East Nusa Tenggara Province Research Articles

IMPLEMENTATION OF THE NORTH CENTRAL TIMOR REGENT INSTRUCTION NUMBER: DPMD 413.4/208/VI/2019 AS A STUNTING MANAGEMENT EFFORT IN THE BORDER AREA OF THE REPUBLIC OF INDONESIA - DEMOCRATIC REPUBLIC OF TIMOR LESTE (RI-RDTL)

<span lang="EN-US">Basic Health Research Results In 2018 show the prevalence of stunting in a national toddler by 30.8 percent including high if referring to WHO data that prevalence must be less than 20 percent. The highest stunting is found in East Nusa Tenggara Province by 42.6 percent. The North Central Timor Regency which is a border district found a prevalence of stunting data by 51.8% in 2018 where this figure is the highest in East Nusa Tenggara Province. Looking at this problem the regional government issued a Regent's instructions Number: DPMD 413.4 / 208 / VI / 2019 concerning the budgeting of village funds and village funds for the prevention and decrease of stunting in the village in 2019. The results showed that the regent's instructions were quite effective in pressing the number of stunting where there was a decline significantly where in February 2021 the prevalence rate gradually declined to reach 26.1%. However, the stunting figure in North Insana Subdistrict and Bikomi Nilulat Subdistrict, which is the border sub-district of its prevalence figure is still below 20% of 31%. The problem found is the mechanism of implementation is still hit by the attitude of the apathetic society and the condition of Covid 19 decisions 31%.</span>

Model Pembelajaran Kooperatif Tipe Jigsaw Untuk Meningkatkan Hasil Belajar Peserta Didik Kelas X Materi Litosfer Di Sma Swasta Maharani Tahun Ajaran 2022/2023

The problem at Maharani Private High School is that teachers or educators still use conventional methods so that students become passive in class and students' low understanding of the subject of geography, lithosphere material, which still contains many concepts, makes students feel bored, lazy, and this affects the results. learning and obtained by students whose grades do not meet the standard criteria for maximum completeness. The minimum standard for completion criteria (KKM) in geography subjects at Maharani Private High School is 75. This classroom action research aims to 1) find out the application of the jigsaw type cooperative learning model, 2) to find out the development of class X students' learning outcomes regarding lithosphere materials and types of rocks after using a jigsaw type learning model. The method used in this research is classroom action research or PTK using a jigsaw type cooperative learning model for class X students with research subjects of 20 students. The location of this research is Maharani Private High School for the 2022/2023 academic year, Weliman District, Malaka Regency, East Nusa Tenggara Province. This classroom action research was carried out in two cycles consisting of four stages including planning, observation, implementation and reflection. This research data was analyzed qualitatively descriptively. The results of this research show that using the jigsaw type cooperative learning model can improve the learning outcomes of class X SMA students on lithosphere material. The research results obtained for the first cycle of student learning outcomes were 6 students who completed with a percentage of 30% and as many as 14 students who did not complete or 70% of the 20 students, meanwhile, in cycle II the students who completed experienced an increase, namely 19 students. or as many as 95% and 1 student who did not complete or only 5% in cycle II. It can be concluded that using the jigsaw type learning model can significantly improve student learning outcomes in geography subjects on lithosphere material at Maharani Private High School for the 2022/2023 academic year.

Exploring the antagonist potential of indigenous Trichoderma spp., Bacillus, and Pseudomonas against Phytophthora palmivora of Soe mandarin in East Nusa Tenggara, Indonesia

Phytophthora palmivora-induced root and basal stem rot pose a significant threat to the survival of Soe mandarin plants in East Nusa Tenggara Province, Indonesia. We isolated four Trichoderma species, five Bacillus, and 13 Pseudomonas isolates from the rhizosphere of healthy Soe mandarin. This study pursued two main objectives: (a) assessing the inhibitory capabilities of indigenous Trichoderma spp., Bacillus, and Pseudomonas towards P. palmivora in vitro, and (b) investigating the combined efficacy of Trichoderma spp., Bacillus, and Pseudomonas in controlling P. palmivora in a pot trial. Results revealed that four Trichoderma species (T. asperellum, T. hamatum, T. harzianum, and T. viride) significantly inhibited the growth of P. palmivora. Notably, T. asperellum exhibited the highest inhibition, at 84.31%, followed closely by T. harzianum (84.11%), T. viride (83.67%), and T. hamatum (80.28%). Bacillus and Pseudomonas exhibited varying levels of inhibition to P. palmivora growth in vitro, with the most substantial inhibition observed in Bacillus 1, followed by Pseudomonas 6. In the subsequent pot trial, the application of Trichoderma, Bacillus, or Pseudomonas, either individually or in combination, significantly increased the height increment and reduced the disease incidence caused by P. palmivora in Soe mandarin seedlings.

Determinants of child stunting in the dryland area of East Nusa Tenggara Province, Indonesia: insights from a national-level survey.

Stunting remains a critical public health issue in Indonesia, particularly in the province of East Nusa Tenggara. This region, characterized by its archipelagic dryland geography, has reported the highest prevalence of stunting among children under five from 2007 to 2021. The study aimed to examine the relationship between various characteristics of children under five and household factors with the occurrence of stunting. This observational study, with a cross-sectional design, used secondary data from the 2021 Indonesian Nutrition Status Survey, covering 7,835 children under five. We analyzed the data to identify patterns and relationships, using univariate analysis to display percentage distributions and bivariate analysis through multiple binary logistic regression tests. The results of the multiple logistic regression test showed that indicators of family characteristics such as age, gender, low birth weight, body length, possession of birth certificates, and receiving complementary feeding were all related to stunting. Additionally, household factors such as toilet type, National Health Insurance coverage, ownership of a Prosperous Family Card, and residential area were significant determinants. Factors contributing to stunting in dryland areas include a range of elements from both family characteristics-such as age, gender, birth certification, low birth weight, and initial body length, to the introduction of supplementary feeding-and household indicators, including the use of specific types of latrines (Plengsengan and Cemplung types without covers), health insurance coverage, possession of Prosperous Family Cards, and the family's residential area.

Factors Affecting Chronic Energy Deficiency among Pregnant Women in East Nusa Tenggara Province, Indonesia

This study aims to investigate the relationship between maternal and household characteristics with the Chronic Energy Deficiency (CED) occurrence among pregnant women in East Nusa Tenggara (ENT). CED was observed through Mid-Upper Arm Circumference (MUAC) measurement of <23.5 cm. Utilizing a cross-sectional design using secondary data from the 2018 Indonesia Basic Health Survey (Riskesdas) involving 387 pregnant women. Bivariate analysis (chi-square test) and multivariate analysis (multiple logistic regression) were conducted. Significant associations with the CED included parity (p=0.002), education level (p=0.018), access to hospital (transportation mode) (p=0.032), and access to primary healthcare facilities (travel time) (p=0.032). Multivariate analysis identified parity as the most influential variable for the CED occurrence among pregnant women (p=0.016; OR=1.868). In conclusion, mothers with a parity of less than two or more than three children had a higher risk of experiencing CED during pregnancy in ENT. To prevent CED and its consequences, it is recommended to emphasize family planning, address parity concerns, and prioritize maternal nutritional status before and during pregnancy.

Distribution of Stunting and Determinants of Stunting in the Province of East Nusa Tenggara, Indonesia in 2021:A Spatial Analysis

The problem of stunting is still fundamental in Indonesia's human development. East Nusa Tenggara Province is an archipelago dryland area with the highest prevalence of stunted children under five in Indonesia. This study aims to determine the relationship of child characteristics with the prevalence of stunting. This type of research is an observational study with a cross-sectional design. This study used individual secondary data from the Indonesian Nutritional Status Survey in 2021 consisting of 7,835 children under five. The results of the spatial analysis showed that in the child's characteristic factor, there was a relationship between short birth length and low birth weight with stunting prevalence. It is hoped that there will be a special model of stunting control interventions that are integrated and of high quality through multisectoral cooperation in the dryland areas of the islands of East Nusa Tenggara Province.

Characteristics and clinical outcomes of patients with pre-delta, delta and omicron SARS-CoV-2 infection in Indonesia (2020–2023): a multicentre prospective cohort study

Limited data exist from southeast Asia on the impact of SARS-CoV-2 variants and inactivated vaccines on disease severity and death among patients hospitalised with COVID-19. A multicentre hospital-based prospective cohort was enrolled from September 2020 through January 2023, spanning pre-delta, delta, and omicron periods. The participant hospitals were conveniently sampled based on existing collaborations, site willingness and available study resources, and included six urban and two rural general hospitals from East Nusa Tenggara, Jakarta, and North Sumatra provinces. Factors associated with severe disease and day-28 mortality were examined using logistic and Cox regression. Among 822 participants, the age-adjusted percentage of severe disease was 26.8% (95% CI 22.7-30.9) for pre-delta, 50.1% (44.0-56.2) for delta, and 15.2% (9.7-20.7) for omicron. The odds of severe disease were 64% (18-84%) lower for omicron than delta (p<0.001). One or more vaccine doses reduced the odds of severe disease by 89% (65-97%) for delta and 98% (91-100%) for omicron. Age-adjusted mortality was 11.9% (8.8-15.0) for pre-delta, 24.4% (18.8-29.9) for delta and 9.6% (5.2-14.0) for omicron. The day-28 cumulative incidence of death was lower for omicron (9.2% [5.6-13.9%]) than delta (28.6% [22.0-35.5%]) (p<0.001). Severe disease on admission was the predominant prognostic factor for death (aHR34.0 [16.6-69.9] vs mild-or-moderate; p<0.001). After controlling for disease severity on admission as an intermediate, the risk of death was 48% (32-60%) lower for omicron than delta (p<0.001); and 51% (38-61%; p<0.001) lower for vaccinated participants than unvaccinated participants overall, and 56% (37-69%; p<0.001) for omicron, 46% (-5 to 73%; p=0.070) for pre-delta (not estimable for delta). Infections by omicron variant resulted in less severe and fatal outcomes than delta in hospitalised patients in Indonesia. However, older, and unvaccinated individuals remained at greater risk of adverse outcomes. University of Oxford and Wellcome Trust.

Does the Nutritional Status of Stunted Toddlers have a Correlation with their Dietary Diversity and Clean Water Sources?

Background: Consumption of a diverse diet and having an improved source of clean water are important factors that can help prevent stunting. Most toddlers both in Indonesia and in East Nusa Tenggara Province have a lack of dietary diversity and consumed clean water from unimproved sources. These conditions affect the nutritional status of toddlers and can have a long impact if not immediately treated. Aim: To analyze the correlation between dietary diversity and source of clean water consumed with nutritional status of stunted toddlers in Kupang Regency. Methods: This research uses secondary data were collected by Indonesian Community Care Network Foundation which came from Tesabela, Bolok, Lifuleo and Sumlili Village. This research used a cross sectional study with a restrospective approach. Total research data was 70 data obtained with a total sampling technique used the inclusion criteria, data stunted toddlers aged 12-59 months and data stunted toddlers from Indonesian Community Care Network Foundation that are complete according to the researcher's needs and the exclusion criteria, incomplete data Indonesian Community Care Network Foundation. Data dietary diversity and clean water sources consumed by subjects were analyzed using rho spearman test. Results: There is a significant correlation between dietary diversity and source of clean water consumed with nutritional status of stunted toddlers as indicated by a significance value of p &lt; 0.001 with a positive or unidirectional correlation. Conclusion: There is a significant correlation between dietary diversity and source of clean water consumed with nutritional status of stunted toddlers in Kupang Regency.

Health Indicators for Accelerating Stunting Reduction: Family Practices in Indonesian Borderland

Background: The Indonesian government has established the latest family-based approach to implement the national strategy to accelerate the reduction of stunting in Indonesia through a family-based intervention approach. Family-based intervention is proven scientifically efective in preventing growth retardation in children under five. However, this research was conducted on families with children aged 0-2 years so that all of the presented problems can be used as a reference in providing family-based interventions. This study aims to describe family health practices in preventing stunting among the people in the border areas of Indonesia and Timor Leste. Subjects and Method: This was a quantitative descriptive study with a cross-sectional design, conducted from May to June 2022. A total of 257 families (out of a total population of 566) with children aged 0-24 months spread across 16 integrated healthcare centers (Posyandu) at the Haliwen Health Center, Belu District, East Nusa Tenggara Province, Indonesia. The subjects in this study were selected by simple random sampling. The single variable in this study was family health practices in preventing stunting, consists of 18 indicators adopted and elaborated from presidential regulation 72 concerning accelerating the reduction of stunting. the data collected by a set of questionnaires. The data analyze by univariate analysis to describe frequency (n) and percentage (%) of each indicators. Results: Out of a total of 18 assessed indicators, most families still use open garbage cans, burning garbage for destruction, and did not carry out pre-marital health screening. Conclusion: The results of this study showed that most of the health indicators had been carried out by families with infants under two years old. It is in line with the growth status of under-two, most of whom are not stunted. Keywords: stunting, children under two, family-based intervention. Correspondence: Maria Paula Marla Nahak. Nursing study program, Universitas Timor, Indonesia. Jln. El Tari - Km. 09, Sasi, Kefamenanu, Timor Tengah Utara, Nusa Tenggara Timur, Indonesia. Email: paulamarla@­unimor.ac.id.

Re-evaluation of a geothermal system model based on high-resolution gravity field inversion: A case study of the Maritaing geothermal field, Alor Regency, East Nusa Tenggara Province, Indonesia

The Maritaing region in East Nusa Tenggara Province, Indonesia, offers significant geothermal potential for direct power generation and use. This study aims to re-evaluate the geothermal system model in the Maritaing geothermal field using high-resolution gravity inversion. High-resolution gravimetric data were collected using satellite observations and data processing techniques, allowing a better understanding of the subsurface geological structure and density distribution of rocks associated with the geothermal reservoir. This study applied data corrections to acquire complete Bouguer anomalies, gravity gradient analysis to detect geological structures, and inversion modeling of residual gravity anomalies to predict subsurface rock density distribution. The complete Bouguer anomalies exhibit positive values ranging from 70 to 140 mGal and have a northwest–southeast orientation, indicating the existence of andesitic lava and pyroclastic volcanic rocks. Gravity gradient analysis determines the geological structures, such as faults or fractures, used as conduits to create Kura Hot Springs. The model provides useful insights into geological occurrences, such as faults, rock layers, and reservoir accumulations that support geothermal fluids. Based on the present study’s findings, we provide recommendations for developing and managing geothermal resources in the Maritaing area.

The Effectiveness of Community Organizations (Ormas) in Maintaining Cultural Diversity in the Community of Gorontalo Village, Komodo District, West Manggarai Regency

Wibowo &amp; Harefa (2015), the form of implementation of everyone's right to gather, express opinions and associate is the formation of community organizations (Ormas). This was further realized with Law Number 16 of 2017 concerning amendments to Law Number 17 of 2013 concerning Community Organizations. Community Organizations, hereinafter referred to as Ormas, are associations created by the community and formed based on the same aspirations, goals and ideals based on voluntary aspects to participate in development as a form of support in achieving state goals based on Pancasila and the 1945 Constitution. Community Organizations have a function as intermediaries to provide aspirations and participation of the community in government, as a forum that provides protection to the community itself, functions to maintain customs and culture as well as religious values, preserve and maintain existing norms in society, both moral and ethical. , and culture that lives in society, and other functions stated in the applicable laws and regulations. The existence of mass organizations is expected to act as a mouthpiece for the people of the area who have united them. Culture is viewed in a completely aesthetic way. What Kleden explains, if it is related to the context of caci, mbata, sanda, danding, etc., seems to be challenged in the midst of today's cultural modernization. Therefore, such cultural heritage should be interpreted as a whole (totality) as a characteristic of Manggarai culture. In the context of caci, it is actually a strategic event in terms of promoting regional tourism. The dance of mutual whipping between adult men (caci) should have a legal basis in the form of regional regulations. This is the task of the regional parliament (DPRD) to make regional regulations. The method used in this research is a descriptive qualitative method which aims to describe the forms, uniqueness and variety of culture of the Manggarai people. The main instrument in this research is own research. The types of data used in this research are primary and secondary data, primary data is data obtained from interviews or observations. Meanwhile, secondary data is data obtained from the results of reviewing reference books or documentation. Community perception of the cultural diversity of Manggarai, especially Gorontalo Village, Komodo District, West Manggarai Regency, East Nusa Tenggara Province. The Gorontalo Village community is very enthusiastic about the cultural diversity of Manggarai by continuing to regenerate this cultural diversity in the younger generations so that cultural diversity continues to exist in the Manggarai community in general and in the Gorontalo Village community in particular.

Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.

Sociological Study on the Participation of Pentahelix Elements in the Reduction of Stunting in Oefafi Bethel Church, East Kupang District, Kupang Regency, East Nusa Tenggara Province

Pentahelix element participation refers to collaboration between various important elements in society, such as government, private sector, civil society organizations, academics, media, and individuals to overcome the problem of stunting in children. Stunting is a public health problem that occurs due to malnutrition and lack of care during the growth and development of children. Through this collaboration, efforts are made to increase public understanding of the importance of proper nutrition and care for children and improve access and availability of nutritious food. In addition, efforts were also made to improve the availability of clean water and good sanitation, also strengthen the health system to provide adequate health services for children and mothers. The participation of Pentahelix elements can produce an integrated and sustainable strategy in dealing with stunting problems in children. This method can help improve the quality of human resources in the future and strengthen sustainable development.

Time Series Ecological Coastal Resilience in Ende City, Indonesia

Ende city is a coastal area that is one of cities in East Nusa Tenggara province. There are risk that threatens the city and coastal area originating from natural disasters and human activity. It is necessary to assess and monitor coastal resilience of this city since abrupt change of city landscape has impact on ecosystem resilience. Therefore, the aim of this research is to measure and analyze ecological coastal resilience from 2016 to 2021. Coastal resilience can be assessed from ecosystem-ecology approach so that sustainability of coastal community can be strengthening. Landscape parameter of typology was used to measure ecological resilience in coastal ecosystem of Ende City. One of widely used approach to measure ecological resilience is applying a variety of different indicator or metric of resilience. Parameter of resilience is scored and classified for each typology in coastal area of Ende City. Research method includes field survey, in depth interview and focus group discussions. One of method to determine coastal resilience classification is from resilience index. Based on result, coastal resilience is mostly moderate class in Ende City. The lowest class of resilience index is in volcanic coast typology.

Reducing Risks Of Income Of The Small Dry Land Maize Farmers In East Nusa Tenggara Province, Indonesia

Reducing Risks Of Income Of The Small Dry Land Maize Farmers In East Nusa Tenggara Province, Indonesia

Exploring the Reality of Poverty in East Nusa Tenggara, Indonesia. A Sociological Approach

This article discusses about poverty in East Nusa Tenggara Province, Indonesia from a sociological perspective. The aim is to find out the causes of poverty and the possible solutions. Using library research and qualitative approach, poverty is discussed and analyzed in order to explore aspects related to it. The findings indicate that poverty in East Nusa Tenggara is multidimensional in its indicators and causes. Three main causes of poverty are natural factors, human factors and structural factors. This study recommends that development in NTT be based on ethical and moral principles such as respect for human dignity, common good, sustainability, participation and cooperation, so that state administrators or public servants in NTT carry out their functions with full dedication and responsibility and avoid corrupt and exploitative behavior. Also, there is an urgent need to develop a “habitus” of bringing this issue into public sphere, in which people of every level in society can participate in public debates on how to overcome poverty in NTT by understanding its root-causes and strategies to solve the problem.

Molecular identification of new Trypanosoma evansi type non-A/B isolates from buffaloes and cattle in Indonesia.

Trypanosoma evansi is reportedly divided into two genotypes: types A and B. The type B is uncommon and reportedly limited to Africa: Kenya Sudan, and Ethiopia. In contrast, type A has been widely reported in Africa, South America, and Asia. However, Trypanosoma evansi type non-A/B has never been reported. Therefore, this study aims to determine the species and genotype of the Trypanozoon subgenus using a robust identification algorithm. Forty-three trypanosoma isolates from Indonesia were identified as Trypanosoma evansi using a molecular identification algorithm. Further identification showed that 39 isolates were type A and 4 isolates were possibly non-A/B types. The PML, AMN-SB1, and STENT3 isolates were likely non-A/B type Trypanosoma evansi isolated from buffalo, while the PDE isolates were isolated from cattle. Cladistic analysis revealed that Indonesian Trypanosoma evansi was divided into seven clusters based on the gRNA-kDNA minicircle gene. Clusters 6 and 7 are each divided into two sub-clusters. The areas with the highest genetic diversity are the provinces of Banten, Central Java (included Yogyakarta), and East Nusa Tenggara. The Central Java (including Yogyakarta) and East Nusa Tenggara provinces, each have four sub-clusters, while Banten has three.

Challenges and Opportunities of Implementing Marine Ecological Carrying Capacity Index in the Blue Economy: A Case Study of Coastal Communities in East Nusa Tenggara Province

An emerging concept of the “Blue Economy” emphasizes using ocean resources sustainably to improve livelihoods and spur economic growth while marine ecosystems are kept in good condition. Utilising the Marine Ecological Carrying Capacity (MECC) Index, one can determine how well marine ecosystems can support human activity while preserving their ecological integrity. By a case study in the East Nusa Tenggara coastal area, this study aims to evaluate the opportunities and challenges associated with implementing the MECC in the Blue Economy scheme. The case study has been analysed using a comprehensive evaluation index system for coordinated development among marine resources, the environment, and social-ecological systems. The study also reviews relevant literature on the Blue Economy and the New Ocean Economy. The study has offered a quantitative evaluation of the Blue Economy Index’s economic effects, with an emphasis on Indonesia. The study found that effective implementation of the Index in the Blue Economy could increase the ocean economy’s contribution to East Nusa Tenggara’s GDP by at least 2–3%.

The Influence of Gross Regional Domestic Product (PDRB), Education Health, and Unemploymenton The Poverty Rate in Regencies/Cities of East Nusa Tenggara Province

This research aims to determine and analyze the influence of Gross Regional Domestic Product (PDRB), length of schooling (education), life expectancy (health), and unemployment rate on the poverty rate in regencies or cities of East Nusa Tenggara Province.The method used is panel data regression, combining time series data from 22 regencies/cities and cross-sectional data from 2011 to 2022. There are three models in panel data regression: Pooled Least Squares (PLS), Fixed Effects Model (FEM), and Random Effects Model (REM). Based on the Hausman test, the model used in this research is the Random Effects Model (REM). The results of the research show that simultaneously, PDRB, education, health, and unemployment significantly influence the poverty rate. Partially, the PDRB variable and life expectancy (health) have a negative effect, while unemployment has a positive effect on the poverty rate. However, the length of schooling variable (education) does not have an influence on the poverty rate.

STRATEGI PEMERINTAH INDONESIA DALAM MENINGKATKAN KEAMANAN WILAYAH PERBATASAN MENURUT PERSPEKTIF SOSIAL PEMBANGUNAN

The national development of the Unitary State of the Republic of Indonesia (NKRI) aims to realize equal distribution of people's welfare throughout the region, including border areas where until now there are still problems related to welfare. The border area essentially has a very vital and strategic meaning, at least when viewed from 3 (three) points of view, namely: defense-security, economic-trade, and socio-cultural. Therefore, a strategy is needed to improve the security of border areas according to the social perspective of development. This study used qualitative descriptive method, with data collection using interviews, observation, and documentation. Data analysis techniques use triangulation. This research shows that the strategy that can be carried out by the Indonesian government in overcoming problems in order to improve border area security according to the social perspective of border development of the Republic of Indonesia (RI) – Democratic Republic of Timor Leste (RDTL) in Atambua, Belu Regency, East Nusa Tenggara Province, among others, through Economic Development, Infrastructure, Human Resource Development, Social Welfare Programs, Diplomacy and Regional Cooperation, Community Empowerment, Cultural and Social Security, Law Enforcement, and Social Security.