Glycosylphosphatidylinositol Deficiency Research Articles

Migrating Focal Seizures and Myoclonic Status in ARV1-Related Encephalopathy.

ObjectiveTo report longitudinal clinical, EEG, and MRI findings in 2 sisters carrying compound heterozygous ARV1 mutations and exhibiting a peculiar form of developmental and epileptic encephalopathy (DEE). Neuropathologic features are also described in one of the sisters.MethodsClinical course description, video-EEG polygraphic recordings, brain MRI, skin and muscle biopsies, whole-exome sequencing (WES), and brain neuropathology.ResultsSince their first months of life, both girls exhibited severe axial hypotonia, visual inattention, dyskinetic movements, severe developmental delay, and slow background EEG activity. Intractable nonmotor seizures started in both at the eighth month of life, exhibiting the electroclinical characteristics of epilepsy of infancy with migrating focal seizures (EIMFS). In the second year of life, continuous epileptiform EEG activity of extremely high amplitude appeared in association with myoclonic status, leading to severely impaired alertness and responsiveness. Repeated brain MRI revealed progressive atrophic changes and severe hypomyelination. WES identified a compound heterozygous in the ARV1 gene [(p.Ser122Glnfs*7) and (p.Trp163*)] in one patient and was subsequently confirmed in the other. Both sisters died prematurely during respiratory infections. Postmortem neuropathologic examination of the brain, performed in one, revealed atrophic brain changes, mainly involving the cerebellum.ConclusionsThis report confirms that biallelic ARV1 mutations cause a severe form of DEE and adds epilepsy with migrating focal seizures and myoclonic status to the spectrum of epilepsy phenotypes. Considering the potential role of human ARV1 in glycosylphosphatidylinositol (GPI) anchor biosynthesis, this severe syndrome can be assigned to the group of inherited GPI deficiency disorders, with which it shares remarkably similar clinical and neuroimaging features. ARV1 should be considered in the genetic screening of individuals with EIMFS.

High-dose pyridoxine treatment for inherited glycosylphosphatidylinositol deficiency

ObjectiveWe aimed to assess the efficacy and safety of high-dose pyridoxine treatment for seizures and its effects on development in patients with inherited glycosylphosphatidylinositol deficiencies (IGDs). MethodsIn this prospective open-label multicenter pilot study, we enrolled patients diagnosed with IGDs using flow cytometry and/or genetic tests. The patients received oral pyridoxine (20–30 mg/kg/day) for 1 year, in addition to previous treatment. ResultsAll nine enrolled patients (mean age: 66.3 ± 44.3 months) exhibited marked decreases in levels of CD16, a glycosylphosphatidylinositol-anchored protein, on blood granulocytes. The underlying genetic causes of IGDs were PIGO, PIGL, and unknown gene mutations in two, two, and five patients, respectively. Six patients experienced seizures, while all patients presented with developmental delay (mean developmental age: 11.1 ± 8.1 months). Seizure frequencies were markedly (>50%) and drastically (>90%) reduced in three and one patients who experienced seizures, respectively. None of the patients presented with seizure exacerbation. Eight of nine patients exhibited modest improvements in development (P = 0.14). No adverse events were observed except for mild transient diarrhea in one patient. ConclusionOne year of daily high-dose pyridoxine treatment was effective in the treatment of seizures in more than half of our patients with IGDs and modestly improved development in the majority of them. Moreover, such treatment was reasonably safe. These findings indicate that high-dose pyridoxine treatment may be effective against seizures in patients with IGDs, although further studies are required to confirm our findings. (University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number: UMIN000024185.)

Limb-clasping, cognitive deficit and increased vulnerability to kainic acid-induced seizures in neuronal glycosylphosphatidylinositol deficiency mouse models.

Posttranslational modification of a protein with glycosylphosphatidylinositol (GPI) is a conserved mechanism exists in all eukaryotes. Thus far, >150 human GPI-anchored proteins have been discovered and ~30 enzymes have been reported to be involved in the biosynthesis and maturation of mammalian GPI. Phosphatidylinositol glycan biosynthesis class A protein (PIGA) catalyzes the very first step of GPI anchor biosynthesis. Patients carrying a mutation of the PIGA gene usually suffer from inherited glycosylphosphatidylinositol deficiency (IGD) with intractable epilepsy and intellectual developmental disorder. We generated three mouse models with PIGA deficits specifically in telencephalon excitatory neurons (Ex-M-cko), inhibitory neurons (In-M-cko) or thalamic neurons (Th-H-cko), respectively. Both Ex-M-cko and In-M-cko mice showed impaired long-term fear memory and were more susceptible to kainic acid-induced seizures. In addition, In-M-cko demonstrated a severe limb-clasping phenotype. Hippocampal synapse changes were observed in Ex-M-cko mice. Our Piga conditional knockout mouse models provide powerful tools to understand the cell-type specific mechanisms underlying inherited GPI deficiency and to test different therapeutic modalities.

Loss of PIGK function causes severe infantile encephalopathy and extensive neuronal apoptosis.

PIGK gene, encoding a key component of glycosylphosphatidylinositol (GPI) transamidase, was recently reported to be associated with inherited GPI deficiency disorders (IGDs). However, little is known about the specific downstream effects of PIGK on neurodevelopment due to the rarity of the disease and the lack of in vivo study. Here, we described 2 patients in a Chinese family presented with profound global developmental delay, severe hypotonia, seizures, and postnatal progressive global brain atrophy including hemisphere, cerebellar and corpus callosum atrophy. Two novel compound heterozygous variants in PIGK were identified via genetic analysis, which was proved to cause significant decrease of PIGK protein and reduced cell surface presence of GPI-APs in the patients. To explore the role of Pigk on embryonic and neuronal development, we constructed Pigk knock-down zebrafish and knock-in mouse models. Zebrafish injected with a small dose of morpholino oligonucleotides displayed severe developmental defects including small eyes, deformed head, curly spinal cord, and unconsumed yolk sac. Primary motor neuronal dysplasia and extensive neural cell apoptosis were further observed. Meanwhile, the mouse models, carrying the two variants respectively homologous with the patients, both resulted in complete embryonic lethality of the homozygotes, which suggested the intolerable effect caused by amino acid substitution of Asp204 as well as the truncated mutation. Our findings provide the in vivo evidence for the essential role of PIGK during the embryonic and neuronal development. Based on these data, we propose a basis for further study of pathological and molecular mechanisms of PIGK-related neurodevelopmental defects.

PIGF deficiency causes a phenotype overlapping with DOORS syndrome.

DOORS syndrome is characterized by deafness, onychodystrophy, osteodystrophy, intellectual disability, and seizures. In this study, we report two unrelated individuals with DOORS syndrome without deafness. Exome sequencing revealed a homozygous missense variant in PIGF (NM_173074.3:c.515C>G, p.Pro172Arg) in both. We demonstrate impaired glycosylphosphatidylinositol (GPI) biosynthesis through flow cytometry analysis. We thus describe the causal role of a novel disease gene, PIGF, in DOORS syndrome and highlight the overlap between this condition and GPI deficiency disorders. For each gene implicated in DOORS syndrome and/or inherited GPI deficiencies, there is considerable clinical variability so a high index of suspicion is warranted even though not all features are noted.

PIGO variants in a boy with features of Mabry syndrome who also exhibits Fryns syndrome with peripheral neuropathy

AbstractWe report a 2‐year‐old boy with left congenital diaphragmatic defect (CDH), pulmonary hypoplasia, and polyhydramnios who harbors compound heterozygous mutations, c.1109A>G and c.2497_2498del, in the PIGO gene. The facial appearance was characterized by cloudy cornea, broad and flat nasal bridge, long philtrum, low‐set ears, and micrognathia. Serum alkaline phosphatase level was consistently elevated, suggesting that he meets the criteria for Mabry syndrome. However, the observation of other anomalies including micropenis, cryptorchidism, and Hirschsprung disease suggests clinical features compatible with Fryns syndrome (FS). Left CDH and Hirschsprung disease were surgically repaired at 1 week and 3 months of age, respectively. He also exhibited multiple joint contractures and markedly decreased voluntary movement. Craw hands were seen but pes cavus was absent. Electrophysiology studies showed diffuse axonal demyelinating neuropathy. The cell surface expression of CD16, CD24, and CD59 on blood granulocytes was significantly reduced. The PIGO gene encodes ethanolamine phosphate transferase 3 in the glycosylphosphatidylinositol (GPI) biosynthesis pathway. Mutations in the gene are known to cause Mabry syndrome, an inherited GPI deficiency (IGD) characterized by hyperphosphatasia. IGDs show clinical heterogeneity and overlap with other syndromes and diseases. A severe end of the phenotypic spectrum can be recognized as FS. This is the first report of PIGO gene mutations in a Mabry syndrome patient who also meets the criteria for FS.

Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia.

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

Bi-allelic Variants in the GPI Transamidase Subunit PIGK Cause a Neurodevelopmental Syndrome with Hypotonia, Cerebellar Atrophy, and Epilepsy

Glycosylphosphatidylinositol (GPI)-anchored proteins are critical for embryogenesis, neurogenesis, and cell signaling. Variants in several genes participating in GPI biosynthesis and processing lead to decreased cell surface presence of GPI-anchored proteins (GPI-APs) and cause inherited GPI deficiency disorders (IGDs). In this report, we describe 12 individuals from nine unrelated families with 10 different bi-allelic PIGK variants. PIGK encodes a component of the GPI transamidase complex, which attaches the GPI anchor to proteins. Clinical features found in most individuals include global developmental delay and/or intellectual disability, hypotonia, cerebellar ataxia, cerebellar atrophy, and facial dysmorphisms. The majority of the individuals have epilepsy. Two individuals have slightly decreased levels of serum alkaline phosphatase, while eight do not. Flow cytometric analysis of blood and fibroblasts from affected individuals showed decreased cell surface presence of GPI-APs. The overexpression of wild-type (WT) PIGK in fibroblasts rescued the levels of cell surface GPI-APs. In a knockout cell line, transfection with WT PIGK also rescued the GPI-AP levels, but transfection with the two tested mutant variants did not. Our study not only expands the clinical and known genetic spectrum of IGDs, but it also expands the genetic differential diagnosis for cerebellar atrophy. Given the fact that cerebellar atrophy is seen in other IGDs, flow cytometry for GPI-APs should be considered in the work-ups of individuals presenting this feature.

CNS glycosylphosphatidylinositol deficiency results in delayed white matter development, ataxia and premature death in a novel mouse model.

The glycosylphosphatidylinositol (GPI) anchor is a post-translational modification added to approximately 150 different proteins to facilitate proper membrane anchoring and trafficking to lipid rafts. Biosynthesis and remodeling of the GPI anchor requires the activity of over 20 distinct genes. Defects in the biosynthesis of GPI anchors in humans lead to inherited glycosylphosphatidylinositol deficiency (IGD). IGD patients display a wide range of phenotypes though the central nervous system (CNS) appears to be the most commonly affected tissue. A full understanding of the etiology of these phenotypes has been hampered by the lack of animal models due to embryonic lethality of GPI biosynthesis gene null mutants. Here we model IGD by genetically ablating GPI production in the CNS with a conditional mouse allele of phosphatidylinositol glycan anchor biosynthesis, class A (Piga) and Nestin-Cre. We find that the mutants do not have structural brain defects but do not survive past weaning. The mutants show progressive decline with severe ataxia consistent with defects in cerebellar development. We show that the mutants have reduced myelination and defective Purkinje cell development. Surprisingly, we found that Piga was expressed in a fairly restricted pattern in the early postnatal brain consistent with the defects we observed in our model. Thus, we have generated a novel mouse model of the neurological defects of IGD which demonstrates a critical role for GPI biosynthesis in cerebellar and white matter development.

Presentation clinical, haematological and immunophenotypic features of 1081 patients with GPI-deficient (paroxysmal nocturnal haemoglobinuria) cells detected by flow cytometry.

A retrospective analysis of presentation clinical, laboratory and immunophenotypic features of 1081 patients with paroxysmal nocturnal haemoglobinuria (PNH) clones [glycosylphosphatidylinositol (GPI)-deficient blood cells] identified at our hospital by flow cytometry over the past 25years was undertaken. Three distinct clusters of patients were identified and significant correlations between presentation disease type and PNH clone sizes were evident. Smaller PNH clones predominate in cytopenic and myelodysplastic subtypes; large PNH clones were associated with haemolytic, thrombotic and haemolytic/thrombotic subtypes. Rare cases with an associated chronic myeloproliferative disorder had either large or small PNH clones. Cytopenia was a frequent finding, highlighting bone marrow failure as the major underlying feature associated with the detection of PNH clones in the peripheral blood. Red cell PNH clones showed significant correlations between the presence of type II (partial GPI deficiency) red cells and thrombotic disease. Haemolytic PNH was associated with type III (complete GPI deficiency) red cell populations of >20%. Those with both haemolytic and thrombotic features had major type II and type III red cell populations. Distinct patterns of presentation age decade were evident for clinical subtypes with a peak incidence of haemolytic PNH in the 30-49year age group and a biphasic age distribution for the cytopenia group.

Significantly different clinical phenotypes associated with mutations in synthesis and transamidase+remodeling glycosylphosphatidylinositol (GPI)-anchor biosynthesis genes

BackgroundDefects in the glycosylphosphatidylinositol (GPI) biosynthesis pathway can result in a group of congenital disorders of glycosylation known as the inherited GPI deficiencies (IGDs). To date, defects in 22 of the 29 genes in the GPI biosynthesis pathway have been identified in IGDs. The early phase of the biosynthetic pathway assembles the GPI anchor (Synthesis stage) and the late phase transfers the GPI anchor to a nascent peptide in the endoplasmic reticulum (ER) (Transamidase stage), stabilizes the anchor in the ER membrane using fatty acid remodeling and then traffics the GPI-anchored protein to the cell surface (Remodeling stage).ResultsWe addressed the hypothesis that disease-associated variants in either the Synthesis stage or Transamidase+Remodeling-stage GPI pathway genes have distinct phenotypic spectra. We reviewed clinical data from 58 publications describing 152 individual patients and encoded the phenotypic information using the Human Phenotype Ontology (HPO). We showed statistically significant differences between the Synthesis and Transamidase+Remodeling Groups in the frequencies of phenotypes in the musculoskeletal system, cleft palate, nose phenotypes, and cognitive disability. Finally, we hypothesized that phenotypic defects in the IGDs are likely to be at least partially related to defective GPI anchoring of their target proteins. Twenty-two of one hundred forty-two proteins that receive a GPI anchor are associated with one or more Mendelian diseases and 12 show some phenotypic overlap with the IGDs, represented by 34 HPO terms. Interestingly, GPC3 and GPC6, members of the glypican family of heparan sulfate proteoglycans bound to the plasma membrane through a covalent GPI linkage, are associated with 25 of these phenotypic abnormalities.ConclusionsIGDs associated with Synthesis and Transamidase+Remodeling stages of the GPI biosynthesis pathway have significantly different phenotypic spectra. GPC2 and GPC6 genes may represent a GPI target of general disruption to the GPI biosynthesis pathway that contributes to the phenotypes of some IGDs.

Early infantile epileptic-dyskinetic encephalopathy due to biallelic PIGP mutations.

ObjectiveTo describe clinical, biochemical, and molecular genetic findings in a large inbred family in which 4 children with a severe early-onset epileptic-dyskinetic encephalopathy, with suppression burst EEG, harbored homozygous mutations of phosphatidylinositol glycan anchor biosynthesis, class P (PIGP), a member of the large glycosylphosphatidylinositol (GPI) anchor biosynthesis gene family.MethodsWe studied clinical features, EEG, brain MRI scans, whole-exome sequencing (WES), and measured the expression of a subset of GPI-anchored proteins (GPI-APs) in circulating granulocytes using flow cytometry.ResultsThe 4 affected children exhibited a severe neurodevelopmental disorder featuring severe hypotonia with early dyskinesia progressing to quadriplegia, associated with infantile spasms, focal, tonic, and tonic-clonic seizures and a burst suppression EEG pattern. Two of the children died prematurely between age 2 and 12 years; the remaining 2 children are aged 2 years 7 months and 7 years 4 months. The homozygous c.384del variant of PIGP, present in the 4 patients, introduces a frame shift 6 codons before the expected stop signal and is predicted to result in the synthesis of a protein longer than the wild type, with impaired functionality. We demonstrated a reduced expression of the GPI-AP CD16 in the granulocytic membrane in affected individuals.ConclusionsPIGP mutations are consistently associated with an epileptic-dyskinetic encephalopathy with the features of early infantile epileptic encephalopathy with profound disability and premature death. CD16 is a valuable marker to support a genetic diagnosis of inherited GPI deficiencies.

Cerebral and portal vein thrombosis, macrocephaly and atypical absence seizures in Glycosylphosphatidyl inositol deficiency due to a PIGM promoter mutation

Defects of the glycosylphosphatidylinositol (GPI) biosynthesis pathway constitute an emerging subgroup of congenital disorders of glycosylation with heterogeneous phenotypes. A mutation in the promoter of PIGM, resulting in a syndrome with portal vein thrombosis and persistent absence seizures, was previously described in three patients. We now report four additional patients in two unrelated families, with further clinical, biochemical and molecular delineation of this unique entity. We also describe the first prenatal diagnosis of PIGM deficiency, allowing characterization of the natural history of the disease from birth. The patients described herein expand the phenotypic spectrum of PIGM deficiency to include macrocephaly and infantile-onset cerebrovascular thrombotic events. Finally, we offer insights regarding targeted treatment of this rare disorder with sodium phenylbutyrate.

Mutations in PIGB Cause an Inherited GPI Biosynthesis Defect with an Axonal Neuropathy and Metabolic Abnormality in Severe Cases

Proteins anchored to the cell surface via glycosylphosphatidylinositol (GPI) play various key roles in the human body, particularly in development and neurogenesis. As such, many developmental disorders are caused by mutations in genes involved in the GPI biosynthesis and remodeling pathway. We describe ten unrelated families with bi-allelic mutations in PIGB, a gene that encodes phosphatidylinositol glycan class B, which transfers the third mannose to the GPI. Ten different PIGB variants were found in these individuals. Flow cytometric analysis of blood cells and fibroblasts from the affected individuals showed decreased cell surface presence of GPI-anchored proteins. Most of the affected individuals have global developmental and/or intellectual delay, all had seizures, two had polymicrogyria, and four had a peripheral neuropathy. Eight children passed away before four years old. Two of them had a clinical diagnosis of DOORS syndrome (deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures), a condition that includes sensorineural deafness, shortened terminal phalanges with small finger and toenails, intellectual disability, and seizures; this condition overlaps with the severe phenotypes associated with inherited GPI deficiency. Most individuals tested showed elevated alkaline phosphatase, which is a characteristic of the inherited GPI deficiency but not DOORS syndrome. It is notable that two severely affected individuals showed 2-oxoglutaric aciduria, which can be seen in DOORS syndrome, suggesting that severe cases of inherited GPI deficiency and DOORS syndrome might share some molecular pathway disruptions.

Glycosylphosphatidylinositol biosynthesis and remodeling are required for neural tube closure, heart development, and cranial neural crest cell survival.

Glycosylphosphatidylinositol (GPI) anchors attach nearly 150 proteins to the cell membrane. Patients with pathogenic variants in GPI biosynthesis genes develop diverse phenotypes including seizures, dysmorphic facial features and cleft palate through an unknown mechanism. We identified a novel mouse mutant (cleft lip/palate, edema and exencephaly; Clpex) with a hypo-morphic mutation in Post-Glycophosphatidylinositol Attachment to Proteins-2 (Pgap2), a component of the GPI biosynthesis pathway. The Clpex mutation decreases surface GPI expression. Surprisingly, Pgap2 showed tissue-specific expression with enrichment in the brain and face. We found the Clpex phenotype is due to apoptosis of neural crest cells (NCCs) and the cranial neuroepithelium. We showed folinic acid supplementation in utero can partially rescue the cleft lip phenotype. Finally, we generated a novel mouse model of NCC-specific total GPI deficiency. These mutants developed median cleft lip and palate demonstrating a previously undocumented cell autonomous role for GPI biosynthesis in NCC development.

Selective Pharmacologic Inhibition of Paroxysmal Nocturnal Hemoglobinuria Clones

Paroxysmal nocturnal hemoglobinuria (PNH) is usually associated with reduced bone marrow (BM) capacity caused by acquired idiopathic aplastic anemia (AA). PIGA mutations lead to a partial or total deficiency of glycosylphosphatidyl-inositol (GPI) anchor proteins (AP). AA is characteristically accompanied by the presence of often tiny GPI-AP deficient clones, which in a significant proportion of patients (10-15%), irrespective of the initial success of immunosuppressive therapy, will evolve to produce manifest hemolytic PNH. Indeed in our cohort of BM failure patients (n=319), 41% of AA patients had a PNH clone present (0.02-20% of granulocytes) (AA/PNH), 14% of patients had primary PNH (primary PNH), and 8% had a history of PNH post AA (secondary PNH).To date, drug development for PNH has focused on designing supportive therapies to prevent transfusions due to hemolysis or thrombotic complications. In addition to the current FDA approved C5 inhibitor eculizumab, new, more convenient and effective complement blockers are under development. Apart from hematopoietic stem cell (HSC) transplantation, no direct strategies targeting basic pathophysiologic mechanisms of PNH have been ventured to prevent evolution of PNH clones and cure the disease. In early AA/PNH syndrome, the PIGA mutant HSCs are rare and unlikely contribute to significant blood cell production. While in later stages of manifest hemolytic PNH, hematopoiesis relies most frequently on mutant HSCs and thus elimination of these cells would result in AA.We hypothesized that if a selective inhibitor of GPI-AP-deficient [GPI-AP (-)] cells can be developed, it could be used primarily in AA/PNH patients with a small clone size. The hope would be to prevent both later expansion of GPI-AP d(-) cells and development of manifest PNH.To discover compounds acting selectively against GPI-AP (-) cells, we subjected wild type (WT) and GPI-AP (-) cell lines (K562, TF-1) to a high-throughput screen using a platform of 3000 bio-active molecules to identify hits and chemical compounds capable of selectively eliminating GPI-AP (-) cells. Our robotic screen yielded several top hits including GR -89696 fumarate, D-cycloserine and CGS-15943. Dose-response experiments confirmed CGS-15943 as a candidate growth inhibitor of GPI-AP (-) cells. CGS-15943 is an adenosine receptor antagonist and non-phosphodiesterase inhibitor which has previously been shown to inhibit cancer cell growth via PI3K/Akt pathway.Low range dose CGS-15943 (1uM) induced cell growth inhibition in K562 and TF-1 GPI-AP (-) cells by 4.7 fold and 3.2 fold, respectively. No cell growth arrest was observed in K562 WT and TF-1 WT cells, as the percentage of alive cells was >95% upon drug treatment. Mixed competition assays were conducted in vitro using equal ratios of K562 and TF-1 WT and GPI-AP (-) cells exposed to CGS-15943 (1uM). Six days after culture, flow cytometric analysis of CD59 surface expression revealed that CGS-15943 allowed for preferential survival of WT cells (84.7 % K562, 96.3% TF-1) vs. GPI-AP (-) cells (15.3% K562, 3.7% TF-1). CGS-15943 induced an increase in the % of AnnexinV+/PI- and AnnexinV+/PI+ in TF-1 GPI-AP (-) cells (12.04% and 44.82, respectively). Similar results were obtained in K562 GPI-AP (-) cells (15.84% and 21.08%). Mononuclear cells of a PNH patient were stimulated with CD3/28 beads in presence of CGS-15943. Flow cytometric analysis indicates a dose dependent growth inhibition effect on GPI-AP (-) lymphocytes after 3 days of culture. Previous reported observations from our group identified that the survival differences between GPI-AP (-) and WT cells largely depend on active PI3K signaling pathway. Our pilot investigation of CGS-15943 - indicates that CGS-15943 induces an decrease in the protein expression of the PI3K isoform - p110γ - exclusively in GPI-AP (-) cells possibly suggesting that CGS-15943 inhibits the catalytic subunit of- p110γ.In sum, we describe that the small molecule compound CGS-15943 selectively eliminates GPI-AP (-) cells in vitro, in both cell lines and in primary PNH cells most likely interfering with the PI3K/AKT survival pathway. DisclosuresMaciejewski:Alexion Pharmaceuticals, Inc.: Consultancy, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Ra Pharmaceuticals, Inc: Consultancy; Apellis Pharmaceuticals: Consultancy; Apellis Pharmaceuticals: Consultancy; Alexion Pharmaceuticals, Inc.: Consultancy, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Ra Pharmaceuticals, Inc: Consultancy.

Identification of ω-sites of Glycosylphosphatidylinositol Anchored Proteins

Unique and complex post-translational modifications are present in the outer leaflet of the plasma membrane. Glycosylphosphatidylinositol (GPI) anchoring is essential for the expression of several outer membrane proteins on the cell surface. A common GPI anchor structure is constituted by glycan moiety, lipid moiety, phosphate and ethanolamine. GPI-anchored proteins (GPI-APs) are observed among eukaryotic species. Abnormal GPI anchoring of proteins is thought to cause various diseases such as paroxysmal nocturnal hemoglobinuria. Recently, many inherited GPI deficiencies (IGDs) have been reported to cause epilepsy, mental retardation, coarse facial features, and multiple organ anomalies. Diseases caused by abnormal GPI anchoring will probably continue to increase, because it is still unknown how many causative genes of IGDs are present. Therefore, in order to study these diseases, the analytical methods of GPI-APs will become important in the future. To date, many methods have been developed for analysis of GPI- APs. In this review, we attempt to summarize the present knowledge about comprehensive analytical methods of GPI-APs and introduce briefly some GPI anchor-related diseases.

Clinical variability in inherited glycosylphosphatidylinositol deficiency disorders.

It is estimated that 0.5% of all mammalian proteins have a glycosylphosphatidylinositol (GPI)-anchor. GPI-anchored proteins (GPI-APs) play key roles, particularly in embryogenesis, neurogenesis, immune response and signal transduction. Due to their involvement in many pathways and developmental events, defects in the genes involved in their synthesis and processing can result in a variety of genetic disorders for which affected individuals display a wide spectrum of features. We compiled the clinical characteristics of 202 individuals with mutations in the GPI biosynthesis and processing pathway through a review of the literature. This review has allowed us to compare the characteristics and the severity of the phenotypes associated with different genes as well as highlight features that are prominent for each. Certain combinations, such as seizures with aplastic/hypoplastic nails or abnormal alkaline phosphatase levels suggest an inherited GPI deficiency, and our review of all clinical findings may orient the management of inherited GPI deficiencies.

A PIGH mutation leading to GPI deficiency is associated with developmental delay and autism.

We identified an individual with a homozygous missense variant (p.Ser103Pro) in a conserved residue of the glycosylphosphatidylinositol (GPI) biosynthesis gene PIGH. This gene encodes an essential component of the phosphatidylinositol N-acetylglucosaminyltransferase complex, in the first step of the biosynthesis of GPI, a glycolipid anchor added to more than one hundred human proteins, several being critical for embryogenesis and neurological functions. The affected individual had hypotonia, moderate developmental delay, and autism. Unlike other reported individuals with GPI deficiency, the proband did not have epilepsy; however, he did have two episodes of febrile seizures. He had normal alkaline phosphatase and no brachytelephalangy. Upon analysis of the surface expression of GPI-anchored proteins on granulocytes, he was demonstrated to have GPI deficiency. This suggests that PIGH mutations may cause a syndrome with developmental delay and autism, but without an epileptic encephalopathy, and should increase the awareness of the potentially deleterious nature of biallelic variants in this gene.

Generating anchors only to lose them: The unusual story of glycosylphosphatidylinositol anchor biosynthesis and remodeling in yeast and fungi.

Glycosylphosphatidylinositol (GPI)-anchored proteins (GPI-APs) are present ubiquitously at the cell surface in all eukaryotes. They play a crucial role in the interaction of the cell with its external environment, allowing the cell to receive signals, respond to challenges, and mediate adhesion. In yeast and fungi, they also participate in the structural integrity of the cell wall and are often essential for survival. Roughly four decades after the discovery of the first GPI-APs, this review provides an overview of the insights gained from studies of the GPI biosynthetic pathway and the future challenges in the field. In particular, we focus on the biosynthetic pathway in Saccharomyces cerevisiae, which has for long been studied as a model organism. Where available, we also provide information about the GPI biosynthetic steps in other yeast/ fungi. Although the core structure of the GPI anchor is conserved across organisms, several variations are built into the biosynthetic pathway. The present Review specifically highlights these variations and their implications. There is growing evidence to suggest that several phenotypes are common to GPI deficiency and should be expected in GPI biosynthetic mutants. However, it appears that several phenotypes are unique to a specific step in the pathway and may even be species-specific. These could suggest the points at which the GPI biosynthetic pathway intersects with other important cellular pathways and could be points of regulation. They could be of particular significance in the study of pathogenic fungi and in identification of new and specific antifungal drugs/ drug targets. © 2018 IUBMB Life, 70(5):355-383, 2018.