Dahlia Mosaic Virus Research Articles

First Report of Lily Virus X Infecting Paris polyphylla var. yunnanensis in Yunnan, China

Lily virus X (LVX) is a positive-sense ssRNA virus belonging to the genus Potexvirus in the family Alphaflexiviridae. LVX is known to infect plants of the genera Lilium and Tricyrtis in the family Liliacea. LVX was first reported in an asymptomatic lily (Lilium formosanum) from England (Stone, 1980), but has been shown to infect plants in the Netherlands (Chen et al. 2005), the United States (Jordan et al. 2008) and Japan (Nijo et al. 2018). To date, the complete genomes of two LVX isolates from the Netherlands and Japan have been reported. Paris polyphylla var. yunnanensis, known as Dianchonglou in China, is a perennial plant of the family Melanthiaceae (formerly belonging to the family Trillium). In China, its rhizome is commonly used as an antispasmodic agent for stroke and cancer treatment (Chang et al. 2017). From 2019 to 2022, leaf mottle and shrinkage which are typical symptoms of viral infections were observed on the leaves of P. polyphylla var. yunnanensis plants in Dianchonglou fields in Qujing, Yunnan. Disease incidence ranged from 19% to 45% across 5 fields (90 plants per field) in Qujing. To identify the possible viral pathogen(s) associated with the disease, the mirVanaTM miRNA isolation Kit was used to extract total RNA was from a mixed sample pool of 5 symptomatic leaf samples collected from the 5 fields. RNA sequencing library was constructed using TruSeqTM RNA sample preparation kit. Sequencing on the Illumina HiSeqTM 2500 platform (Illumina, USA) with 125-bp paired-end reads yielded 23,077,786 raw reads. 22,534,100 clean reads were obtained by removing reads of low quality and poly-N using Trimmomatic software (Bolger et al. 2014). By utilizing the paired-end splicing method in Trinity software (Grabherr et al. 2011) the the raw reads were De novo assembled into 184,596 contigs, of which 303 were related to viruses, including Paris mosaic necrosis virus (PMNV), Pear alphapartitivirus (PAPV), Dahlia mosaic virus (DMV), and Lily virus X (LVX). BLASTn analysis revealed that 12 contigs (lengths ranging from 344 nt to 5,981 nt, query cover 6% to 99%) were most similar (57.32% to 91.67% nt identities) to the genome sequences of LVX, suggesting a possible infection of LVX in the plants. To confirm the result, a full-length genomic sequence of LVX was obtained by reverse transcription polymerase chain reaction (RT-PCR) using specific primers designed based on the sequence of the assembled contigs. The PCR products were cloned into pGEM-T vector (Promega Corporation, USA) and sequenced using the Sanger method (Sangon Biotech, Shanghai, China). The obtained full-length genomic sequence of the LVX isolate (LVX-PP, accession number OM100017) was 5,981 nt in length. BLASTp analysis demonstrated that the putative Rep and CP of LVX-PP shared 76.27% to 81.05% and 80.81% to 81.82% aa sequence similarities with that of other LVX isolates, respectively. Maximum-likelihood phylogenetic trees inferred from the Rep and CP aa sequences showed that LVX-PP clustered closely with LVX isolates. The leaf samples were further analyzed using a lily virus X (LVX) ELISA kit (DEIAPV181, Creative Diagnostics, U.S.A.). Healthy P. polyphylla var. yunnanensis leaves were taken as a negative control and buffer solution as a blank control. The results showed a positive reaction for all five symptomatic plants (OD = 1.259 ± 0.007) relative to the negative (OD = 0.099) and blank (OD = 0.073) controls. These results indicate that LVX can infect P. polyphylla var. yunnanensis. To our knowledge, this is the first report that LVX has been detected in P. polyphylla var. yunnannensis. This study will serve as an important reference for the study of the host range of LVX. Further studies will be required to determine how LVX spreads between P. polyphylla var. yunnannensis and other host plants.

Identification and Genome Characterization of a Dahlia Common Mosaic Virus Isolate from China.

Dahlia (Dahlia variabilis) is a widely cultivated ornamental and medicinal plant in China. Recently, dahlia plants with symptoms of leaf mottling and distortion were collected in Hohhot, Inner Mongolia, China. The presence of dahlia common mosaic virus (DCMV), an unassigned species in the genus Caulimovirus, was confirmed by high-throughput sequencing. Three fragments of DCMV Inner Mongolia isolate (DCMV-IN) were PCR-amplified with specific primers, sequenced and assembled into the complete genome sequence with a GenBank accession number of OR494328. The double-stranded circular DNA genome of DCMV-IN consists of 7949 bp and contains six open reading frames (ORFs). Sequence analysis showed that DCMV-IN shared high sequence identities with other DCMV isolates available in the GenBank database. Phylogenetic analysis of DCMV isolates and other representative caulimoviruses based on genome sequence clustered four DCMV isolates to a single branch which was closest to dahlia mosaic virus (DMV). No recombination event was detected among the four DCMV isolates.

Synthetic Promoters from Strawberry Vein Banding Virus (SVBV) and Dahlia Mosaic Virus (DaMV).

We have constructed two intra-molecularly shuffled promoters, namely S100 and D100. The S100 recombinant promoter (621bp) was generated by ligation of 250bp long upstream activation sequence (UAS) of Strawberry vein banding virus (SV10UAS; - 352 to - 102 relative to TSS) with its 371bp long TATA containing core promoter domain (SV10CP; - 352 to + 19). Likewise, 726bp long D100 promoter was constructed by fusion of 170bp long UAS of Dahlia mosaic virus (DaMV14UAS; - 203 to - 33) with its 556bp long core promoter domain (DaMV4CP; - 474 to + 82). S100 and D100 promoters showed 1.8 and 2.2 times stronger activities than that of the CaMV35S promoter. The activity of the promoters is comparable to that of the CaMV35S2 promoter. Transcript analysis employing qRT-PCR and histochemical assays supported the above findings. Abscisic acid and salicylic acid induce the activity of the D100 promoter. Leaf protein obtained from Nicotiana tabacum plant expressing NSD2 gene (Nigella sativa L. defensin 2) driven by the D100 promoter showed antifungal activity against Alternaria alternata and Phoma exigua var. exigua and antibacterial activity against Pseudomonas aeruginosa and Staphylococcus aureus. Strong S100 and D100 promoters have potential to become efficient candidates for plant metabolic engineering and molecular pharming.

IN VITRO ELIMINATION OF DAHLIA MOSAIC VIRUS BY USING MERISTEM CULTURE, ELECTROTHERAPY AND CHEMOTHERAPY

This study was conducted to investigate the effect of different in vitro techniques on elimination of dahlia mosaic virus. Meristems of Dahlia mosaic virus (DMV) infected dahlias, with 0.2-0.3 mm in length, were cultured on Murashige and Skoog (MS) medium. Based on DAS-ELISA, 100% of the survived plantlets by meristem culture were virus-free. DMV infected stem segments with two axillary buds were treated at three different levels of electric currents (15, 25 and 35 mA) and two time courses (10 and 20 min) in an electrophoresis tank and cultured on MS medium. The treatment of 35 mA for 20 min was the best for viral elimination from diseased dahlias by 85% followed by 25 mA for 20 min by 70%. Acyclovir and salicylic acid were the antivirals were used to eliminate DMV from the infected dahlias. For chemotherapy, nodes were cultured on MS media supplemented with antivirals at 0, 10, 20, 30, 40 and 50 mg/l for 20 and 30 days. The highest concentration of acyclovir (50 mg/l) for 30 days were the best treatments as its highest effectiveness on elimination ability (90.67%) but gave only 49% for plantlet survival. Whereas 40 mg/l acyclovir for 30 days gave elimination ability (80%) and plantlet survival (89.67%). The therapy containing salicylic acid at 40 mg/l for 30 days was the best as its highest effectiveness on DMV elimination ability (100%). But the concentration of salicylic acid at 30 mg/l for 30 days was the best treatment (chemotherapy efficiency= 49.21) as well as DMV elimination ability (75.33%) and plant survival (65.33%). The in vitro developed dahlia plantlets were tested for DMV-freeness using DAS-ELISA. The using therapies (electrotherapy and chemotherapy) can play a good role in virus elimination because they need the minimum period of time to regenerate fully developed healthy plants as long as 2-3 months.

First Report of Dahlia Latent Viroid Infecting Dahlia in China

Dahlia pinnata Cav. (Asteraceae), a bushy, herbaceous ornamental plant widely cultivated in China, is frequently infected by viruses and viroids including tobacco mosaic virus, potato virus Y, cucumber mosaic virus (CMV), tobacco streak virus, dahlia mosaic virus, dahlia common mosaic virus, potato spindle tuber viroid (PSTVd), and dahlia latent viroid (DLVd) (Pappu et al. 2008). DLVd (Hostuviroid, Pospiviroidae) was first characterized in Netherlands as a novel species in 2010 from dahlia without discernible symptoms (Verhoeven et al. 2013) and later in Japan and the United Kingdom (Monger 2018; Tsushima et al. 2015). These findings drew attention toward the study of DLVd infection in dahlia and its potential risk in domestic dahlia cultivation. During June 2013 to September 2018, dahlia plants showing dwarfism were observed in some gardens including Beijing Botanical Garden, Beijing Zhongshan Park, and Xiangshan Park in Beijing, China. To determine the potential pathogen(s), a symptomatic leaf sample was collected, and total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA) with a standard procedure following the instructions, and it was subsequently used for small RNA deep sequencing library construction. The high-throughput sequencing was conducted on an Illumina HiSeq 4000 platform, and the reads generated were de novo assembled into contigs with CLC Genomics Workbench software, and candidate virus(es)/viroid(s) were screened through BLASTN and BLASTX analysis. Results showed 15 contigs shared high nucleotide sequence identity with CMV and two with DLVd, which covered the whole genome of DLVd. To further confirm the presence of DLVd, a primer pair (DLVd F, CAGGTCTTCTAAGGGTTCCTGTGGT; and DLVd R, GGGCTTCTTTGGAGCCCTGGGCGC) was designed and reverse transcription PCR (RT-PCR) conducted. The amplicon was ligated to pMD19-T vector (TaKaRa, Dalian, China) and sequenced. Sequence analysis showed it (accession no. KT119407) shared 100% nucleotide sequence identity with the reported sequences (GenBank accession nos. JX263426.1, LC036322.1 and MG214159.1). Furthermore, a total of 15 asymptomatic dahlia leaf samples were collected and verified by RT-PCR using the abovementioned DLVd primers. Of these samples, five were DLVd positive, in accordance with the previous report that DLVd existed in asymptomatic samples. This was the first report of DLVd infecting dahlia in China. Although DLVd was asymptomatic in dahlia, when in mixed infection with PSTVd negative synergistic interaction was observed (Tsushima et al. 2015). In this study, DLVd was coinfected with CMV, and their interaction needed to be investigated. Furthermore, a larger scale survey of symptomatic and asymptomatic dahlia plants is needed to determine the distribution and prevalence of DLVd in China and its potential risk in dahlia cultivation, especially when coinfected with other viruses/viroids.

The ARGOS-LIKE genes of Arabidopsis and tobacco as targets for improving plant productivity and stress tolerance

A small family of ARGOS genes encodes transmembrane proteins that act as negative regulators of ethylene signaling. Recent studies show that ARGOS genes are involved in the regulation of plant growth under the influence of stress factors. However, the role of ARGOS genes in this process is poorly known. Thereby, our goal was to determine the expression profile of these genes in Arabidopsis thaliana and Nicotiana tabacum in response to phytohormone treatment and stress factors. We discovered that expression of the AtARGOS and AtARGOS-LIKE genes of A. thaliana is regulated by ethylene and depends on environmental conditions. The highest expression level of the NtARGOS-LIKE1 gene of tobacco (NtARL1) was observed in blooming flowers and young organs. It was induced by auxins, ethylene, ABA, methyl jasmonate as well as hypothermia, drought, salinity and heat stresses. To evaluate the impact of ARGOS genes on plant growth under stress, we created transgenic tobacco plants with constitutive expression of the AtARGOS-LIKE gene of A. thaliana (AtARL), controlled by a strong Dahlia mosaic virus promoter. Overexpression of the AtARL gene contributed to an increase in the volume and quantity of mesophyll cells in the leaves of tobacco under normal conditions, and also to an improvement in root growth under salinity, cold and cadmium treatment. The AtARL transgene produced a positive effect on shoot growth when exposed to drought and high salinity, and a negative effect under cold stress. Accordingly, genes of the ARGOS family can be recommended as targets for genetic engineering and genome editing in order to enhance productivity and stress tolerance of economically important plants.

In silico comparative analysis of promoters derived from plant pararetroviruses.

Promoters are specific sequence of nucleotides present upstream of gene coding region involved in initiation and regulation of transcription. Multiple cis-acting element forms the architecture of promoter to which trans-acting nucleic binding factors bind and regulates its activity. Since 1980 genome of pararetrovirus, are being exploited for developing efficient promoters. Among all of them Cauliflower mosaic virus is the most widely used promoter for gene expression. The basic rational behind the strength of promoter lies in the sequence of cis elements and the spacer nucleotide elements between them, thereby strength of these promoter fragments can be regulated by altering these nucleotide sequences. In the present study sequence of eight putative promoters of plant pararetrovirus are retrieved from National Centre for Biotechnology Information (NCBI) website. These sequence are subjected to various bioinformatics tools comprises of Clustal W, Plant Care, Mathinspector, ModelInspector for establishing the phylogenetic similarity, to identify the quantity and quality of present cis-elements, to find the various common transcription factors binding sites and to determine the presence of module for various specific functions respectively. A range of 28.80-56.0 percentage identification was observed in phylogenetic analysis, with the greatest similarity in Mirabilis mosaic virus and Dahlia mosaic virus. A broad range of cis-elements (51), transcription factor binding site (512) was obtained and 60% observed module are in combination with DOFF motif which shows a function relevance with abiotic stress inducibility. The present study had revealed the functional significance of these elements in gene regulation of pararetrovirus genome and also gives a overall idea for designing novel synthetic promoter.

Phylogenetic Distribution of DMV-D10, an Endogenous Strain of Dahlia Mosaic Virus, in Members of Asteraceae

DMV-D10 is a strain of Dahlia mosaic virus (DMV) that is classified as an endogenous virus and does not induce any visible symptoms in the host plant. Endogenous viruses have the ability to integrate their viral sequences into the host plant genome, which can be transmitted to offspring. No studies have examined the host range of DMV-D10 outside of the Dahlia genus. Because DMV-D10 has only been observed in Dahlia, the objective for this study was to determine if presence of DMV-D10 follows an evolutionary relationship among species closely related to Dahlia. An addition objective of this study was to determine if species infected with DMV-D10 may also be infected with Dahlia common mosaic virus (DCMV) because these plant viruses are closely related. It was hypothesized species in the same tribe (Coreopsideae) as Dahlia were more likely to be infected with DMV-D10 compared to species in other Asteraceae tribes. Ten tribes consisting of thirty-five species were collected, and DNA was extracted to determine DMV-D10 infection. Polymerase chain reaction (PCR) results for a movement protein gene indicate DMV-D10 is widely spread across Asteraceae. Specifically, gel electrophoresis results suggest presence of DMV-D10 in thirteen species across seven tribes. Additionally, DCMV was detected in six species across five tribes of Asteraceae. Although, phylogenetic relationship of host plants does not necessarily determine DMV-D10 infection. This leads to questions of how this virus can move to species in other Asteraceae tribes. Some potential hypotheses include pollen transmission or possible plant-virus coevolution.

Changes in phenotype of transgenic amaranth Amaranthus retroflexus L., overexpressing ARGOS-LIKE gene

Amaranth is a new and promising crop for the Russian climate, notable for its well-balanced amino acid composition. Yield increase using the methods of genetic engineering is a challenging task. We generated transgenic plants of amaranth with expression of the Arabidopsis thaliana ARGOS-LIKE gene under the control of the dahlia mosaic virus promoter. We achieved 1.4% transformation effectiveness. In comparison with wild-type amaranth, we observed a 21% increase in stem length, 79% increase in leaf length, and 190% increase in fresh weight of transgenic plants. It was shown that ARGOS-LIKE gene of A. thaliana along with the dahlia mosaic virus promoter can be used to increase primarily the green weight of shoot and leaf size of amaranth.

Phylogenetic distribution of an endogenous strain of Dahlia mosaic virus in members of Asteraceae

Dahlia mosaic virus (DMV) is a double-stranded DNA viral pathogen. A newly discovered strain of this virus called DMV-D10 was first observed in Dahlia variabilis. DMV-D10 does not induce visible symptoms of infection in the host plant, and is classified as an endogenous pararetrovirus. These viruses have the ability to integrate their viral sequences into the host plant genome, which can be transmitted vertically to offspring. Currently, no studies have examined the host range of DMV-D10. Because DMV-D10 has only been observed in Dahlia, the objective for this study was to determine if presence of DMV-D10 follows an evolutionary relationship among species closely related to Dahlia. It was hypothesized species in the same tribe (Coreopsideae) as Dahlia, such as Cosmos, were more likely to be infected with DMV-D10 compared to species within other tribes in the Asteraceae family. PCR results for a movement protein gene indicate DMV-D10 is more widely spread across Asteraceae than in Dahlia species. DMV-D10 was present in Callistephus chinensis (Astereae tribe), Centaurea cyanus (Cardueae tribe), and Dahlia variabilis (Coreopsideae tribe), but not in Tagetes erecta (Tageteae tribe) or Cosmos bipinnatus (Coreopsideae tribe). Therefore, phylogenetic relationship in host plants does not necessarily determine presence or absence of DMV-D10. This leads to questions of how this virus can move to other species in other tribes. Future work will further explore host range, and if there are physiological symptoms associated with DMV-D10 infection.

Simultaneous detection of Tomato spotted wilt virus, Dahlia mosaic virus and Chrysanthemum stunt viroid by multiplex RT-PCR in dahlias and their distribution in Japanese dahlias.

Tomato spotted wilt virus (TSWV), Dahlia mosaic virus (DMV) and Chrysanthemum stunt viroid (CSVd) are economically important viruses and viroid that infect cultivated dahlias. Prior to this investigation, no multiplex RT-PCR assay for the detection of dahlia virus and viroid infections existed. In this study, we report the development of a multiplex RT-PCR that simultaneously detects TSWV, DMV and CSVd infections in dahlias. In addition, a simple RT-PCR method that does not require RNA extraction, microtissue direct RT-PCR, could be used to prepare samples for analysis by this multiplex RT-PCR. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions, and CSVd in the Hokkaido region. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. The multiplex RT-PCR assay described in this study is the first report of simultaneous detection of virus and viroid in dahlia. This method represents a rapid, sensitive and cost effective approach to diagnose viral infections in dahlias. A field survey validated our results, indicating that TSWV was the dominant virus found in the Kansai region, DMV in the Tohoku and Kyushu regions and CSVd in the Hokkaido region.

First Report of Chili Pepper (Capsicum annuum) as a Natural Host Plant for Dahlia mosaic virus

First Report of Chili Pepper (<i>Capsicum annuum</i>) as a Natural Host Plant for <i>Dahlia mosaic virus</i>

Characterization and comparative analysis of promoters from three plant pararetroviruses associated with Dahlia (Dahlia variabilis).

Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus (DCMV), and an endogenous plant pararetroviral sequence (DvEPRS, formerly known as DMV-D10) were reported from dahlia (Dahlia spp). Promoter elements from these dahlia-associated pararetroviruses were identified and characterized. The TATA box, the CAAT box, the transcription start site, the polyadenylation signal, and regulation factors, characteristic of caulimovirus promoters, were present in each of these promoter regions. Each of the promoter regions was separately cloned into a binary vector containing β-glucuronidase (GUS) reporter gene and delivered into Agrobacterium tumefaciens by electroporation followed by agroinfiltration into Nicotiana benthamiana. The activity of the 35S promoter homologs was determined by transient expression of the GUS gene both in qualitative and quantitative assays. The length of the promoter regions in DMV, DCMV, and DvEPRS corresponded to 438, 439, and 259 bp, respectively. Quantitative GUS assays showed that the promoters from DMV and DCMV resulted in higher levels of gene expression compared to that of DvEPRS in N. benthamiana leaf tissue. Significant differences were observed among the three promoters (p < 0.001). Qualitative GUS assays were consistent with quantitative GUS results. This study provides important information on new promoters for prospect applications as novel promoters for their potential use in foreign gene expression in plants.

CONSTRUCTION OF TRANSGENIC RAPE (Brassica napus L.) OVEREXPRESSING ARGOS-LIKE GENE FROM Arabidopsis thaliana USING THE FLORAL DIP METHOD

In this paper, we present transgenic rape plants overexpressing the ARGOS-LIKE gene from Arabidopsis thaliana that have been obtained by the floral dip method. The transformation success rate for rape cultivars of Hanna and Ratnik averaged at 10%. In comparison with control wild-type plants, transgenic plants showed the greater organ size: 27% in the stem length, 58% in the leaf length, 40% in the leaf width, 22% in corolla diameter, 23% in seed volume and 29% in seed weight. The lower epidermis cell area in transgenic plants increased on average by 18%. It was shown that the ARGOS-LIKE gene from A. thaliana along with the promoter of dahlia mosaic virus can be used for the enlargement of organ size in rape.

A Region Containing an as-1 Element of Dahlia Mosaic Virus (DaMV) Subgenomic Transcript Promoter Plays a Key Role in Green Tissue- and Root-Specific Expression in Plants

A subgenomic transcript (Sgt) promoter was isolated from the genomic clone of dahlia mosaic virus (DaMV), which is a double-stranded DNA virus of the Caulimoviridae family. The DaMVSgt promoter, which is linked to the heterologous β-glucuronidase (GUS) reporter gene, was characterized in transient protoplasts and in transgenic tobacco, as well as in Arabidopsis plants. The 5′- and 3′-deletion analysis of a 591-bp DaMVSgt promoter fragment indicated that a 441-bp promoter fragment (−372 to +69 from the transcription start site; TSS) was sufficient for maximal promoter activity. A 141-bp promoter fragment (−72 to +69 from TSS) was the minimal promoter region that also showed relatively strong activity. The three activation sequence-1 (as-1) elements and the border regions were primarily responsible for the promoter activity, as revealed by a finer internal deletion and mutation analysis of the cis-elements and of the immediate border sequence of the activation domain. Electrophoretic mobility shift assay (EMSA), supershift EMSA, DNase I footprinting, Southwestern blotting, and UV cross-linking studies demonstrated the binding of a tobacco transcription factor, TGA1a, that correlated with 2,4-dichlorophenylacetic acid (2,4D)-induced transcriptional activity of the DaMVSgt promoter. Histological GUS staining and the GUS enzymatic assay demonstrated that the 441-bp DaMVSgt4 promoter and 141-bp minimal DaMVSgt4F are 5.5 and 4.6 times, respectively, stronger than the CaMV 35S promoter. The minimal DaMVSgt4F promoter is more active than CaMV 35S in all types of green tissues and roots, without any detectable expression in reproductive tissues and seeds. The DaMVSgt4F promoter may be useful for transgene containment applications.

Analysis of Dahlia Mosaic Virus Full-length Transcript Promoter-Driven Gene Expression in Transgenic Plants

A 556-bp long full-length transcript promoter (DaMVFLt4-; −474 to +82 from transcription start site) with enhanced activity was characterized from the Dahlia mosaic virus (DaMV). The strength of the DaMVFLt4- promoter has been evaluated in transient systems and in transgenic plants using two different reporter genes like β-glucuronidase (GUS) and green fluorescent protein (GFP). The DaMVFLt4- promoter was found to be 4-fold and 5-fold stronger than the CaMV35S promoter in tobacco protoplast and transgenic tobacco plants, respectively. Electrophoretic mobility shift assay (EMSA) and supershift analysis confirmed the binding of tobacco transcription factor TGA1a to the enhancer region of the DaMVFLt4- promoter. TGA1a specially interacted with the activation sequence-1 (as-1) (−69 to –41 from transcription start site (TSS)) of DaMVFLt4- promoter as shown by DNaseI footprinting. UV cross-linking studies and Southwestern blot analysis clearly demonstrated that the purified TGA1a specifically bound to as-1 element, whereas in tobacco nuclear extract, two unknown transcription factors of about 41 kDa (putative TGA1a) and about 67 kDa were bound to the as-1 sequence of the DaMVFLt4- promoter. Expression studies with the DaMVFLt4-::β-glucuronidase (GUS) genes in tobacco protoplasts co-transfected with CaMV35S::TGA1a showed that expression of TGA1a resulted in approximately 3.7 times elevated levels of GUS activity. The DaMVFLt4- promoter is a constitutive promoter, and the expression level in tissues of transgenic tobacco plants was in the order root > leaf > stem. In addition, the DaMVFLt4- promoter was regulated by a number of abiotic and biotic stresses as studied in transgenic Arabidopsis and tobacco plants. The newly derived DaMVFLt4- promoter would become an efficient tool for biotechnological application.

Biological studies of three caulimoviruses associated with dahlia (Dahlia variabilis)

Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus (DCMV), were found to be associated with dahlia mosaic disease. Additionally, an endogenous caulimovirus, Dahlia variabilis endogenous plant pararetroviral sequence (DvEPRS), was found to be present in many cultivated and wild Dahlia spp. Biological properties including mechanical and aphid transmission were investigated for DMV, DCMV and DvEPRS using Verbesina encelioides (crownbeard) as an experimental host. DMV and DCMV were transmitted by Myzus persicae at the rate of 50 and 73%, respectively. DMV and DCMV were mechanically transmissible to V. encelioides and the two effective buffers for mechanical transmission were phosphate buffer (pH 7.0) with nicotinic acid (1%) and sodium bisulfite (5%). Mechanical transmission rates of 58% and 36% were obtained for DMV and DCMV, respectively. DvEPRS was not transmissible by either aphids or mechanical inoculation. Availability of aphid and mechanical inoculation protocols for DMV and DCMV would facilitate further biological studies on caulimoviruses associated with Dahlia.

Comparative analysis of endogenous plant pararetroviruses in cultivated and wild Dahlia spp.

Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus, and an endogenous plant pararetroviral sequence (DvEPRS) were reported in Dahlia spp. DvEPRS, previously referred to as DMV-D10, was originally identified in the US from the cultivated Dahlia variabilis, and has also been found in New Zealand, Lithuania and Egypt, as well as in wild dahlia species growing in their natural habitats in Mexico. Sequence analysis of three new EPRSs from cultivated dahlias from Lithuania [D10-LT; 7,159 nucleotide level (nt)], New Zealand (D10-NZ, 7,156 nt), and the wild species, Dahlia rupicola, from Mexico (D10-DR, 7,133 nt) is reported in this study. The three EPRSs have the structure and organization typical of a caulimovirus species and showed identities among various open reading frames (ORFs) ranging between 71 and 97 % at the nt when compared to those or the known DvEPRS from the US. Examination of a dataset of seven full-length EPRSs obtained to date from cultivated and wild Dahlia spp. provided clues into genetic diversity of these EPRSs from diverse sources of dahlia. Phylogenetic analyses, mutation frequencies, potential recombination events, selection, and fitness were evaluated as evolutionary evidences for genetic variation. Assessment of all ORFs using phylogenomic and population genetics approaches suggests a wide genetic diversity of EPRSs occurring in dahlias. Phylogenetic analyses show that the EPRSs from various sources form one clade indicating a lack of clustering by geographical origin. Grouping of various EPRSs into two host taxa (cultivated vs. wild) shows little divergence with respect to their origin. Population genetic parameters demonstrate negative selection for all ORFs, with the reverse transcriptase region more variable than other ORFs. Recombination events were found which provide evolutionary evidence for genetic diversity among dahlia-associated EPRSs. This study contributes to an increased understanding of molecular population genetics and evolutionary pathways of these reverse transcribing viral elements.

Expression of endogenous para-retroviral genes and molecular analysis of the integration events in its plant host Dahlia variabilis

The dahlia (Dahlia variabilis) genome contains an endogenous pararetrovirus sequence (EPRS) tentatively designated as DvEPRS. The DvEPRS shares genome structure and organization that is typical of members of the Caulimovirus genus. Studies were carried out to better understand the nature of this integration and to determine the gene expression of this DvEPRS. Genomic Southern hybridization showed multiple and random integration events of the DvEPRS in the dahlia genome. To investigate the presence of DvEPRS transcripts, RT-PCR was done on DNase-treated total RNA from DvEPRS-infected dahlia plants. Results showed the expression of open reading frames I, V, and VI. Direct PCR from sap extracts produced more intense DNA amplicons of Dahlia mosaic virus and Dahlia common mosaic virus which are believed to exist as typical episomal caulimoviruses, whereas significantly less intense amplicon was seen in case of DvEPRS in comparison with internal transcribed spacer region of dahlias amplicon. The DvEPRS in wild and cultivated species of Dahlia offer a model system to study the molecular events underlying the ecology, evolution and spread of DvEPRS within natural and managed ecosystems and the factors affecting integration of these EPRS in the plant genome.

Morphological features of transgenic tobacco plants expressing the AINTEGUMENTA gene of rape under control of the dahlia mosaic virus promoter

Morphological features of transgenic tobacco plants expressing the AINTEGUMENTA gene of rape under control of the dahlia mosaic virus promoter