Abstract
Trichoderma have been used as biological control agents against soil borne plant pathological fungi such as S. rolfsii. On this day molecular based techniques has been developed to detect T. harzanium using a fungus-specific marker derived from genomic DNA. An amplified RAPD product of 220 bp and 900 bp obtained in T. harzanium (NBAII Th 1) and T. viride (NBAII Tv 2) isolates, respectively. These two RAPD products were obtained using two random primers OPA-16 for harzanium (NBAII Th 1) isolate and OPC-05 for T. viride (NBAII Tv 2), thin RAPD products were sequenced. Based on sequences, one primers were designed, out of which a primer pair HAR220FP5 (CTTTTGGTTTGACACGGTTCT and HAR220RP5 (AAGCTTTGAAGTTGCGAGGA) amplified a sequence of 220 bp. and VIRI900FP7 (TACGCTCCAGGCTACCACTT) VIRI900RP7 (GAGATGAGCTCCTTGCTGCT) amplified a sequence of 900 bp. which was specific to T. harzianum and T. viride, respectively. The specificity of the marker when tested against six isolates of Trichoderma species showed a specific band of 220 bp. only in T. harzanium and a specific band of 900 bp. only in T.viride with the optimized PCR parameters. This sequence characterized amplified region (SCAR) marker was sensitive and could detect small quantities of Trichoderma DNA as low as 25 to 30 ng with high efficiency. This marker could also clearly distinguish T. harzianum and T. viride from other isolates of Trichoderma.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have