DNA Beta Research Articles

Enhancing environmental DNA metabarcoding from marine ecosystems: Impact of filter type, storage method, and storage time on the assessment of fish alpha and beta diversity

AbstractThe collection of environmental DNA (eDNA) and subsequent metabarcoding are useful tools for assessing marine fish biodiversity noninvasively. It is of particular importance to evaluate biodiversity in regions that are hard to access and thus less well studied. Sampling and preservation methods tailored to the specific circumstances are required. Aquatic eDNA is often captured on filters made of different materials and pore sizes, and subsequently stored under divergent conditions for varying periods of time. Previous studies on multispecies detection in marine systems have primarily focused on capture and extraction effects. Our study, in contrast, examined the effects of filter type, storage method, and storage time on DNA yield, alpha (i.e., ZOTU richness) and beta diversity (i.e., ZOTU composition) recovered from a marine ecosystem in Shark Bay, Western Australia. We compared two different filter types (cellulose‐nitrate filters with pore sizes of 0.45 μm; glass‐fiber filters with pore sizes of 0.1 μm), two storage methods (preservation in Longmire's solution and drying, respectively), various storage times (30–68 days) on two metabarcoding assays using different fish‐specific primers. Our results showed that storage time decreased DNA yield and affected alpha and beta diversity estimates. Cellulose‐nitrate filters stored in Longmire's solution proved to be the best combination with the smallest decrease in DNA yield, no effect on alpha diversity and consistent community compositions. Storing glass‐fiber filters in Longmire's solution led to a decrease in eDNA yield and alpha diversity estimates with increasing storage time. Furthermore, the largest change in beta diversity for each metabarcode was found for glass‐fiber filters regardless of storage method. Our results highlight the importance of considering storage time and interactions between storage method and filter when analyzing eDNA results, especially when storing samples for an extended time period or comparison of samples stored for different durations.

Genome organization of satellite DNA beta molecule associated with Mungbean yellow mosaic India virus Gujarat, India

Recent advancements in genomics have unveiled fascinating insights into the intricate world of plant pathogens. The discovery of an intriguing association between the DNA beta and MYMIV-[IN:Ana: CpMBKA25:04], a strain containing 1367 base pairs of nucleotides, has sparked a wave of scientific curiosity. Through sequence identity matrix analysis, it was revealed that this strain shares a striking 96% similarity with the Potato apical leaf curl virus, closely followed by the Tomato leaf curl beta satellite virus [Accession No. AY230138] at 95.3%. In contrast, its relationship with the beta satellite Bhendi yellow vein beta satellite [Accession No. AJ308425] stood at a comparative 45.7% when compared against seventeen other DNA beta isolates infecting various crops. Noteworthy features of the beta satellite sequences include a distinctive putative stem-loop structure TAATATT/AC in the common region and a recurring GCTACGC repeat sequence. An A-rich region spanning from nucleotides 910 to 1120 further adds to the genetic complexity of this novel strain. Intriguingly, an analysis of the amino acid sequence unveiled additional residues V, C, and N at the carboxyl end of the βC1 protein, setting it apart from its counterparts. The identity matrix analysis established a 95.9% similarity between βC1 and the beta satellite associated with Tomato leaf curl Karnataka virus and Potato apical leaf curl virus, phylogenetic analysis placed the beta satellite linked with MYMIV-[IN:Ana: CpMBKA25:04] in a distinct category within the Papaya leaf curl virus family, shedding light on its unique evolutionary lineage and biological significance in the realm of plant virology.

First report of Ludwigia yellow vein Vietnam virus causing leaf curling on tobacco plants in Hainan province, China.

Cigar tobacco (Nicotiana tabacum L.) has been recently introduced into China for various industrial applications. From March 2022, certain symptoms of begomovirus infection, including leaf curling and thickening of veins, were sporadically (disease incidence was approximately 0.2%) observed in several cigar tobacco plantations in numerous counties in Hainan Province, China (Figure 1A). These typical symptoms of begomovirus infection were similar to those caused by the sida leaf curl virus-Hainan (SiLCV-HN) begomovirus and its associated betasatellite, as reported in our previous study on cigar tobacco plants in the same region (Wang et al. 2022). In order to determine whether these symptoms were caused by SiLCV-HN or other begomoviruses, samples of leaves were collected from the diseased tobacco plants for DNA extraction, and the total DNA was extracted for viral metagenomics using an Illumina Sequencing platform at Tiangen Biotech, Beijing. A total of 65711396 filtered reads were obtained, of which 65362322 (99.47%) reads matched to the genome of tobacco. The remaining unmapped 349074 (0.53%) reads were analyzed by BLASTn against the virus Refseq Database of GenBank and subsequently assembled. A total of 8 (5+2+1) enriched contigs of the complete sequence of ludwigia yellow vein Vietnam virus (LuYVVNV) and 9 (8+1) contigs of ludwigia yellow vein virus-associated DNA beta (LuYVB) were finally obtained (Table 1). LuYVVNV belongs to the Begomovirus genus that infects various weeds, including Ludwigia octovalvis and Impatiens balsamina. As far as we know, it was reported earliest on weed in Vietnam (Ha et al. 2008). GenBank contains data pertaining to previously identified isolates of LuYVVNV, and the data revealed that the virus was discovered in Vietnam and the Yunnan province of China currently. However, there are no reports on the infection of crops by LuYVVNV to date. The findings of the present study indicated that LuYVVNV and LuYVB could be responsible for the aforementioned symptoms observed on cigar tobacco. The complete genomes of LuYVVNV and LuYVB were amplified using primer pairs designed based on sequence assembly for viral metagenomics (Table 2). Indeed, two DNA bands with length 2763 bp of LuYVVNV genome and 1348 bp of LuYVB were amplified from leaf samples of diseased tobacco (Figure 1B). The products of polymerase chain reaction (PCR) amplification were analyzed by Sanger sequencing, and the complete nucleotide sequences of LuYVVNV and its associated betasatellite were obtained. Analysis with the BLASTn tool of NCBI revealed that the genome sequence of LuYVVNV isolated from the Hainan province of China had the highest identity of 96.9% to a different isolate of LuYVVNV (GenBank accession number: MN210347.1). These two isolates belong to the same strain, according to the latest revision of Begomovirus taxonomy (Brown et al. 2015). The isolate of LuYVVNV identified in this study was designated as LuYVVNV, Hainan isolate (LuYVVNV-HN, GenBank accession number: OP948731). BLASTn analysis further revealed that the associated betasatellite had the highest sequence identity of 96.9% with an LuYVB (GenBank accession number: AJ965541.1) of a different viral isolate, according to the classification and nomenclature of DNA betasatellites of begomoviruses (Briddon et al. 2008). The sequence of LuYVB obtained herein was therefore designated as LuYVB, Hainan isolate (LuYVB-HN, GenBank accession number: OP948732). The pathogenicity of LuYVVNV-HN and LuYVB-HN was determined using infectious clones that were constructed by ligating two fragments of LuYVVNV-HN or LuYVB-HN to a binary pCAMBIA1300 expression vector, as previously described (Wang et al. 2019). Infectious clones of LuYVVNV-HN, LuYVB-HN, and LuYVVNV-HN plus LuYVB-HN were separately agroinfiltrated into N. benthamiana for determining viral pathogenicity. The typical symptoms of begomovirus infection were observed in N. benthamiana plants inoculated with LuYVVNV-HN alone or LuYVVNV-HN plus LuYVB-HN, and the emerging leaves were mildly or severely down-curled, respectively, at 7 days post inoculation (dpi), with 100% disease incidence (6/6) (Figure 1C). Positive PCR products of the AV1 gene of LuYVVNV-HN were obtained from N. benthamiana plants inoculated with LuYVVNV-HN alone or LuYVVNV-HN plus LuYVB-HN. The βC1 gene of LuYVB-HN was only obtained from N. benthamiana plants co-infected with LuYVVNV-HN and LuYVB-HN (Figure 1D). No symptoms of viral infection were observed in plants individually inoculated with LuYVB-HN, and the results of PCR were negative (Figure 1C and 1D). These findings indicated that the N. benthamiana plants had been successfully inoculated with LuYVVNV-HN, and that LuYVB-HN was incapable of causing infections on its own, but functioned as a helper and enhanced viral pathogenicity. This report is the first to identify isolates of LuYVVNV and LuYVB from cigar tobacco, which is an economically important crop plant. The findings provide insights into the epidemic threat of begomovirus reservoirs in weeds to crop plants, and emphasize the need for monitoring and controlling whitefly-transmitted viral diseases in tobacco plantations worldwide (Ye et al. 2021).

First Report of the Satellite DNA Beta Associated with Tomato Yellow Leaf Curl Virus – Mild on Tomato in Iraq

In November 2021, severe symptoms of TYLCV disease were observed in tomato fields in Karbala Province, Iraq. Symptomatic tomato samples were observed on 20 to 30% of plants. Samples of symptomatic plants were collected randomly. TYLCV-specific PCR primers were employed to confirm the presence of the virus. Total DNA was extracted and used as templates for next-generation sequencing. The unmapped reads were subjected to de novo assembly. The contigs assembled were compared with GenBank data of plant viruses. A BLASTn analysis revealed 99.34% similarity with tomato yellow leaf curl virus-mild (MT583814.1). This finding was confirmed by a PCR test using specific primers. Additionally, there was 94.66% pairwise identity with cotton leaf curl Gezira betasatellite (CLCuGB) isolate Al-Ain (KM279620.1). The universal primer pair for detection of betasatellites was applied, followed by Sanger sequencing of the amplicons, which confirmed the infection of all the tested plants with CLCuGB. The DNA sequence of CLCuGB has accession number ON206651. To verify the presence of TYLCV-mild and betasatellite, a field survey was conducted in the main regions of tomato cultivation in Karbala Province, Iraq, in November 2021. Symptomatic leaf samples were collected randomly from 40 fields and analyzed for virus infections. This analysis revealed that the virus and its satellite are distributed throughout the province. To our knowledge, this is the first record of occurrence and complete genome sequence of CLCuGB, associated with TYLCV-mild, in tomato fields in Iraq.

BEGOMOVIRUSES AND BETASATELLITES ASSOCIATED WITH CLCuD

Begomoviruses are one of the major types of plant viruses. They are transmitted by whitefly and cause many diseases. The CLCuD is the most damaging disease of cotton. It is the vector of begomoviruses, namely as monpartite or bipartite begomoviruses. Bipartite begomoviruses are consisted of A and B DNA molecuales. Monopatite consist of single genome. It is mainly linked with alphasatellites and betasatellites. Alphasatellites can replicate by using replication protein and not called as true satellites. Betasatellites are called as true satellites as they are linked with alphasatellites. Mainly cause tomato yellow leaf curl disease. Begomoviruses are different from other plant viruses as the basis of RNA genomes. DNA beta satellite is involves in suppressing the expressions of genes in plants. It has a major role in preventing RNA silencing by encoding proteins that binds with DNA and target the nucleus of cell. Affected plants show various symptoms such as leaf curling, enations etc. that cause loss in cotton field by preventing the growth. With the help of PCR, 1.4 kb fragments of DNA have been amplified from DNA template. For cloning the whole begomoviruses genome, a simple method of cloning has been widely used. Cloning is usually done by using the bacteriophage DNA polymerase. The betasatellites have shown association with CLCuD.

The Roles of DNA Topoisomerase IIβ in Transcription

Type IIA topoisomerases allow DNA double helical strands to pass through each other by generating transient DNA double strand breaks βDSBs), and in so doing, resolve torsional strain that accumulates during transcription, DNA replication, chromosome condensation, chromosome segregation and recombination. Whereas most eukaryotes possess a single type IIA enzyme, vertebrates possess two distinct type IIA topoisomerases, Topo IIα and Topo IIβ. Although the roles of Topo IIα, especially in the context of chromosome condensation and segregation, have been well-studied, the roles of Topo IIβ are only beginning to be illuminated. This review begins with a summary of the initial studies surrounding the discovery and characterization of Topo IIβ and then focuses on the insights gained from more recent studies that have elaborated important functions for Topo IIβ in transcriptional regulation.

First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka

HomePlant DiseaseVol. 101, No. 7First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri LankaC. J. Tharmila, E. C. Jeyaseelan, U. Ihsan, A. C. Wetten, D. M. De Costa, and M. W. ShawC. J. TharmilaSearch for more papers by this author, E. C. JeyaseelanSearch for more papers by this author, U. IhsanSearch for more papers by this author, A. C. WettenSearch for more papers by this author, D. M. De CostaSearch for more papers by this author, and M. W. ShawSearch for more papers by this authorAffiliationsAuthors and Affiliations C. J. Tharmila E. C. Jeyaseelan , Department of Botany, University of Jaffna, Sri Lanka U. Ihsan A. C. Wetten , School of Agriculture, Policy and Development, University of Reading, U.K. D. M. De Costa , Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Sri Lanka M. W. Shaw , School of Agriculture, Policy and Development, University of Reading, U.K. Published Online:14 Apr 2017https://doi.org/10.1094/PDIS-10-16-1492-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Yellow vein mosaic disease (YVMD) is a major biotic constraint on okra (Abelmoschus esculentus) cultivation in Sri Lanka. Diseased plants show characteristic symptoms of mosaic and vein yellowing on leaves and small and yellowish green fruits. Disease incidence was 55 to 70% in three districts (Jaffna, Trincomalee, and Vavuniya) of northern Sri Lanka in 2015. To confirm the identity of the pathogen, symptomatic leaf samples were collected from the above three districts in May and June 2015. In each district, three diseased plant samples were collected from three different farms. DNA of the samples was amplified by PCR using begomovirus specific primers to detect DNA-A (Deng et al. 1994), DNA-B (Rojas et al. 1993), and β-satellite DNA (Briddon et al. 2002). For all samples (27 DNA samples of infected plants), the presence of DNA-A and β-satellite DNA of a monopartite begomovirus was confirmed; however, DNA-B was not detected. A full-length PCR amplified product of the β-satellite DNA of each district was cloned and sequenced. The resulting sequences (GenBank KX174318, KX174319, and KX174322) have several features of begomovirus DNA-β, namely, a conserved nonanucleotide TAATATTAC, which is found in all geminiviruses, a coding sequence for the protein beta-C1, an adenine rich region, and a highly conserved stretch of ∼100 nucleotides upstream of the predicted stem-loop structure. The sequences showed great similarity with several isolates of Bhendi yellow vein mosaic betasatellite (BYVB) in GenBank and were distantly related to begomoviruses previously identified in Sri Lanka: Tomato leaf curl virus associated DNA beta (AJ542493) and Ageratum yellow vein virus associated DNA beta (AJ542498). The complete nucleotide sequences of DNA-A were amplified with three sets of degenerate overlapping primers (Venkataravanappa et al. 2012). The DNA-A sequences assembled from the cloned segments (KX698087, KX698088, and KX698090) have the genome organization characteristic of begomoviruses, encoding six ORFs with two ORFs (AV1 and AV2) in the virion sense strand and four ORFs (AC1-AC4) in the complementary strand, separated by an intergenic region (IR). The IR contains a stem loop structure with the expected conserved nonanucleotide sequence, TAATATTAC. The nucleotide sequence comparisons showed that the genome of DNA-A of the isolates shared 97 to 98% sequence identity with Okra enation leaf curl virus isolates (KT390458, KX553923) and also 97% identity with Mesta yellow vein mosaic virus (KJ462074), and 91% with Indian isolates of Bhendi yellow vein mosaic virus, while it showed ≤80% similarity with other identified Sri Lankan begomoviruses, such as Ageratum yellow vein virus (NC_002981), Chilli leaf curl virus (JN555600), and Cassava mosaic virus (AJ314737). Hence, the virus associated with YVMD of okra has been identified as an isolate of Okra yellow vein mosaic virus. Furthermore, leaf samples collected from infected plants showed positive results to dot blot hybridization using a digoxigenin labeled DNA probe (DIG DNA labeling and detection kits, Sigma Aldrich, U.S.A.), which had been prepared specifically to beta-satellite DNA using the primer pair (BetaF: GGTTCGTTTACATCCATTCCCA, BetaR: TCCATTCGACTTCAACGGT). To our knowledge, this is the first report of Okra yellow vein mosaic virus (OYVMV) associated with yellow vein mosaic disease of okra in Sri Lanka. Identification of OYVMV association with okra will provide the platform for further study, prevention, and control of the disease.

Profiles of teleost DNA fragmentation factor alpha and beta from rock bream (Oplegnathus fasciatus): molecular characterization and genomic structure and gene expression in immune stress

Apoptosis serves to protect normal cells during the processes of development, aging, tissue homeostasis, immunity, and inflammation. Molecules such as caspases, the Bcl-2 family proteins, cytochrome c, APAF-1, and apoptotic endonucleases are concerned with and regulate different stages of apoptosis. DNA fragmentation factor (DFF) is a key final molecule in chromosomal DNA fragmentation during the last step of apoptosis, and is a heterodimeric complex consisting of alpha/inhibitor of caspase-activated DNase (DFFA/ICAD) and beta/caspase-activated DNase (DFFB/CAD) subunits. DFFB/CAD is normally combined with the inhibitor, DFFA/ICAD, in healthy cells. However, after cleavage of the DFF complex by effector caspases, DFFB/CAD acts as an apoptotic nuclease and induces DNA fragmentation in apoptotic cells. The study of DFF proteins is focused on the roles of the apoptotic pathway in mammals. However, gene expression and functions under immune stimulation are not well known in other species. In the present study, we first characterized teleost DFFA/ICAD and DFFB/CAD from rock bream at the molecular level and analyzed the transcriptional expression pattern under immune challenges, to understand their role in immunity. These putative proteins have shown conserved domains and interaction sites orthologous to those of other species. High mRNA expression of both genes was found in the gills and blood of tissues involved in the immune response. The increased expression of DFF genes upon bacterial and viral stimulation was confirmed by qPCR analysis. DFFA/ICAD and DFFB/CAD of rock bream may play a pivotal role in apoptosis and may be involved in host immunity against bacterial and viral infection.

The effects of grape seed on apoptosis-related gene expression and oxidative stress in streptozotocin-induced diabetic rats

Background: Diabetic nephropathy is the most common cause of end-stage renal disease. Emerging evidences indicate that many mechanistic pathways including apoptosis play an important role in the pathogenesis and progression of macrovascular and microvascular complications of diabetes mellitus. The aim of the present study is to show the effects of grape seed extract (GSE) on oxidative stress and apoptosis in the kidney of streptozotocin-induced diabetic rats. Materials and methods: The study included control group, diabetic group without treatment and diabetic group treated with GSE (n = 7) group. GSE was given orally (100 mg/kg/day) for six weeks. Following parameters were evaluated; oxidative stress index, caspase 1, IL1-alpha, caspase 2, IL1-beta, BCL2-associated agonist of cell death (BAD), X-linked inhibitor of apoptosis (XIAP), DNA fragmentation factor, alpha subunit and beta bubunit (DFFA, DFFB), BH3 interacting domain death agonist (BID), caspase 6, Bcl2-like 1 (BCL-XL), caspase 8, tumor necrosis factor receptor superfamily, member 1 b (TNFRSF1B) and IAP-binding mitochondrial protein (DIABLO). Results: Oxidative stress index levels were significantly increased in the kidney of diabetic group without treatment compared to control group, and decreased in diabetic + GSE group compared to diabetic group without treatment. In the kidney of diabetic group without treatment, caspase 1, IL-1 alpha, BAD, DFFA, DFFB and caspase-6 gene expressions were significantly higher compared to control group. In diabetic + GSE group caspase 1, caspase 2, XIAP, DFFA, BID, BCL-XL and TNFRSF1B genes were significantly decreased compared to control group. Conclusions: Grape seed reduces oxidative stress and apoptosis gene expression suggesting the protective effect on diabetic nephropathy.

Comparative analysis of developmentally regulated expressions of Gadd45a, Gadd45b, and Gadd45g in the mouse and marmoset cerebral cortex

The cerebral cortex is an indispensable region that is involved in higher cognitive function in the mammalian brain, and is particularly evolved in the primate brain. It has been demonstrated that cortical areas are formed by both innate and activity-dependent mechanisms. However, it remains unknown what molecular changes induce cortical expansion and complexity during primate evolution. Active DNA methylation/demethylation is one of the epigenetic mechanisms that can modify gene expression via the methylation/demethylation of promoter regions. Three growth arrest and DNA damage-inducible small nuclear proteins, Gadd45 alpha, beta, and gamma, have been identified as regulators of methylation status. To understand the involvement of epigenetic factors in primate cortical evolution, we started by analyzing expression of these demethylation genes in the developing common marmoset (Callithrix jacchus) and mouse (Mus musculus) brain. In the marmoset brain, we found that cortical expression levels of Gadd45 alpha and gamma were reduced during development, whereas there was high expression of Gadd45 beta in some areas of the adult brain, including the prefrontal, temporal, posterior parietal and insula cortices, which are particularly expanded in greater primates and humans. Compared to the marmoset brain, there were no clear regional differences and constant or reduced Gadd45 expression was seen between juvenile and adult mouse brain. Double staining with a neuronal marker revealed that most Gadd45-expressing cells were NeuN-positive neurons. Thus, these results suggest the possibility that differential Gadd45 expression affects neurons, contributing cortical evolution and diversity.

Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan.

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05'06″ N, 35°38'52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production.

Interactions Between the E. Coli Sos Response Protein Umud and DNA Polymerase III Alpha Subunit Have Implications for Regulating Replication in Response to DNA Damage

Faithful and efficient DNA replication is critical for the survival of all organisms; however, DNA is constantly subject to damage from endogenous and exogenous sources. Attempts to replicate damaged DNA can result in harmful mutations. The bacterial SOS response system regulates DNA repair and other pathways responsible for the cellular response to DNA damage. Among genes upregulated during the SOS response is the umuD gene, encoding the manager protein UmuD that subsequently undergoes self-cleavage to remove its N-terminal 24 amino acids to form UmuD'. The umuD gene products are involved in managing the cellular response to DNA damage through their interactions with damage-bypass DNA polymerases DNA pol IV and pol V. UmuD and UmuD' also interact with the alpha DNA polymerase and beta processivity clamp subunits of the replicative DNA polymerase III. We probed the interactions between UmuD or UmuD' and the alpha polymerase subunit and determined that the umuD gene products interact with alpha at two sites: the N-terminal PHP domain, which is responsible for interactions with the epsilon proofreading subunit, and the C-terminal domain, which harbors interaction sites for the beta clamp, the tau subunit of the clamp loader, and single-stranded DNA (ssDNA). The C-terminal domain of alpha preferentially binds to full-length UmuD. With FRET experiments, we subsequently showed that UmuD but not UmuD' inhibits the interaction between alpha and beta, suggesting that early in the SOS response to DNA damage, UmuD could displace alpha from the beta processivity clamp. Furthermore, optical tweezers experiments revealed that UmuD specifically inhibits the interaction between alpha and ssDNA. Together, these observations suggest that UmuD plays a key role in regulating the replication fork after DNA damage.

Suppressors of RNA silencing encoded by tomato leaf curl betasatellites

Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to counter RNA-silencing defense of plants. Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B and ORF beta C1 in satellite DNA beta which are predicted to function as silencing suppressors. In the present study suppressor function of ORF beta C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl Multan betasatellite CLCuMB-[IN:Sri:02] and Luffa leaf distortion betasatellite LuLDB-[IN:Lu:04] were examined. Agroinfiltration of GFP-silenced Nicotiana tabaccum cv. Xanthi with the cells expressing betaC1 protein resulted in reversal of silenced GFP expression. GFP-siRNA level was more than 50-fold lower compared to silenced plants in plants infiltrated with betaC1 gene from ToLCBB. However, in the case of 35S-beta C1 CLCuMB and 35S- beta C1 LuLDB construct, although GFP was expressed, siRNA level was not reduced, indicating that the step at which beta C1 interfere in RNA-silencing pathway is different.

A Gene-Targeting Approach for the Biological Significance of AML1/Runx1 Arginine-Methylation

Abstract 1309Acute Myeloid Leukemia 1 (AML1; also called as Runx1: Runt-related transcription factor 1) belongs to the Class II group of leukemia-associated mutation-target genes, and it encodes the DNA-binding subunit of the hetero-dimeric transcription factor complex, Core-Binding Factor (CBF). CBF plays pivotal roles in initial hematopoietic development during embryogenesis and in cellular differentiation of thrombotic and lymphatic lineages throughout adult life. Recent researches revealed that cellular AML1 polypeptide is processed with post-translational modifications, including phosphorylation, acethylation, ubiquitination, and methylation. Biological significance of these modifications on the AML1's function as the hematopoietic regulator, however, largely remains to be elucidated. In this study, we focused on the arginine-methylation as an initial step towards the comprehensive understanding for the AML1-regulating mechanism through these modifications. Arginine residues just downstream to the Runt-domain, which is located at N-terminal region of the molecule and functions as the binding site to DNA and CBF beta: the hetero-dimerization partner, are recently reported to be methylated, resulting in the inhibition of the corepressor-binding thus enhancing its trans- activating activity. In order to elucidate biological significance of these methylations, we performed a series of genetic experiments: First, we generated the non-methylatable double arginine-to-lysine (RRKK) mutant of AML1 at these residues, which should keep AML1-corepressor-binding. When this mutant was subjected to the luciferase reporter-assay using a target-gene construct, it showed lower trans- activating activity in comparison to that for wild-type molecule, as expected. However, this loss-of-function mutation appeared to be dispensable at least for in vitro function for hematopoietic regulation in that this RRKK mutant did rescue hematopoietic differentiation of the AML1-deficient murine ES cells in culture when expressed from a knock-in allele as was the case for the wild-type cDNA of mouse AML1. To further evaluate the biological activity of this mutant in the context of an entire animal, we introduced this mutant cDNA into AML1/Runx1 locus of mouse ES cells by means of a targeted-insertion (knock-in) strategy. Germline mutant mouse lines were successfully established, following blastocyst-injection of these ES cell clones. Heterozygous mice were healthy and fertile, and genotyping for the live pups generated from heterozygotes-crossing revealed that this arginine-mutant allele segregated according to the Mendelian ratio. Homozygous AML1RRKK/RRKK mice were born alive and grew up adult, circumventing the mid-embryonic death due to hematopoietic block that was originally described for the AML1-deficient mice, thus the in vitro notion that these arginine-methylations were not essential for the early hematopoietic development described above was further underscored. There were no significant differences so far observed in peripheral blood cell counts among mice of the AML1RRKK/RRKK or AML1WT/WT genotypes, in comparison to their wild-type littermates. Preliminary studies revealed that AML1RRKK/RRKK mice showed imbalance of the peripheral T cell populations, implying that these methylations may have roles in these cellular lineages. We are currently focusing on further examination of these mutant mice, paying special attention to the cellular lineages where genetic manifestations were observed for AML1 haploinsufficient mice and/or conditional AML1-deficient mice. We hope that these efforts will unveil the biological significance of the AML1 methylation in hematopoietic regulation. Disclosures:No relevant conflicts of interest to declare.

Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates

Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings

BackgroundIn resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. ObjectivesAssess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. Study design60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. ResultsThe manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. ConclusionsUsing just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay.

Molecular characterization and an infectious clone construction of sweet potato leaf curl virus (SPLCV) isolated from Korea

Sweet potato leaf curl disease (SPLCD) was primarily identified in sweet potato fields in Korea in 2003, and the complete genomic sequence of sweet potato leaf curl virus (SPLCV) has been cloned. The genome of the Korean SPLCV isolate (SPLCV-KR) comprises 2,828 nucleotides with six open reading frames in DNA-A, similar to a monopartite begomovirus. Additionally, neither the genome B genomic component nor the DNA beta sequence was detected. The results of phylogenetic analysis using the maximum parsimony method showed that SPLCV-KR is more closely related to SPLCV-US (US) than SPLCV-CN (China) and SPLCV-JP (Japan). A tandem repeat dimer of SPLCV-KR was cloned and found to be infectious in sweet potatoes (Ipomoea batatas) via biolistic inoculation. The SPLCV-infected sweet potatoes exhibited mild leaf curl symptoms of SPLCD, and the newly-replicated viral DNA was detected via Southern blot analysis. Results of biotic, molecular, and phylogenetic characterization suggest that SPLCV-KR is a new strain of SPLCV and is importantly placed in the evolutionary progression from curtoviruses to begomoviruses. sweet potato leaf curl virus; sweet potato leaf curl disease; phylogenetic analysis; infectious clone; biolistic infection.

In silico analysis reveals that several tomato microRNA/microRNA∗ sequences exhibit propensity to bind to tomato leaf curl virus (ToLCV) associated genomes and most of their encoded open reading frames (ORFs)

Tomato leaf curl virus (ToLCV) is a member of family geminiviridae that constitute rapidly emerging group of phytopathogens posing threat to a large number of vegetable crops worldwide. Three different genomes are found to be associated with ToLCV viz., DNA-A, DNA-B and beta satellite DNA. MicroRNAs (miRs) are known to govern several fundamental processes in eukaryotes, including basal defense mechanisms. In animals, it has been demonstrated that certain host miRs prevent viral establishment by directly interfering with pathogen replication or by binding to viral transcripts. However, in spite of the existence of huge families of phytopathogenic viruses, no such mechanism has been observed in plants. In the present study, we performed in silico analysis to investigate whether tomato encoded miR/miR* sequences possess any potential to bind to viral genome and/or encoded ORFs. We observed that different sequences can bind to ToLCNDV DNA-A, ToLCNDV DNA-B and ToLCNDV associated DNA beta genomes and most of the encoded ORFs. Interestingly, our analysis revealed that several miR* species could similarly target genome and ORFs of ToLCNDV suggesting novel role of miR* in host defense response. This observation holds much importance as miR* molecules are presently thought to follow degradation pathway and are not assigned with any function. Moreover, we could predict targets for these miR* sequences that are generally involved in plant metabolism. Overall, these results shed light on new paradigm of intricate host-pathogen interactions via miRNA pathway.

Molecular characterization of a distinct begomovirus species from Vernonia cinerea and its associated DNA-β using the bacteriophage Φ29 DNA polymerase

Vernonia cinerea plants with yellow vein symptoms were collected around crop fields in Madurai. A portion (550 bp) of the AV1 gene amplified using degenerate primers from the total DNA purified from diseased leaf sample was cloned and sequenced. Specific primers derived from the above sequence were used to amplify 2,745 nucleotides with the typical genome organization of begomoviral DNA A (EMBL Accession No. AM182232). Sequence comparison with other begomoviruses revealed the greatest identity (82.4%) with Emilia yellow vein virus (EmYVV-[Fz1]) from China and less than 80% with all other known begomoviruses. The International Committee on Taxonomy of Viruses (ICTV) has therefore recognized Vernonia yellow vein virus (VeYVV) as a distinct begomovirus species. Conventional PCR could not amplify the DNA B or DNA beta from the diseased tissue. However, the beta DNA (1364 bp) associated with the disease was obtained (Accession No. FN435836) by the rolling circle amplification-restriction fragment length polymorphism method (RCA-RFLP) using Phi 29 DNA polymerase. Sequence analysis shows that DNA beta of VeYVV has the highest identity (56.8%) with DNA beta of Sigesbeckia yellow vein Guangxi betasatellite (SibYVGxB-[CN: Gx111:05]) and 56-53% with DNA beta associated with other begomoviruses. This is the first report of the molecular characterization of VeYVV from V. cinerea in India. The complete molecular characterization, phylogenetic analysis, and putative recombination events in VeYVV are reported.

Satellite DNA β overrides the pathogenicity phenotype of the C4 gene of tomato leaf curl virus but does not compensate for loss of function of the coat protein and V2 genes

We have investigated the ability of satellite DNA beta to complement mutations in the CP, V2 and C4 genes of the monopartite begomovirus, tomato leaf curl virus, which are potentially involved in movement. A mutation in the coat protein was not complemented by DNA beta. Mutations of the C4 and V2 genes attenuated and abolished symptoms, respectively. In the presence of the C4 mutant, but not the V2 mutant, DNA beta induced typical symptoms, confirming that the satellite encodes a dominant symptom determinant. In contrast to the C4 mutant, DNA beta did not enhance the viral DNA levels of the V2 mutant, suggesting that V2 is required for this phenomenon. The significance of these findings is discussed based on our present understanding of the functions of the viral genes and DNA beta.