) for 3 wks after one wk of adaptation. The results showed that egg-laying rate was not affected by OV, CC and OVC (p > 0.05), but weekly average egg mass was significantly increased by OV and CC (p < 0.05). The feed egg ratio in the CC group (2.82) was significantly lower than that in the other three groups (p < 0.05). The eggshell thickness (EST), albumen height (AH) and Haugh unit (HU) were decreased by OV and CC (p < 0.05); while yolk color (YC) was increased in the CC and OVC groups (p < 0.05). Egg grade was decreased by OV (p < 0.05). Sensory evaluation showed that there was a trend for increased YC in OV, CC and OVC (p = 0.089). Serum total protein was significantly lower in OV group than those in the control and CC group (p < 0.05); serum albumin content was significantly decreased in OV, CC and OVC groups (p = 0.006). Serum glutathione peroxidase activity in CC and OVC groups was significantly higher than that in the control group (p < 0.05). In conclusion, the present study suggests that CC had a better effect on the performance of the native laying hens than OV. The OV and CC affected egg quality, while YC was increased in CC and OVC groups. The OVC improved YC and serum antioxidative properties of native laying hens without affecting the performance.

Effect of Botanicals on Fall Armyworm and Predators in Sorghum Ecosystem

The present field experiment was conducted at Agricultural College Farm, Bapatla during kharif (June-November), 2019 to know the impact of botanicals against fall armyworm, S. frugiperda and their natural enemies (coccinellids, spiders and predatory bugs) in the sorghum ecosystem. Among the botanicals, the highest population reduction of FAW egg masses and larval population was recorded in NSKE @ 5% (71.43 and 60.87%, respectively), green chilli pod extract @ 5% (61.90 and 54.35%, respectively), neem leaf extract @ 5% (69.05 and 45.65%, respectively) and garlic bulb extract @ 5% (52.38 and 54.35%, respectively) treated plots. The botanicals that are used in the experiment were found safe from natural enemies. The maximum population of natural enemies i.e., coccinellids, spiders and predatory bugs was recorded in pongamia leaf extract @ 5% (0.16, 0.22 and 0.10 plant-1, respectively) whereas, the least was observed in emamectin benzoate 5 SG @ 11 g a.i. ha-1 (0.02, 0.02 and 0.01 plant-1 respectively) treated plots. The emamectin benzoate 5 SG @ 11 g a.i. ha-1 presented an adverse effect on natural enemies whereas no or few natural enemies were observed compared to botanical extracts. Therefore, it is recommended that spraying of botanicals has to be done four times at weekly intervals to keep FAW populations below economic injury level until crop maturity and these treatments were also found safe to natural enemies of FAW.