First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka

Abstract

HomePlant DiseaseVol. 101, No. 7First Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri Lanka PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report on Association of Okra yellow vein mosaic virus With Yellow Vein Mosaic Disease of Okra (Abelmoschus esculentus) in Sri LankaC. J. Tharmila, E. C. Jeyaseelan, U. Ihsan, A. C. Wetten, D. M. De Costa, and M. W. ShawC. J. TharmilaSearch for more papers by this author, E. C. JeyaseelanSearch for more papers by this author, U. IhsanSearch for more papers by this author, A. C. WettenSearch for more papers by this author, D. M. De CostaSearch for more papers by this author, and M. W. ShawSearch for more papers by this authorAffiliationsAuthors and Affiliations C. J. Tharmila E. C. Jeyaseelan , Department of Botany, University of Jaffna, Sri Lanka U. Ihsan A. C. Wetten , School of Agriculture, Policy and Development, University of Reading, U.K. D. M. De Costa , Department of Agricultural Biology, Faculty of Agriculture, University of Peradeniya, Sri Lanka M. W. Shaw , School of Agriculture, Policy and Development, University of Reading, U.K. Published Online:14 Apr 2017https://doi.org/10.1094/PDIS-10-16-1492-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Yellow vein mosaic disease (YVMD) is a major biotic constraint on okra (Abelmoschus esculentus) cultivation in Sri Lanka. Diseased plants show characteristic symptoms of mosaic and vein yellowing on leaves and small and yellowish green fruits. Disease incidence was 55 to 70% in three districts (Jaffna, Trincomalee, and Vavuniya) of northern Sri Lanka in 2015. To confirm the identity of the pathogen, symptomatic leaf samples were collected from the above three districts in May and June 2015. In each district, three diseased plant samples were collected from three different farms. DNA of the samples was amplified by PCR using begomovirus specific primers to detect DNA-A (Deng et al. 1994), DNA-B (Rojas et al. 1993), and β-satellite DNA (Briddon et al. 2002). For all samples (27 DNA samples of infected plants), the presence of DNA-A and β-satellite DNA of a monopartite begomovirus was confirmed; however, DNA-B was not detected. A full-length PCR amplified product of the β-satellite DNA of each district was cloned and sequenced. The resulting sequences (GenBank KX174318, KX174319, and KX174322) have several features of begomovirus DNA-β, namely, a conserved nonanucleotide TAATATTAC, which is found in all geminiviruses, a coding sequence for the protein beta-C1, an adenine rich region, and a highly conserved stretch of ∼100 nucleotides upstream of the predicted stem-loop structure. The sequences showed great similarity with several isolates of Bhendi yellow vein mosaic betasatellite (BYVB) in GenBank and were distantly related to begomoviruses previously identified in Sri Lanka: Tomato leaf curl virus associated DNA beta (AJ542493) and Ageratum yellow vein virus associated DNA beta (AJ542498). The complete nucleotide sequences of DNA-A were amplified with three sets of degenerate overlapping primers (Venkataravanappa et al. 2012). The DNA-A sequences assembled from the cloned segments (KX698087, KX698088, and KX698090) have the genome organization characteristic of begomoviruses, encoding six ORFs with two ORFs (AV1 and AV2) in the virion sense strand and four ORFs (AC1-AC4) in the complementary strand, separated by an intergenic region (IR). The IR contains a stem loop structure with the expected conserved nonanucleotide sequence, TAATATTAC. The nucleotide sequence comparisons showed that the genome of DNA-A of the isolates shared 97 to 98% sequence identity with Okra enation leaf curl virus isolates (KT390458, KX553923) and also 97% identity with Mesta yellow vein mosaic virus (KJ462074), and 91% with Indian isolates of Bhendi yellow vein mosaic virus, while it showed ≤80% similarity with other identified Sri Lankan begomoviruses, such as Ageratum yellow vein virus (NC_002981), Chilli leaf curl virus (JN555600), and Cassava mosaic virus (AJ314737). Hence, the virus associated with YVMD of okra has been identified as an isolate of Okra yellow vein mosaic virus. Furthermore, leaf samples collected from infected plants showed positive results to dot blot hybridization using a digoxigenin labeled DNA probe (DIG DNA labeling and detection kits, Sigma Aldrich, U.S.A.), which had been prepared specifically to beta-satellite DNA using the primer pair (BetaF: GGTTCGTTTACATCCATTCCCA, BetaR: TCCATTCGACTTCAACGGT). To our knowledge, this is the first report of Okra yellow vein mosaic virus (OYVMV) associated with yellow vein mosaic disease of okra in Sri Lanka. Identification of OYVMV association with okra will provide the platform for further study, prevention, and control of the disease.