Development Of Sequence Characterized Amplified Region Markers Research Articles

Development of SCAR markers related to heat tolerance in Kentucky bluegrass

As a high-quality cool-season grass, Kentucky bluegrass (Poa pratensis) is facing increasing threat of high temperature, so improving its heat tolerance (HT) has become an important breeding target. In this study, the HT of 84 materials was identified in the artificial climate chamber, and 15 most heat-tolerant and 15 most heat-sensitive materials were selected respectively to construct two DNA pools. There was a significant difference in high-temperature tolerance time between the plants in the two pools, which was more than 22 days. A total of 304 sequence-related amplified polymorphism (SRAP) and 88 simple sequence repeat (SSR) markers were used to screen the polymorphic bands between the two pools. Then, these bands were transformed into sequence characterized amplified region (SCAR) markers, and finally 12 SCAR dominant markers related to HT were obtained, which could detect the heat-sensitive materials efficiently. Among them, S-me8×em2 and S-me52×em5 had the best identification effect, and the consistency between the absence of these two markers and the heat-sensitive phenotype was 87%. According to the comparison with NCBI database, the sequences of 12 SCAR markers had no homology with known HT related genes. Next, we would further verify the HT identification efficiency of these SCAR markers in single plants within materials, and try to use them in molecular marker-assisted breeding.

Development of DNA and GC-MS Fingerprints for Authentication and Quality Control of Piper nigrum L. and Its Adulterant Carica papaya L.

Piper nigrum L. (family: Piperaceae) is cultivated for its mature fruit/berries. Generally dried, they are one of the most important commercial spice/food additives. The dried fruit of P. nigrum is almost similar in morphology to seeds of Carica papaya L. and is used as an adulterant of P. nigrum. Molecular technology and plant metabolomics are effective tools for unequivocal authentication and detection of food ingredients. In this study, DNA fingerprinting-based quality control markers [sequence characterized amplified region (SCAR) markers] were employed for authentication and discrimination of P. nigrum from its adulterant C. papaya. The 500- and 750-bp-sized SCAR markers of P. nigrum and C. papaya were amplified using their specific SCAR primer sets. Further, metabolic profiling was carried out using gas chromatography–mass spectrometry (GC-MS) on the fruits and seeds of P. nigrum and C. papaya, respectively. For P. nigrum and for C. papaya, 84 and 61 chemically diverse metabolites were observed, respectively, among which 44 and 33 metabolites were putatively selected, respectively. The detection efficiency of GC-MS was assessed by combining the powdered samples of both P. nigrum and C. papaya in different ratios and was able to detect as low as 20 mg/g (w/w) (20,000 ppm) of metabolites. Multivariate data analysis and clustering analysis was performed on the mixture samples of both the food ingredients. Thus, development of SCAR markers along with the phytochemical fingerprints can correlate DNA fingerprinting data with the quantity of active ingredient and/or phytochemical constituents associated with the specific spice/herb/(s).

Development of diagnostic SCAR markers for genomic DNA amplifications in breast carcinoma by DNA cloning of high-GC RAMP-PCR fragments.

Cancer is genetically heterogeneous regarding to molecular genetic characteristics and pathogenic pathways. A wide spectrum of biomarkers, including DNA markers, is used in determining genomic instability, molecular subtype determination and disease prognosis, and estimating sensitivity to different drugs in clinical practice. In a previous study, we developed highly effective DNA markers using improved random amplified polymorphic DNA (RAPD) with high-GC primers, which is a valuable approach for the genetic authentication of medicinal plants. In this study, we applied this effective DNA marker technique to generate genetic fingerprints that detect genomic alterations in human breast cancer tissues and then developed sequence-characterized amplified region (SCAR) markers. Three SCAR markers (BC10-1, BC13-4 and BC31-2) had high levels of genomic DNA amplification in breast cancer. The PHKG2 and RNF40 genes are either overlapping or close to the sequences of SCAR marker BC13-4, while SCAR marker BC10-1 is in the intron and overlap the DPEP1 gene, suggesting that alterations in the expression of these genes could contribute to cancer progression. Screening of breast cancer cell lines showed that the mRNA expression levels for the PHKG2 and DPEP1 were lower in non-tumorigenic mammary epithelial cell MCF10A, but elevated in other cell lines. The DPEP1 mRNA level in invasive ductal carcinoma specimens was significantly higher than that of the adjacent normal tissues in women. Taken together, high-GC RAMP-PCR provides greater efficacy in measuring genomic DNA amplifications, deletion or copy number variations. Furthermore, SCAR markers BC10-1 and BC13-4 might be useful diagnostic markers for breast cancer carcinomas.

Authentication of Punica granatum L.: Development of SCAR markers for the detection of 10 fruits potentially used in economically motivated adulteration

The large commercial success of pomegranate increase the likelihood of economically motivated adulteration (EMA), which has been gradually spotted with the undeclared addition of anthocyanin-rich plants or cheaper fruit juices used as bulking and diluting agents. A method based on Sequence-Characterized Amplified Regions (SCARs) was developed to detect the presence of Aristotelia chilensis, Aronia melanocarpa, Dioscorea alata, Euterpe oleracea, Malus×domestica, Morus nigra, Sambucus nigra, Vaccinium macrocarpon, Vaccinium myrtillus, Vitis vinifera as bulking agents in Punica granatum. The method enabled the unequivocal detection of up to 1% of each adulterant, allowing the preemptive rejection of suspect samples. The recourse to such method may reduce the number of samples to be subjected to further phytochemical analyses when multiple batches have to be evaluated in a short time. Vice versa, it allows the cross-check of suspect batches previously tested only for their anthocyanin profile. The dimension of the amplicons is suitable for the analysis of degraded DNA obtained from stored and processed commercial material. Proper SCAR markers may represent a fast, sensitive, reliable and low-cost screening method for the authentication of processed commercial pomegranate material.

Development of RAPD and SCAR markers related to watermelon mosaic virus and zucchini yellow mosaic virus resistance in Cucurbita moschata

Squash (Cucurbita spp.) is a major vegetable crop in the Cucurbitaceae family, and has high economic value. Squash is an important foodstuff and has possible health benefits because of its antioxidant, anti-diabetic, anti-carcinogenic, and anti-microbial potential. However, the highly virulent watermelon mosaic virus (WMV) and zucchini yellow mosaic virus (ZYMV) are serious problems for squash worldwide. Single or mixed infections of WMV and ZYMV can destroy entire squash plants. Therefore, breeding squash cultivars with resistance to WMV and ZYMV is of major importance for squash cultivation. In this study, random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) markers were developed using C. moschata lines resistant or susceptible to WMV and ZYMV. A total of 100 random primers were tested for their ability to discriminate between resistant and susceptible lines in RAPD analysis, and 4 RAPD markers (OPF10, OPF19, OPF20, and OPL19) related to WMV and ZYMV resistance were selected. Based on the RAPD results, genetic similarities were calculated and cluster analysis was conducted using unweighted pair group method with arithmetic mean (UPGMA) method. C. moschata lines were clearly segregated into resistant and susceptible lines by cluster analysis. One of the RAPD markers was successfully converted into a SCAR marker (VirSq-F19). This marker could be used as a tool for selecting WMV- and ZYMV-resistant squash in the early selection stages of a practical squash breeding program.

Development of specific SCAR markers identifying recessive genic male sterile gene in sesame (Sesamum indicum L.)

To develop a simple and convenient marker for genetic linkage of sesame male sterile gene,based on an AFLP marker,7 SCAR( sequence characterized amplified region) markers were developed using recessive genic male sterile two- type line 95ms- 5AB as fertile and sterile gene bulks. These 7 markers could detect bands from fertile bulk with 806 bp to 1 638 bp in size,and could not from sterile bulk. They were designated as PMC- 1to PMC- 7. These markers were used to detect 1 184 fertile and sterile plants of 95ms- 5AB with 0. 25% exchange rate. 4 F2 populations obtained from 95ms- 5A and different genotypes and 2 recessive genic male sterile lines were identified using these 7 SCAR markers. Result indicated that the SCAR markers were specific for 95ms- 5.

Development of novel SCAR markers for genetic characterization of Lonicera japonica from high GC-RAMP-PCR and DNA cloning.

Sequence-characterized amplified region (SCAR) markers were further developed from high-GC primer RAMP-PCR-amplified fragments from Lonicera japonica DNA by molecular cloning. The four DNA fragments from three high-GC primers (FY-27, FY-28, and FY-29) were successfully cloned into a pGM-T vector. The positive clones were sequenced; their names, sizes, and GenBank numbers were JYHGC1-1, 345 bp, KJ620024; YJHGC2-1, 388 bp, KJ620025; JYHGC7-2, 1036 bp, KJ620026; and JYHGC6-2, 715 bp, KJ620027, respectively. Four novel SCAR markers were developed by designing specific primers, optimizing conditions, and PCR validation. The developed SCAR markers were used for the genetic authentication of L. japonica from its substitutes. This technique provides another means of developing DNA markers for the characterization and authentication of various organisms including medicinal plants and their substitutes.

Diversity of black Aspergilli isolated from raisins in Argentina: Polyphasic approach to species identification and development of SCAR markers for Aspergillus ibericus

Aspergillus section Nigri is a heterogeneous fungal group including some ochratoxin A producer species that usually contaminate raisins. The section contains the Series Carbonaria which includes the toxigenic species Aspergillus carbonarius and nontoxigenic Aspergillus ibericus that are phenotypically undistinguishable. The aim of this study was to examine the diversity of black aspergilli isolated from raisins and to develop a specific genetic marker to distinguish A. ibericus from A. carbonarius. The species most frequently found in raisins in this study were Aspergillus tubingensis (35.4%) and A. carbonarius (32.3%), followed by Aspergillus luchuensis (10.7%), Aspergillus japonicus (7.7%), Aspergillus niger (6.2%), Aspergillus welwitschiae (4.6%) and A. ibericus (3.1%). Based on inter-simple sequence repeat (ISSR) fingerprinting profiles of major Aspergillus section Nigri members, a sequence-characterized amplified region (SCAR) marker was identified. Primers were designed based on the conserved regions of the SCAR marker and were utilized in a PCR for simultaneous identification of A. carbonarius and A. ibericus. The detection level of the SCAR-PCR was found to be 0.01ng of purified DNA. The present SCAR-PCR is rapid and less cumbersome than conventional identification techniques and could be a supplementary strategy and a reliable tool for high-throughput sample analysis.

Development of SCAR marker for Specific Detection of Trichoderma harzanium and Trichoderma viride

Trichoderma have been used as biological control agents against soil borne plant pathological fungi such as S. rolfsii. On this day molecular based techniques has been developed to detect T. harzanium using a fungus-specific marker derived from genomic DNA. An amplified RAPD product of 220 bp and 900 bp obtained in T. harzanium (NBAII Th 1) and T. viride (NBAII Tv 2) isolates, respectively. These two RAPD products were obtained using two random primers OPA-16 for harzanium (NBAII Th 1) isolate and OPC-05 for T. viride (NBAII Tv 2), thin RAPD products were sequenced. Based on sequences, one primers were designed, out of which a primer pair HAR220FP5 (CTTTTGGTTTGACACGGTTCT and HAR220RP5 (AAGCTTTGAAGTTGCGAGGA) amplified a sequence of 220 bp. and VIRI900FP7 (TACGCTCCAGGCTACCACTT) VIRI900RP7 (GAGATGAGCTCCTTGCTGCT) amplified a sequence of 900 bp. which was specific to T. harzianum and T. viride, respectively. The specificity of the marker when tested against six isolates of Trichoderma species showed a specific band of 220 bp. only in T. harzanium and a specific band of 900 bp. only in T.viride with the optimized PCR parameters. This sequence characterized amplified region (SCAR) marker was sensitive and could detect small quantities of Trichoderma DNA as low as 25 to 30 ng with high efficiency. This marker could also clearly distinguish T. harzianum and T. viride from other isolates of Trichoderma.

Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

Development of SCAR Markers Linked to Cold Resistance for Marker-assisted Selection of Grapevines

포도 신품종 육성에서 내한성 계통의 조기 선발을 위하여, 다양한 품종을 대상으로 randomly amplified polymorphic DNA(RAPD)를 수행하고, 그 결과를 바탕으로‘Campbell Early’x ‘Kaiji’, ‘Golden Muscat’x‘Tamnara’,‘Campbell Early’x‘Neo Muscat’와‘Alden’x‘Kaiji’의 포도교배조합 실생계통을 이용하여 내한성 관련 sequence characterized amplified region(SCAR) 분자표지를 개발하였다. 400여개의 primer를 사용하여 bulk집단에서의 RAPD 분석을 통해서 6개의 UBC random primer를 최종적으로 선발하였고, RAPD 산물을 클로닝한 후 염기서열을 분석하였다. 6개의 SCAR primer (UBC123-428, UBC196-353, UBC221-503, UBC317-800, UBC342-500, UBC344-451)를 제작하고 교배조합 실생에 재검정한 결과 내한성과 관련한 특이밴드를 확인할 수 있었다. 포도나무의 내한성과 관련한 특이적인 밴드출현양상은 수피의 탄수화물함량, 전해질전도도, 포장에서의 신초생존율과 유사한 양상을 보였다. 본 연구에서 개발한 SCAR marker는 포도의 염색체상에서 위치를 확인할 수 있었으며, 그 주변에는 주로 cytochrome P450, glutathione S-transferase, leucine-rich repeat, pleiotropic drug resistance 12, ribosomal protein 등의 유전자가 분포하였다. 본 연구에서 개발된 포도 내한성 관련 SCAR marker는 내한성 포도 품종의 조기선발과 육종효율 증진에 기여할 수 있을 것으로 기대된다.

Characterization of four B-chromosome-specific RAPDs and the development of SCAR markers on the maize B-chromosome.

Understanding the molecular organization of the maize B-chromosome is hindered by its high homology with A-chromosomes. Recently, various approaches have been employed to overcome this hindrance, and several B-chromosome-specific sequences have been identified. Here, we cloned and characterized four previously published B-chromosome-specific RAPD fragments in detail. The results of sequence analysis, Southern hybridization and fluorescence in situ hybridization revealed that the four RAPD fragments are repetitive and present on both the B- and A-chromosomes, which supports an A-chromosome origin of the B-chromosome. We further developed four sequence-characterized amplified region (SCAR) markers derived from the four B-chromosome-specific RAPDs. These markers amplified PCR products exclusively in plants with B-chromosomes and were further mapped to definite distal heterochromatic regions of the B-chromosome by 15 B-A translocations. Furthermore, reverse transcriptase-PCR revealed that two of the four B-chromosome-specific RAPD fragments are transcriptionally active. These results demonstrate the feasibility of using B-chromosome-specific RAPD sequences to generate SCAR markers specific to the B-chromosome and might apply to other sequences of the maize B-chromosome.

Development of SCAR marker associated with downy mildew disease resistance in pearl millet (Pennisetum glaucum L.).

Pearl Millet is an important crop coarse grain cereal crop in the semi arid tropics which is extremely susceptible to oomycete plant pathogen Sclerospora graminicola causing downy mildew (DM) disease. The aim of the current study is to breed resistance against downy mildew disease into high yielding cultivars of pearl millet. Hence, in the present work a sequence characterized amplified region (SCAR) marker was developed as a molecular screening tool to identify DM resistance source and presented here. Of the 27 inter simple sequence repeats (ISSR) decamer primers used to identify polymorphism amongst pearl millet genotypes ICMR-01007 (P1) and ICMR-01004 (P2) and their populations (F1 and F2), only one primer pair ISSR-22 produced polymorphic bands on ICMR-01004 producing 1.4 kb size. The PCR amplification of 1.4 kb band was found tightly linked to the resistant line of ICMR-01004 and also in F2 segregation population was in the ratio 3:1. This band was cloned, sequenced and candidate SCAR primer (SCAR ISSR 863 ) was designed. Segregant analysis of their F2 progeny revealed that the SCAR ISSR 863 marker was linked to downy mildew resistance linkage group (χ(2) 3:1 = 0.86, P = 0.22) with a genetic distance of 0.72 cM. This SCAR marker was further validated using diverse pearl millet lines of India and Africa. Results indicated that the SCAR ISSR 863 band was amplified in all the seven resistant lines and were absent in five susceptible lines. The confirmation of the ISSR-derived SCAR marker in different genetic backgrounds of pearl millet lines suggests that this marker can be exploited for DM resistance screening in pearl millet breeding programs.

Development of SCAR marker for sex identification in dioecious Garcinia gummi-gutta

We have developed sex-specific SCAR marker for the identification of dioecious Garcinia gummi - gutta (L.), which is useful for the selection of G. gummi - gutta at seedling stage and for plantation programmes. Garcinia gummi-gutta (L.) Robs. is a dioecious fruit yielding tree, which is naturally distributed as well as cultivated in the orchards in Western Ghat regions of India. A sex-linked DNA fragment was identified in Garcinia gummi-gutta (L.) Robs. by screening 150 randomly amplified polymorphic DNA primers and only one of them (OPBD20) showed different amplification band pattern associated with sex type. This sex-linked fragment was converted into male-specific sequence-characterized amplified region (SCAR) marker, CAM-566. The primers deigned in this study (OPBD20F and OPBD20R) correctly differentiated 12 male and 12 female plants at high annealing temperatures. Thus, a 556-bp band was amplified in male samples but not in female ones. Nevertheless, it should be noted that the fragments from both sexes were amplified at relatively low annealing temperatures. Additionally, the developed SCAR marker successfully identified the sexes of ten sex-unknown samples. Therefore, it can be used as an effective, convenient and reliable tool for sex determination in such dioecious species.

Development of SCAR marker for the detection of QTL for resistance to dollar spot in creeping bentgrass (Agrostis stolonifera L.)

Dollar spot (caused by Sclerotinia homoeocarpa F. T. Bennett) is the most economically important fungal turf disease on golf courses in North America. This disease is mainly controlled by using multiple fungicides. However, the causal fungus has developed resistance to seveal classes of fungicides and host resistance is an alternative control strategy. A creeping bentgrass (Agrostis stolonifera L.) cultivar improved with dollar spot resistance would greatly reduce the costs and environmental impacts of fungicide applications. Our previous QTL analysis in the creeping bentgrass ‘549 × 372’ population detected one QTL with a large effect for dollar spot resistance and several QTLs with smaller effects. One RAPD primer, AW10, amplified an 650-bp band in the parent ‘372’, was named 3.AW10.650. This RAPD marker was located on linkage group 7.1 and was significantly (p < 0.0001) associated with the QTL for dollar spot resistance based on 697 progeny of the ‘549 × 372’ population. In this study, we converted the RAPD marker 3.AW10.650 into a sequence characterized amplified region (SCAR) marker, named CreepDSp.650. The SCAR marker showed a significant association (p = 0.006) with dollar spot resistance in an additional segregating population developed at the University of Illinois. We report here the first PCR-based SCAR marker associated with a major-effect QTL for dollar spot resistance in creeping bentgrass. This SCAR marker will facilitate evaluating relatively large numbers of breeding progeny for marker-assisted selection (MAS) in bentgrasses.

Development of a specific SCAR marker for the Ns genome of Psathyrostachys huashanica Keng

Wang, J., Du, W., Wu, J., Chen, X., Liu, C., Zhao, J., Yang, Q. and Li, F. 2014. Development of a specific SCAR marker for the Ns genome of Psathyrostachys huashanica Keng. Can. J. Plant Sci. 94: 1441-1447. Psathyrostachys huashanica Keng (2n=2×=14, NsNs) possesses many agronomically desirable traits that could be used in wheat improvement. We have previously produced a complete set of wheat-P. huashanica disomic addition lines (1Ns-7Ns, 2n=44=22 II). To track the addition of P. huashanica chromatin in wheat rapidly and effectively, a repetitive sequence of 1665 base pairs, designated pHs8, was isolated based on 21 different Triticeae species, including the parents' common wheat cv. 7182 and P. huashanica, by RAPD analysis. The diagnostic fragments of the RAPD marker OPF151665 were cloned, sequenced, and converted into a sequence-characterized amplified region (SCAR) marker, known as RHS12. Southern hybridization using labeled pHs8 as probe showed intense hybridization signals on P. huashanica, but not on...

Development of SCAR markers and UP-PCR cross-hybridization method for specific detection of four major subgroups of Rhizoctonia from infected turfgrasses

A rapid identification assay for Waitea circinata (anamorph: Rhizoctonia spp.) varieties zeae and circinata causing patch diseases on turfgrasses was developed based on the universally primed PCR (UP-PCR) products cross-blot hybridization. Tester isolates belonging to the two varieties of W. circinata were amplified with a single UP primer L21, which generated multiple DNA fragments for each variety. Probes were prepared with UP-PCR products of each tester isolate by labeling with digoxigenin. Fieldcollected W. circinata isolates and representative isolates of different R. solani anastomosis groups (AG) and AG subgroups were amplified with L21, immobilized on nylon membrane and cross hybridized with the two probes. Isolates within a W. circinata variety cross-hybridized strongly, while non-homologous isolates did not cross-hybridize or did so weakly. Closely related W. circinata varieties zeae and circinata were clearly distinguished with this assay. Sequence-characterized amplified region (SCAR) markers also were developed from UP-PCR products to identify isolates of Thanatephorus cucumeris (anamorph: R. solani) AG 1-IB and AG 2-2IIIB. These two AGs are commonly isolated from diseased, cool-season turfgrasses. The specific SCAR markers that were developed could differentiate isolates of AG 1-IB or AG 2-2IIIB groups. These SCAR markers did not amplify a product from genomic DNA of nontarget isolates of Rhizoctonia. The specificities and sensitivities of the SCAR primers were tested on total DNA extracted from several field-grown, cool-season turf species having severe brown-patch symptoms. First, the leaf samples from diseased turf species were tested for the anastomosis groups of the causal pathogen, and thereafter the total DNA was amplified with the specific primers. The specific primers were sensitive and unique enough to produce a band from total DNA of diseased turfgrasses infected with either AG 1-IB or AG 2-2IIIB.

Development of SCAR Markers for the Identification of Phytophthora katsurae Causing Chestnut Ink Disease in Korea

Sequence characterized amplified region (SCAR) markers are one of the most effective and accurate tools for microbial identification. In this study, we applied SCAR markers for the rapid and accurate detection of Phytophthora katsurae, the casual agent of chestnut ink disease in Korea. In this study, we developed seven SCAR markers specific to P. katsurae using random amplified polymorphic DNA (RAPD), and assessed the potential of the SCAR markers to serve as tools for identifying P. katsurae. Seven primer pairs (SOPC 1F/SOPC 1R, SOPC 1-1F/SOPC 1-1R, SOPC 3F/SOPC 3R, SOPC 4F/SOPC 4R, SOPC 4F/SOPC 4-1R, SOPD 9F/SOPD 9R, and SOPD 10F/SOPD 10R) from a sequence derived from RAPD fragments were designed for the analysis of the SCAR markers. To evaluate the specificity and sensitivity of the SCAR markers, the genomic DNA of P. katsurae was serially diluted 10-fold to final concentrations from 1 mg/mL to 1 pg/mL. The limit of detection using the SCAR markers ranged from 100 μg/mL to 100 ng/mL. To identify the limit for detecting P. katsurae zoospores, each suspension of zoospores was serially diluted 10-fold to final concentrations from 10 × 105 to 10 × 101 zoospores/mL, and then extracted. The limit of detection by SCAR markers was approximately 10 × 101 zoospores/mL. PCR detection with SCAR markers was specific for P. katsurae, and did not produce any P. katsurae-specific PCR amplicons from 16 other Phytophthora species used as controls. This study shows that SCAR markers are a useful tool for the rapid and effective detection of P. katsurae.

Use of RAPD markers to characterize commercially grown rust resistant cultivars of sugarcane

The brown leaf rust caused by Puccinia melanaocephala (Syd. & P. Syd.) is a major cause of reduction in sugar production and withdrawal of sugarcane cultivars from growing fields. In The present study, the eight commercially grown sugarcane cultivar was characterized under natural inoculation and divided into two discrete groups i.e. four rust resistant and four rust susceptible. The extracted genomic DNA was subjected against RAPD (Random Amplified Polymorphic DNA) markers. After screening of decamers, 7 were picked for further analysis on the basis of polymorphism, which is the most important application of DNA markers. These decamers generated 21 trackable loci with the range of 400-2500 bp and 100% polymorphic loci were recorded genomic DNA of eight sugarcane cultivars. From 7 primers, 3 generated 5 specific loci in 4 sugarcane cultivars, which is a potential use of RAPD-PCR for identifying Saccharum spp. hybrids and clones. Primer G-06 generated only one locus 1200 bp in the rust susceptible cultivar NSG-59 while J-05 had produced two loci i.e. 400 bp and 1100 bp in rust resistant cultivars NSG-555 and CP-77-400 respectively. Primer L-18 generated 700 bp and 1400 bp loci in rust susceptible cultivar CoJS-84. The homology tree was constructed using DNAMAN software based on binary data set. During cluster analysis, we found two major groups of cultivars with different minor groups. This study will be useful to characterize rust resistance in sugarcane and could be extended for the development of SCAR (Sequence Characterized Amplified Region) marker, which is specific, reliable and reproducible marker.

Quality Control of Saffron (Crocus sativus L.): Development of SCAR Markers for the Detection of Plant Adulterants Used as Bulking Agents

A method based on sequence-characterized amplified regions (SCARs) was developed from random amplified polymorphic DNA markers (RAPDs) specific for Arnica montana L., Bixa orellana L., Calendula officinalis L., Carthamus tinctorius L., Crocus vernus L. (Hill), Curcuma longa L., and Hemerocallis sp. to detect these common bulking agents in commercial saffron (Crocus sativus). The method enabled the unequivocal detection of low amounts (up to 1%) of each adulterant, allowing the preemptive rejection of suspect samples. Its enforcement limits the number of samples to be subjected to further evaluation with pharmacognostic or phytochemical analyses, especially when multiple batches have to be evaluated in a short time. The dimension of the amplicons is suitable for the analysis of degraded DNA obtained from dried, stored, processed, and finely ground commercial material. Proper SCAR markers may represent a fast, sensitive, reliable, and low-cost screening method for the authentication of dried commercial saffron material.