Ecdysone Response Research Articles

Steroid signaling controls sex-specific development in an invertebrate.

In vertebrate sexual development, two important steroid hormones, testosterone and estrogen, regulate the sex-specific development of many tissues. In contrast, invertebrates utilize a single steroid hormone, ecdysone, to regulate developmental timing in both sexes. However, here we show that in Drosophila melanogaster, sex-specific ecdysone (E) signaling controls important aspects of gonad sexual dimorphism. Rather than being regulated at the level of hormone production, hormone activity is regulated cell-autonomously through sex-specific hormone reception. Ecdysone receptor (EcR) expression is restricted to the developing ovary and is repressed in the testis at a time when ecdysone initiates ovary morphogenesis. Interestingly, EcR expression is regulated downstream of the sex determination factor Doublesex (Dsx), the founding member of the Dsx/Mab3 Related Transcription Factor (DMRT) family that regulates gonad development in all animals. E signaling is required for normal ovary development1,2, and ectopic activation of E signaling in the testis antagonized stem cell niche identity and feminized somatic support cells, which were transformed into follicle-like cells. This work demonstrates that invertebrates can also use steroid hormone signaling to control sex-specific development. Further, it may help explain recent work showing that vertebrate sexual development is surprisingly cell-autonomous. For example, chickens utilize testosterone and estrogen to control sex-specific development, but when they have a mixture of cells with male and female genotypes, the male cells develop as male and the female cells develop as female despite exposure to the same circulating hormones3. Sex-specific regulation of steroid hormone signaling may well underly such cell-autonomous sexual fate choices in vertebrates as it does in Drosophila.

N(alpha)-acetyltransferase 40-mediated histone acetylation plays an important role in ecdysone regulation of metamorphosis in the red flour beetle, Tribolium castaneum

Histone acetylation, a crucial epigenetic modification, is governed by histone acetyltransferases (HATs), that regulate many biological processes. Functions of HATs in insects are not well understood. We identified 27 HATs and determined their functions using RNA interference (RNAi) in the model insect, Tribolium castaneum. Among HATs studied, N-alpha-acetyltransferase 40 (NAA40) knockdown caused a severe phenotype of arrested larval development. The steroid hormone, ecdysone induced NAA40 expression through its receptor, EcR (ecdysone receptor). Interestingly, ecdysone-induced NAA40 regulates EcR expression. NAA40 acetylates histone H4 protein, associated with the promoters of ecdysone response genes: EcR, E74, E75, and HR3, and causes an increase in their expression. In the absence of ecdysone and NAA40, histone H4 methylation by arginine methyltransferase 1 (ART1) suppressed the above genes. However, elevated ecdysone levels at the end of the larval period induced NAA40, promoting histone H4 acetylation and increasing the expression of ecdysone response genes. NAA40 is also required for EcR, and steroid-receptor co-activator (SRC) mediated induction of E74, E75, and HR3. These findings highlight the key role of ecdysone-induced NAA40-mediated histone acetylation in the regulation of metamorphosis.

Ecdysone-controlled nuclear receptor ERR regulates metabolic homeostasis in the disease vector mosquito Aedes aegypti.

Hematophagous mosquitoes require vertebrate blood for their reproductive cycles, making them effective vectors for transmitting dangerous human diseases. Thus, high-intensity metabolism is needed to support reproductive events of female mosquitoes. However, the regulatory mechanism linking metabolism and reproduction in mosquitoes remains largely unclear. In this study, we found that the expression of estrogen-related receptor (ERR), a nuclear receptor, is activated by the direct binding of 20-hydroxyecdysone (20E) and ecdysone receptor (EcR) to the ecdysone response element (EcRE) in the ERR promoter region during the gonadotropic cycle of Aedes aegypti (named AaERR). RNA interference (RNAi) of AaERR in female mosquitoes led to delayed development of ovaries. mRNA abundance of genes encoding key enzymes involved in carbohydrate metabolism (CM)-glucose-6-phosphate isomerase (GPI) and pyruvate kinase (PYK)-was significantly decreased in AaERR knockdown mosquitoes, while the levels of metabolites, such as glycogen, glucose, and trehalose, were elevated. The expression of fatty acid synthase (FAS) was notably downregulated, and lipid accumulation was reduced in response to AaERR depletion. Dual luciferase reporter assays and electrophoretic mobility shift assays (EMSA) determined that AaERR directly activated the expression of metabolic genes, such as GPI, PYK, and FAS, by binding to the corresponding AaERR-responsive motif in the promoter region of these genes. Our results have revealed an important role of AaERR in the regulation of metabolism during mosquito reproduction and offer a novel target for mosquito control.

Low concentrations of cyantraniliprole negatively affects the development of Spodoptera frugiperda by disruption of ecdysteroid biosynthesis and carbohydrate and lipid metabolism

In addition to the acute lethal toxicity, insecticides might affect population dynamics of insect pests by inducing life history trait changes under low concentrations, however, the underlying mechanisms remain not well understood. Here we examined systemic impacts on development and reproduction caused by low concentration exposures to cyantraniliprole in the fall armyworm (FAW), Spodoptera frugiperda, and the putative underlying mechanisms were investigated. The results showed that exposure of third-instar larvae to LC10 and LC30 of cyantraniliprole significantly extended larvae duration by 1.46 and 5.41 days, respectively. Treatment with LC30 of cyantraniliprole significantly decreased the pupae weight and pupation rate as well as the longevity, fecundity and egg hatchability of female adults. Consistently, we found that exposure of FAW to LC30 cyantraniliprole downregulated the mRNA expression of four ecdysteroid biosynthesis genes including SfNobo, SfShd, SfSpo and SfDib and one ecdysone response gene SfE75 in the larvae as well as the gene encoding vitellogenin (SfVg) in the female adults. We also found that treatment with LC30 of cyantraniliprole significantly decreased the whole body levels of glucose, trehalose, glycogen and triglyceride in the larvae. Our results indicate that low concentration of cyantraniliprole inhibited FAW development by disruption of ecdysteroid biosynthesis as well as carbohydrate and lipid metabolism, which have applied implications for the control of FAW.

The nuclear receptor gene E75 plays a key role in regulating the molting process of the spider mite, Tetranychus urticae.

The nuclear receptor gene Ecdysone-induced protein 75 (E75), as the component of ecdysone response genes in the ecdysone signaling pathway, has important regulatory function for insect molting. However, the regulatory function of E75 during the molting process of spider mites is not yet clear. In this study, the expression pattern of E75 in the molting process of the spider mite Tetranychus urticae was analyzed. The results showed that there was a peak at 8h post-molting, followed by a decline 8h after entering each respective quiescent stage across various developmental stages. During the deutonymph stage, the expression dynamics of E75, observed at 4-h intervals, indicated that the transcript levels of TuE75 peaked at 24h, coinciding with the onset of molting in the mites. To investigate the function of TuE75 during the molting process, silencing TuE75 through dsRNA injection into deutonymph mites at the age of 8h yielded a notable outcome: 78% of the deutonymph mites were unable to progress to the adult stage. Among these phenotypic mites, 37% were incapable of transitioning into the quiescent state and eventually succumbed after a certain period. An additional 41% of the mites successfully entered the quiescent state but encountered difficulties in shedding the old epidermis, leading to eventual mortality. In summary, these results suggested that TuE75 plays a key role in the molting process of T. urticae.

The Sterol Transporter Npc2c Controls Intestinal Stem Cell Mitosis and Host-Microbiome Interactions in Drosophila.

Cholesterol is necessary for all cells to function. The intracellular cholesterol transporters Npc1 and Npc2 control sterol trafficking and their malfunction leads to Neimann-Pick Type C disease, a rare disorder affecting the nervous system and the intestine. Unlike humans that encode single Npc1 and Npc2 transporters, flies encompass two Npc1 (Npc1a-1b) and eight Npc2 (Npc2a-2h) members, and most of the Npc2 family genes remain unexplored. Here, we focus on the intestinal function of Npc2c in the adult. We find that Npc2c is necessary for intestinal stem cell (ISC) mitosis, maintenance of the ISC lineage, survival upon pathogenic infection, as well as tumor growth. Impaired mitosis of Npc2c-silenced midguts is accompanied by reduced expression of Cyclin genes, and genes encoding ISC regulators, such as Delta, unpaired1 and Socs36E. ISC-specific Npc2c silencing induces Attacin-A expression, a phenotype reminiscent of Gram-negative bacteria overabundance. Metagenomic analysis of Npc2c-depleted midguts indicates intestinal dysbiosis, whereby decreased commensal complexity is accompanied by increased gamma-proteobacteria. ISC-specific Npc2c silencing also results in increased cholesterol aggregation. Interestingly, administration of the non-steroidal ecdysone receptor agonist, RH5849, rescues mitosis of Npc2c-silenced midguts and increases expression of the ecdysone response gene Broad, underscoring the role of Npc2c and sterols in ecdysone signaling. Assessment of additional Npc2 family members indicates potential redundant roles with Npc2c in ISC control and response to ecdysone signaling. Our results highlight a previously unidentified essential role of Npc2c in ISC mitosis, as well as an important role in ecdysone signaling and microbiome composition in the Drosophila midgut.

Coregulators Reside within Drosophila Ecdysone-Inducible Loci before and after Ecdysone Treatment.

Ecdysone signaling in Drosophila remains a popular model for investigating the mechanisms of steroid action in eukaryotes. The ecdysone receptor EcR can effectively bind ecdysone-response elements with or without the presence of a hormone. For years, EcR enhancers were thought to respond to ecdysone via recruiting coactivator complexes, which replace corepressors and stimulate transcription. However, the exact mechanism of transcription activation by ecdysone remains unclear. Here, we present experimental data on 11 various coregulators at ecdysone-responsive loci of Drosophila S2 cells. We describe the regulatory elements where coregulators reside within these loci and assess changes in their binding levels following 20-hydroxyecdysone treatment. In the current study, we detected the presence of some coregulators at the TSSs (active and inactive) and boundaries marked with CP190 rather than enhancers of the ecdysone-responsive loci where EcR binds. We observed minor changes in the coregulators' binding level. Most were present at inducible loci before and after 20-hydroxyecdysone treatment. Our findings suggest that: (1) coregulators can activate a particular TSS operating from some distal region (which could be an enhancer, boundary regulatory region, or inactive TSS); (2) coregulators are not recruited after 20-hydroxyecdysone treatment to the responsive loci; rather, their functional activity changes (shown as an increase in H3K27 acetylation marks generated by CBP/p300/Nejire acetyltransferase). Taken together, our findings imply that the 20-hydroxyecdysone signal enhances the functional activity of coregulators rather than promoting their binding to regulatory regions during the ecdysone response.

Bruceine D Acts as a Potential Insecticide by Antagonizing 20E-EcR/USP Signal Transduction.

Bruceine D (BD) is an effective insecticidal compound found in the Chinese herb Brucea javanica (L.) Merr. BD inhibits the growth and metamorphosis of Plutella xylostella and Drosophila melanogaster; however, its target protein and the molecular mechanism of insecticidal activity remain unclear. In this study, proteins with high affinity for BD were screened using surface plasmon resonance and high-performance liquid chromatography coupled with matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry, revealing the ecdysone receptor (EcR) is the main target of BD. In vivo results showed that BD inhibited insect growth and metamorphosis through inhibition of the expression of 20E response genes. In vitro dual luciferase and enhanced green fluorescent protein (EGFP) fluorescence experiments indicated that BD suppressed the transcriptional activation activity of EcR by blocking the ecdysone response element (EcRE)-triggered transcriptional cascade, suggesting that BD inhibits the formation of the 20E-EcR-USP-EcRE complex. Moreover, molecular docking demonstrated that BD bound well to EcR. Elucidating the insecticidal mechanism of BD will be helpful in the development of green pesticides to control pests.

A critical role for ecdysone response genes in regulating egg production in adult female Rhodnius prolixus.

Ecdysteroids control ovary growth and egg production through a complex gene hierarchy. In the female Rhodnius prolixus, a blood-gorging triatomine and the vector of Chagas disease, we have identified the ecdysone response genes in the ovary using transcriptomic data. We then quantified the expression of the ecdysone response gene transcripts (E75, E74, BR-C, HR3, HR4, and FTZ-F1) in several tissues, including the ovary, following a blood meal. These results confirm the presence of these transcripts in several tissues in R. prolixus and show that the ecdysone response genes in the ovary are mostly upregulated during the first three days post blood meal (PBM). Knockdown of E75, E74, or FTZ-F1 transcripts using RNA interference (RNAi) was used to understand the role of the ecdysone response genes in vitellogenesis and egg production. Knockdown significantly decreases the expression of the transcripts for the ecdysone receptor and Halloween genes in the fat body and the ovaries and reduces the titer of ecdysteroid in the hemolymph. Knockdown of each of these transcription factors typically alters the expression of the other transcription factors. Knockdown also significantly decreases the expression of vitellogenin transcripts, Vg1 and Vg2, in the fat body and ovaries and reduces the number of eggs produced and laid. Some of the laid eggs have an irregular shape and smaller volume, and their hatching rate is decreased. Knockdown also influences the expression of the chorion gene transcripts Rp30 and Rp45. The overall effect of knockdown is a decrease in number of eggs produced and a severe reduction in number of eggs laid and their hatching rate. Clearly, ecdysteroids and ecdysone response genes play a significant role in reproduction in R. prolixus.

Comparative Transcriptomic Analysis of Head in Laodelphax striatellus upon Rice Stripe Virus Infection

Rice stripe virus (RSV) is transmitted by the small brown planthopper (SBPH), Laodelphax striatellus, in a circulative-propagative manner. Multiple studies have proved that RSV can manipulate vector insects to facilitate its transmission and can alter the gene expressions in viruliferous SBPH. However, to the best of our knowledge, nobody has investigated the gene expressions in the head of SBPH after RSV acquisition. In this study, to investigate the genes and gene functions regulated by RSV infection in the head of SBPH, we used RNA sequencing to compare the transcriptional profiles between SBPH head samples that acquired RSV or not. Compared with the non-viruliferous SBPH, a total of 336 differentially expressed genes (DEGs) were identified in the head samples of viruliferous SBPH groups, including 186 up-regulated and 150 down-regulated genes. Here, we focused on DEGs that may be involved in RSV replication or transmission, primarily genes associated with the nervous system, cytochrome P450s, sugar metabolism, the olfactory system, and cuticular process, as well as genes that have been previously reported to affect virus transmission in insect vectors including ubiquitin-protein ligase (E3), ecdysone response gene (E74A), and vitellogenin receptor (VgR). Finally, we verified the accuracy of the transcriptome sequencing results using qRT-PCR by selecting 16 DEGs. Our results can contribute to the understanding of the effects of RSV infection on gene regulation in the head of SBPH and provide insight into the control of plant virus transmission and insect vectors.

Opportunistic binding of EcR to open chromatin drives tissue-specific developmental responses

Steroid hormones perform diverse biological functions in developing and adult animals. However, the mechanistic basis for their tissue specificity remains unclear. In Drosophila, the ecdysone steroid hormone is essential for coordinating developmental timing across physically separated tissues. Ecdysone directly impacts genome function through its nuclear receptor, a heterodimer of the EcR and ultraspiracle proteins. Ligand binding to EcR triggers a transcriptional cascade, including activation of a set of primary response transcription factors. The hierarchical organization of this pathway has left the direct role of EcR in mediating ecdysone responses obscured. Here, we investigate the role of EcR in controlling tissue-specific ecdysone responses, focusing on two tissues that diverge in their response to rising ecdysone titers: the larval salivary gland, which undergoes programmed destruction, and the wing imaginal disc, which initiates morphogenesis. We find that EcR functions bimodally, with both gene repressive and activating functions, even at the same developmental stage. EcR DNA binding profiles are highly tissue-specific, and transgenic reporter analyses demonstrate that EcR plays a direct role in controlling enhancer activity. Finally, despite a strong correlation between tissue-specific EcR binding and tissue-specific open chromatin, we find that EcR does not control chromatin accessibility at genomic targets. We conclude that EcR contributes extensively to tissue-specific ecdysone responses. However, control over access to its binding sites is subordinated to other transcription factors.

Transcriptional Activation of Ecdysone-Responsive Genes Requires H3K27 Acetylation at Enhancers.

The steroid hormone ecdysone regulates insect development via its nuclear receptor (the EcR protein), which functions as a ligand-dependent transcription factor. The EcR regulates target gene expression by binding to ecdysone response elements (EcREs) in their promoter or enhancer regions. Its role in epigenetic regulation and, particularly, in histone acetylation remains to be clarified. Here, we analyzed the dynamics of histone acetylation and demonstrated that the acetylation of histone H3 on lysine 27 (H3K27) at enhancers was required for the transcriptional activation of ecdysone-responsive genes. Western blotting and ChIP-qPCR revealed that ecdysone altered the acetylation of H3K27. For E75B and Hr4, ecdysone-responsive genes, enhancer activity, and transcription required the histone acetyltransferase activity of the CBP. EcR binding was critical in inducing enhancer activity and H3K27 acetylation. The CREB-binding protein (CBP) HAT domain catalyzed H3K27 acetylation and CBP coactivation with EcR, independent of the presence of ecdysone. Increased H3K27 acetylation promoted chromatin accessibility, with the EcR and CBP mediating a local chromatin opening in response to ecdysone. Hence, epigenetic mechanisms, including the modification of acetylation and chromatin accessibility, controlled ecdysone-dependent gene transcription.

Direct and indirect gene repression by the ecdysone cascade during mosquito reproductive cycle

SignificanceHematophagous Aedes aegypti mosquitoes spread devastating viral diseases. Upon blood feeding, a steroid hormone, 20-hydroxyecdysone (20E), initiates a reproductive program during which thousands of genes are differentially expressed. While 20E-mediated gene activation is well known, repressive action by this hormone remains poorly understood. Using bioinformatics and molecular biological approaches, we have identified the mechanisms of 20E-dependent direct and indirect transcriptional repression by the ecdysone receptor (EcR). While indirect repression involves E74, EcR binds to an ecdysone response element different from those utilized in 20E-mediated gene activation to exert direct repressive action. Moreover, liganded EcR recruits a corepressor Mi2, initiating chromatin compaction. This study advances our understanding of the 20E-EcR repression mechanism and could lead to improved vector control approaches.

The nuclear receptor Hr46/Hr3 is required in the blood brain barrier of mature males for courtship.

The blood brain barrier (BBB) forms a stringent barrier that protects the brain from components in the circulation that could interfere with neuronal function. At the same time, the BBB enables selective transport of critical nutrients and other chemicals to the brain. Beyond these functions, another recently recognized function is even less characterized, specifically the role of the BBB in modulating behavior by affecting neuronal function in a sex-dependent manner. Notably, signaling in the adult Drosophila BBB is required for normal male courtship behavior. Courtship regulation also relies on male-specific molecules in the BBB. Our previous studies have demonstrated that adult feminization of these cells in males significantly lowered courtship. Here, we conducted microarray analysis of BBB cells isolated from males and females. Findings revealed that these cells contain male- and female-enriched transcripts, respectively. Among these transcripts, nuclear receptor Hr46/Hr3 was identified as a male-enriched BBB transcript. Hr46/Hr3 is best known for its essential roles in the ecdysone response during development and metamorphosis. In this study, we demonstrate that Hr46/Hr3 is specifically required in the BBB cells for courtship behavior in mature males. The protein is localized in the nuclei of sub-perineurial glial cells (SPG), indicating that it might act as a transcriptional regulator. These data provide a catalogue of sexually dimorphic BBB transcripts and demonstrate a physiological adult role for the nuclear receptor Hr46/Hr3 in the regulation of male courtship, a novel function that is independent of its developmental role.

The Response of the Estrogen-Related Receptor to 20-Hydroxyecdysone in Bombyx mori: Insight Into the Function of Estrogen-Related Receptor in Insect 20-Hydroxyecdysone Signaling Pathway.

Estrogen-related receptor (ERR) is an orphan nuclear receptor that was first discovered in animals, and play an important role in metabolism, development, and reproduction. Despite extensive research on the function of ERR, its transcriptional regulation mechanism remains unclear. In this study, we obtained the upstream region of Bombyx mori ERR (BmERR) and confirmed the promoter activity of this region. Interestingly, we found that 10 and 50 nM 20-hydroxyecdysone (20E) up-regulated the transcriptional activity of BmERR promoter. In addition, eight putative ecdysone response elements (EcREs) were predicted in the upstream sequence of BmERR. Based on their positions, the upstream sequence of BmERR was truncated into different fragments. Finally, an EcRE-like sequence (5′-AGTGCAGTAAACTGT-3′) was identified. Electrophoretic mobility shift assay (EMSA) and cell transfection experiments confirmed that this motif specifically binds to the complex formed between ecdysone receptor (BmEcR) and the ultraspiracle (BmUSP), a key complex in the 20E signaling pathway. Interference of BmERR or BmEcR mRNA in the embryonic cells of Bombyx mori significantly affected the expression of BmEcR and BmUSP. Overall, these results suggested that an EcRE element was identified from BmERR, and this will help understanding the detailed regulatory mechanism of ERR in insects.

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

Pri smORF Peptides Are Wide Mediators of Ecdysone Signaling, Contributing to Shape Spatiotemporal Responses.

There is growing evidence that peptides encoded by small open-reading frames (sORF or smORF) can fulfill various cellular functions and define a novel class regulatory molecules. To which extend transcripts encoding only smORF peptides compare with canonical protein-coding genes, yet remain poorly understood. In particular, little is known on whether and how smORF-encoding RNAs might need tightly regulated expression within a given tissue, at a given time during development. We addressed these questions through the analysis of Drosophila polished rice (pri, a.k.a. tarsal less or mille pattes), which encodes four smORF peptides (11–32 amino acids in length) required at several stages of development. Previous work has shown that the expression of pri during epidermal development is regulated in the response to ecdysone, the major steroid hormone in insects. Here, we show that pri transcription is strongly upregulated by ecdysone across a large panel of cell types, suggesting that pri is a core component of ecdysone response. Although pri is produced as an intron-less short transcript (1.5 kb), genetic assays reveal that the developmental functions of pri require an unexpectedly large array of enhancers (spanning over 50 kb), driving a variety of spatiotemporal patterns of pri expression across developing tissues. Furthermore, we found that separate pri enhancers are directly activated by the ecdysone nuclear receptor (EcR) and display distinct regulatory modes between developmental tissues and/or stages. Alike major developmental genes, the expression of pri in a given tissue often involves several enhancers driving apparently redundant (or shadow) expression, while individual pri enhancers can harbor pleiotropic functions across tissues. Taken together, these data reveal the broad role of Pri smORF peptides in ecdysone signaling and show that the cis-regulatory architecture of the pri gene contributes to shape distinct spatial and temporal patterns of ecdysone response throughout development.

Anatomy and evolution of a DNA replication origin.

DNA amplification occurs at the DNA puff II/9A locus in the fungus fly Sciara coprophila. As a foundation to study the molecular mechanism for the initiating events of II/9A DNA re-replication, we have sequenced 14kb spanning a DNase hypersensitive site (DHS) upstream of the 1kb amplification origin and through transcription units II/9-1 and II/9-2 downstream of the origin. These elements are annotated as well as the ORC binding site at the origin and the transition point (TP) between continuous and discontinuous DNA syntheses that marks the origin of bidirectional replication at the nucleotide level. A 9bp motif found at the TP is repeated near the other end of the 1 kb ORI and may identify a putative second TP. The steroid hormone ecdysone induces DNA amplification as well as transcription and puffing at locus II/9A. Within the 14 kb, several matches to the ecdysone response element (EcRE) consensus sequence were identified, including some in the amplification origin region. EcRE O-P is at a central axis of a remarkable symmetry, equidistant to the TPs that are themselves equidistant to EcRE O-1 and EcRE O-2. DNA sequence alterations have occurred throughout the II/9A region in a newly discovered polymorphism (#2). Polymorphism #2 is not specific to developmental stage, sex, or tissue, and it does not impair DNA amplification. The DHS, both 9bp TP sequences, and EcREs O-1, O-P, and O-2 are conserved between the polymorphism #1 and #2 sequences, suggesting their functional importance and retention during evolutionary selection. Moreover, a 72 bp sequence in the Sciara DHS at DNA puff II/9A is conserved in DNA puff C-3 of Rhynchosciara americana. Comparisons are discussed between the Sciara II/9A amplicon and the chorion locus amplicon on the third chromosome of Drosophila.

Cross-talk of insulin-like peptides, juvenile hormone, and 20-hydroxyecdysone in regulation of metabolism in the mosquito Aedes aegypti

Female mosquitoes feed sequentially on carbohydrates (nectar) and proteins (blood) during each gonadotrophic cycle to become reproductively competent and effective disease vectors. Accordingly, metabolism is synchronized to support this reproductive cyclicity. However, regulatory pathways linking metabolism to reproductive cycles are not fully understood. Two key hormones, juvenile hormone (JH) and ecdysteroids (20-hydroxyecdysone, 20E, is the most active form) govern female mosquito reproduction. Aedes aegypti genome codes for eight insulin-like peptides (ILPs) that are critical for controlling metabolism. We examined the effects of the JH and 20E pathways on mosquito ILP expression to decipher regulation of metabolism in a reproducing female mosquito. Chromatin immunoprecipitation assays showed genomic interactions between ilp genes and the JH receptor, methoprene-tolerant, a transcription factor, Krüppel homolog 1 (Kr-h1), and two isoforms of the ecdysone response early gene, E74. The luciferase reporter assays showed that Kr-h1 activates ilps 2, 6, and 7, but represses ilps 4 and 5 The 20E pathway displayed the opposite effect in the regulation of ilps E74B repressed ilps 2 and 6, while E74A activated ilps 4 and 5 Combining RNA interference, CRISPR gene tagging and enzyme-linked immunosorbent assay, we have shown that the JH and 20E regulate protein levels of all eight Ae. aegypti ILPs. Thus, we have established a regulatory axis between ILPs, JH, and 20E in coordination of metabolism during gonadotrophic cycles of Ae. aegypti.

Genome-wide identification of target genes for transcription factor BR-C in the silkworm, Bombyx mori.

Transcription factor Broad Complex (BR-C) is an ecdysone primary response gene in insects and participates in the regulation of insect growth and development. In this study, we performed a genome-wide identification of BR-C target genes in silkworm (Bombyx mori) using chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq). As a result, a total of 1006 BR-C ChIP peaks were identified, and 15% of peaks were located in the promoter regions of 133 protein-coding genes. Functional annotation revealed that these ChIP peak-associated genes, as potential BR-C targets, were enriched in pathways related to biosynthetic process, metabolic process, and development. Transcriptome analysis and quantitative real-time polymerase chain reaction (PCR) examination revealed that developmental changes in expression patterns of a portion of potential BR-C targets, including HR96 and GC-α1, were similar to those of BR-C. ChIP-PCR examination confirmed that BR-C could directly bind to the promoters of potential targets. Further, dual luciferase assays demonstrated that HR96 promoter activity was significantly upregulated following BR-C overexpression, and this upregulation was abolished when the binding motif in the promoter was truncated. This study will be helpful for deciphering the regulatory roles of BR-C during insect growth and development.