D1 Gene Research Articles

Analysis of methylation and -141C Ins/Del polymorphisms of the dopamine receptor D2 gene in patients with schizophrenia

The gene for dopamine receptor D2 (DRD2) is associated with schizophrenia (SCZ). Epigenetic changes may be related to SCZ pathology. The -141C Ins/Del polymorphism in DRD2 (rs1799732) is functional and associated with SCZ. Fifty SCZ patients and 50 control subjects were newly recruited and analyzed in addition to 50 previously reported SCZ samples and 50 previously reported control samples. Genomic DNA from peripheral leukocytes was analyzed. We replicated analysis of DNA methylation rates at seven CpG sites (CpG 1-1 to 1-7) and also analyzed five additional sites (CpG 2-1 to 2-5) in the upstream region of DRD2. We also performed genotyping of -141C IIns/Del and analyzed the effects of -141C Ins/Del on methylation of DRD2. Methylation rates were significantly lower in SCZ patients compared to control subjects, respectively. In control subjects, the methylation rates were significantly lower in individuals with the Ins/Ins genotype than in Del allele carriers. We replicated hypomethylation of the DRD2 promoter region in SCZ patients compared to age-matched control subjects. The -141C Ins/Del polymorphism affected the methylation rates in regions of DRD2. Hypomethylation and the -141C Ins/Del polymorphism of DRD2 may be biomarkers for SCZ.

Emotional insecurity as a mediator of the moderating role of dopamine genes in the association between interparental conflict and youth externalizing problems.

This study tested whether the association between interparental conflict and adolescent externalizing symptoms was moderated by a polygenic composite indexing low dopamine activity (i.e., 7-repeat allele of DRD4; Val alleles of COMT; 10-repeat variants of DAT1) in a sample of seventh-grade adolescents (Mean age = 13.0 years) and their parents. Using a longitudinal, autoregressive design, observational assessments of interparental conflict at Wave 1 predicted increases in a multi-informant measurement of youth externalizing symptoms 2 years later at Wave 3 only for children who were high on the hypodopaminergic composite. Moderation was expressed in a "for better" or "for worse" form hypothesized by differential susceptibility theory. Thus, children high on the dopaminergic composite experienced more externalizing problems than their peers when faced with more destructive conflicts but also fewer externalizing problems when exposed to more constructive interparental conflicts. Mediated moderation findings indicated that adolescent reports of their emotional insecurity in the interparental relationship partially explained the greater genetic susceptibility experienced by these children. More specifically, the dopamine composite moderated the association between Wave 1 interparental conflict and emotional insecurity 1 year later at Wave 2 in the same "for better" or "for worse" pattern as externalizing symptoms. Adolescent insecurity at Wave 2, in turn, predicted their greater externalizing symptoms 1 year later at Wave 3. Post hoc analyses further revealed that the 7-repeat allele of the dopamine receptor D4 (DRD4) gene was the primary source of plasticity in the polygenic composite. Results are discussed as to how they advance process-oriented Gene x Environment models of emotion regulation.

The Association between DRD3 Ser9Gly Polymorphism and Depression Severity in Parkinson's Disease.

More and more evidence suggests that dopamine receptor D3 gene (DRD3) plays an important role in the clinical manifestations and the treatment of Parkinson's disease (PD). DRD3 Ser9Gly polymorphism is the most frequently studied variant point. Our aim was to investigate the potential effect of DRD3 Ser9Gly polymorphism on modulating resting-state brain function and associative clinical manifestations in PD patients. We consecutively recruited 61 idiopathic PD patients and 47 healthy controls (HC) who were evaluated by clinical scales, genotyped for variant Ser9Gly in DRD3, and underwent resting-state functional magnetic resonance imaging. Based on DRD3 Ser9Gly polymorphism, PD patients and HCs were divided into four subgroups. Then, two-way analysis of covariance (ANCOVA) was applied to investigate main effects and interactions of PD and DRD3 Ser9Gly polymorphism on the brain function via amplitude of low-frequency fluctuations (ALFF) approach. The association between DRD3 Ser9Gly-modulated significantly different brain regions, and clinical manifestations were detected by Spearman's correlations. PD patients exhibited decreased ALFF values in the right inferior occipital gyrus, lingual gyrus, and fusiform gyrus. A significant difference in the interaction of “groups × genotypes” was observed in the right medial frontal gyrus. The ALFF value of the cluster showing significant interactions was positively correlated with HAMD-17 scores (r=0.489, p=0.011) and anhedonia scores (r=0.512, p=0.008) in PD patients with the Ser/Gly or Gly/Gly genotypes. Therefore, D3 gene Ser9Gly polymorphism might be associated with the severity of depression characterized by anhedonia in PD patients.

REST-DRD2 mechanism impacts glioblastoma stem cell-mediated tumorigenesis.

Glioblastoma (GBM) is a lethal, heterogeneous human brain tumor, with regulatory mechanisms that have yet to be fully characterized. Previous studies have indicated that the transcriptional repressor REST (repressor element-1 silencing transcription factor) regulates the oncogenic potential of GBM stem cells (GSCs) based on level of expression. However, how REST performs its regulatory role is not well understood. We examined 2 independent high REST (HR) GSC lines using genome-wide assays, biochemical validations, gene knockdown analysis, and mouse tumor models. We analyzed in-house patient tumors and patient data present in The Cancer Genome Atlas (TCGA). Genome-wide transcriptome and DNA-binding analyses suggested the dopamine receptor D2 (DRD2) gene, a dominant regulator of neurotransmitter signaling, as a direct target of REST. Biochemical analyses and mouse intracranial tumor models using knockdown of REST and double knockdown of REST and DRD2 validated this target and suggested that DRD2 is a downstream target of REST regulating tumorigenesis, at least in part, through controlling invasion and apoptosis. Further, TCGA GBM data support the presence of the REST-DRD2 axis and reveal that high REST/low DRD2 (HRLD) and low REST/high DRD2 (LRHD) tumors are specific subtypes, are molecularly different from the known GBM subtypes, and represent functional groups with distinctive patterns of enrichment of gene sets and biological pathways. The inverse HRLD/LRHD expression pattern is also seen in in-house GBM tumors. These findings suggest that REST regulates neurotransmitter signaling pathways through DRD2 in HR-GSCs to impact tumorigenesis. They further suggest that the REST-DRD2 mechanism forms distinct subtypes of GBM.

The serotonin transporter gene could play a role in anti-predator behaviour in a forest passerine

Elucidating associations between behavioural variation and genes may help to understand the co-existence of different behavioural phenotypes in natural populations. In birds, two main candidate genes are known to affect exploratory and risk-taking behaviour through the neurotransmitter system: the dopamine receptor D4 gene (DRD4) and the serotonin transporter gene (SERT/SLC6A4). In a small passerine bird, the great tit (Parus major), anti-predator responses (hissing or non-hissing behavioural type) towards a nest predator differ consistently between individuals. As defensive anti-predator behaviours are likely related to variations in neurotransmitter systems, we tested the associations between polymorphisms of the two candidate genes (SERT and DRD4) and the propensity to give hissing calls towards a nest predator in incubating female great tits. We found that acoustic anti-predator responses in wild birds were linked to a single-nucleotide polymorphism in the SERT gene (SNP187 in exon 1), but not in the DRD4 gene. The polymorphism in the SERT gene explains about 16% of the total variance in hissing behaviour. However, as the sample size in this study is quite small, these results are preliminary and should be replicated in future studies.

Prevalence of a Iodothyronine Deiodinase 2 gene single nucleotide polymorphism in children with congenital hypothyroidism from Western Romania and impact on TSH levels

Abstract The aim of this study was to evaluate the prevalence of the Iodothyronine Deiodinase 2 gene Thr92Ala polymorphism in children from West of Romania with congenital hypothyroidism (CH) and association with TSH levels in response to levothyroxine monotherapy. Genotyping in 50 children with CH and 52 healthy controls was done using real time PCR. The results showed that there was no statistical difference between the frequencies of genotypes in patients vs. controls. Patients were treated with L-thyroxine and most had normal values for fT3 and fT4. However, high TSH values were found in 21 patients (42%) after treatment. Among patients with high TSH values, AA genotypes were significantly more prevalent (p = 0.044) than TT and AT genotypes. Our results suggest that for the D2 gene Ala92Thr polymorphism, the AA genotype may be detrimental for achieving euthyroidism in patients with CH and levothyroxine monotherapy, therefore polytherapy could be considered as a better approach in these patients.

No association between polymorphisms in the promoter region of dopamine receptor D2 gene and schizophrenia in the northern Chinese Han population: A case-control study.

BackgroundEpidemiological studies found that genetic factors are among the causes of schizophrenia, exclusively the genes involved in the dopamine system. Prior to this, the role of dopamine receptor D2 (DRD2) gene promoter polymorphisms and schizophrenia has been studied extensively, but there are still some uncertainties about these associations. The present study is focusing on the association between the DRD2 gene promoter region polymorphisms and schizophrenia in the northern Chinese Han population.MethodsWe sequenced 2,111‐bp fragment of DRD2 gene promoter region in 306 schizophrenic patients and 324 healthy controls to find association between DRD2 and schizophrenia. SPSS version 18 0.0 was used to calculate odds ratios (OR), 95% confidence intervals (CIs).The Hardy–Weinberg equilibrium test and the confirmation of haplotypes were calculated using Haploview version 4.1. The association of schizophrenic risk of DRD2 genotypes, alleles, and haplotypes between case and control groups was calculated using the chi‐squared test. PS program was used to calculate the Power analysis.ResultsThe genotype frequencies of rs7116768 (p = 0.025) and rs1799732 (p = 0.042) were associated meagerly. After Bonferroni correction, there was no association found between DRD2 gene promoter region with schizophrenia risk in the northern Chinese Han population.ConclusionsIn this study, we did not find any significant difference between schizophrenia and the polymorphisms of DRD2 gene promoter region. A more forceful conclusion remains to be verified by further confirmatory experiments.

Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

The Response Analysis of BR Related Genes at Low Temperature in Potato Sprout Regulation

Brassinosteroids (BR) plays an important role in regulating plant growth. We found that the expression of BR synthesis and signal transduction genes were up-regulation when potato dormancy was released, and suckering agents can inhibit the expression of Methylsterol monooxygenase 1 (SMO1), Delta24-sterol reductase 1 (DWF1), Protein BR insensitive 1 (BRI1), BR-signaling kinase (BSK) and Cyclin D3 (CYCD3) genes in potato tuber. Besides, we found that the storage period among different cultivars are significant different at low temperature. Low temperature can obviously extend cultivar ‘Favorita’ storage time than cultivar ‘Mira’. In order to explore the response of BR genes to potato sprout at low temperature. This study will analyze the expression of BR synthesis, signal transduction and regulation genes at from cultivar ‘Favorita’ and cultivar ‘Mira’ which both cultivars are storage at low temperature (4°C) and room temperature (23±2)°C environment by qRT-PCR technique. The results showed that the expression of DWF1 and BRI1 are decreased in both cultivars by low temperature treatment. The expression of SMO1 , BSK and CYCD3 genes are decreased in cultivar ‘Favorita’by low temperature treatment. While, the expression of SMO1 , BSK and CYCD3 genes in‘Mira’are increase by temperature treatment. It shows that low temperature influences the expression of SMO1 , BSK and CYCD3 genes in cultivar ‘Favorita’, which results in the long dormancy period of the cultivar ‘Favorita’. These results will provide the theoretical basis in elucidating the BR mechanism of potato sprout, breeding variety selection and new technology research and development of potato storage regulation.

Type 2 deiodinase polymorphism causes ER stress and hypothyroidism in the brain.

Levothyroxine (LT4) is a form of thyroid hormone used to treat hypothyroidism. In the brain, T4 is converted to the active form T3 by type 2 deiodinase (D2). Thus, it is intriguing that carriers of the Thr92Ala polymorphism in the D2 gene (DIO2) exhibit clinical improvement when liothyronine (LT3) is added to LT4 therapy. Here, we report that D2 is a cargo protein in ER Golgi intermediary compartment (ERGIC) vesicles, recycling between ER and Golgi. The Thr92-to-Ala substitution (Ala92-D2) caused ER stress and activated the unfolded protein response (UPR). Ala92-D2 accumulated in the trans-Golgi and generated less T3, which was restored by eliminating ER stress with the chemical chaperone 4-phenyl butyric acid (4-PBA). An Ala92-Dio2 polymorphism-carrying mouse exhibited UPR and hypothyroidism in distinct brain areas. The mouse refrained from physical activity, slept more, and required additional time to memorize objects. Enhancing T3 signaling in the brain with LT3 improved cognition, whereas restoring proteostasis with 4-PBA eliminated the Ala92-Dio2 phenotype. In contrast, primary hypothyroidism intensified the Ala92-Dio2 phenotype, with only partial response to LT4 therapy. Disruption of cellular proteostasis and reduced Ala92-D2 activity may explain the failure of LT4 therapy in carriers of Thr92Ala-DIO2.

The study of mRNA Expression of Dopamine Receptors D2 and D3 in Schizophrenic Patients

Schizophrenia is a severe mental disorder affecting behavior, thought and emotions in the form of hallucinations, delusions and cognitive impairment. Dopamine system is implicated in the pathogenesis of schizophrenia through dopamine receptors expression in the brain. The aim of this work is to evaluate the role of mRNA expression of dopamine receptors D2 and D3 in the diagnosis of schizophrenia. Thirty-five schizophrenic patients and fifteen age and gender matched healthy controls were included in this study. Serum lipid profiles were determined by enzymatic colorimetric method while the determination of dopamine receptors D2 and D3 mRNA expression was performed by real time q PCR technique. There was significant statistical decrease of HDL-c and increase of LDL-c in patients compared to control group, while Cholesterol and TAG showed no significant statistical difference between the two groups. There was significant increase of the mRNA expression of dopamine receptors D2 and D3 genes in the blood of the patients compared to control group (p value= 0.001 and < 0.001 respectively). From this study, it could be concluded that Dopamine receptors D2 and D3 mRNA expression in the blood might be used as diagnostic markers of schizophrenia, revealing the importance of dopamine receptors antagonist as antipsychotics. Key words : Schizophrenia, dopamine D2 receptors, dopamine D3 receptors, mRNA expression.

The mechanism of naringin on the apoptosis of nucleus pulposus cells of human degenerative intervertebral disc by Wnt/β-catenin signaling pathway

Objective To study the effects of naringin on the apoptosis of nucleus pulposus cells of human degenerative intervertebral disc. Methods Nucleus pulposus cells were identified via the toluidine blue and safranin O. Next, P3 cells were cultured with naringin 0 μg/ml (control group), naringin group (10, 20, 40, 80, 100 μg/ml). After 48 hours, the best concentration of naringin was selected by cell counting kit-8 (CCK-8) and flow cytometry. β-catenin, Cyclin D1, c-Myc gene expression was detected by real-time quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR). The expression of B cell lymphoma/leukemia-2 (bcl-2), bcl-2 associated X protein (bax), Caspase-3 protein, type Ⅱ collagen and proteoglycan was determined by enzyme linked immunosorbent assay (ELISA). Western blotting detected of type Ⅱ collagen and proteoglycan expression. Results The results of cells staining were positive. CCK-8 and flow cytometry were used to determine the optimum concentration of naringin (20 μg/ml) to inhibit the apoptosis of nucleus pulposus cells. In the human degeneration nucleus pulposus cells, the expression of β-catenin gene was overexpressed and the expression of Cyclin D1 and c-Myc gene was down regulated. 20g/ml naringin could down regulate the expression of β-catenin gene (P=0.000), and up regulate the expression of Cyclin D1 and c-Myc gene (P=0.000, 0.001). The naringin (20 μg/ml) could obviously regulate up the expression of bcl-2, type Ⅱ collagen and proteoglycan protein (P=0.001, 0.000, 0.023), and regulate down the expression of bax and Caspase-3 protein, (P=0.001, 0.001). Western blotting showed that 20 μg/ml naringin could promote the expression of type Ⅱ collagen and proteoglycan. Conclusion Naringin may inhibit the apoptosis of nucleus pulposus cells by regulating the Wnt/β-catenin pathway and the mitochondrial apoptosis pathway. Key words: Naringin; Human nucleus pulpous; Apoptosis; Intervertebral disc; Degeneration

Dopamine receptor D2 gene polymorphism, urine fluoride, and intelligence impairment of children in China: A school-based cross-sectional study

ObjectiveWe aimed to study the association of urine fluoride with intelligence quotient (IQ) in children with a careful consideration of up to 30 potential confounding factors as well as possible heterogeneity of the relation between urine fluoride levels and IQ scores across children with different dopamine receptor-2 (DRD2) Taq 1A genotypes (CC, CT, and TT). MethodsA school-based cross-sectional study design was applied. A total of 323 children (2014–2015, 7–12 years old) were enrolled from four schools in both historical endemic and non-endemic areas of fluorosis in Tianjin of China using a cluster sampling method. Urine fluoride levels and age-specific IQ scores in children were measured at the enrollment. Polymerase chain reaction-restriction fragment length polymorphism methods were used to genotype DRD2 Taq 1A polymorphism with genomic DNA isolated from whole blood collected at the enrollment. Multiple linear regression models were applied to evaluate the relationship between urine fluoride levels and IQ scores overall and within the DRD2 Taq 1A SNP = CC/CT and TT subgroups. Model robustness was tested through bootstrap, sensitivity analysis, and cross-validation techniques. A safety threshold of urine fluoride levels for IQ impairment was determined in the subgroup TT. ResultsIn overall participants, the DRD2 Taq 1A polymorphism itself was not related to IQ scores in children who had a high level of urine fluoride. In the CC/CT subgroup, urine fluoride levels and IQ scores in children were unrelated (adjusted β (95% confidence interval (CI)) = − 1.59 (− 4.24, 1.05), p = 0.236). Among the participants carrying the TT genotype, there was a strong and robust negative linear relationship between log-urine fluoride and IQ scores in children (adjusted β (95% CI) = − 12.31 (− 18.69, − 5.94), p < 0.001). Urine fluoride levels had a stronger association with IQ in children carrying the TT genotype (adjusted β = − 12.31, bootstrapped standard error (SE) = 1.28), compared to that in overall participants (adjusted β = − 2.47, bootstrapped SE = 3.75) (Z = 2.483 and bootstrapped p = 0.007). The safety threshold of urine fluoride levels in the subgroup TT was 1.73 mg/L (95% CI = (1.51, 1.97) (mg/L)). ConclusionsThere is heterogeneity in the relation between urine fluoride and IQ across children carrying different DRD2 Taq 1A genotypes. Large-scale epidemiological studies are needed to confirm our findings.

Early-Life Adversity Induces Epigenetically Regulated Changes in Hippocampal Dopaminergic Molecular Pathways

Early-life adversity (ELA) represents a major risk factor for the development of behavioral dysfunctions and mental disorders later in life. On the other hand, dependent on type, time point, and duration, ELA exposure can also induce adaptations, which result in better stress coping and resilience later in life. Guided by the hypothesis that chronic exposure to ELA results in dysfunctional brain and behavior, whereas short exposure to ELA may result in resilience, the behavioral and neurobiological consequences of long-term separation stress (LTSS) and short-term separation stress (STSS) were compared in a mouse model for ELA. In line with our hypothesis, we found that LTSS induced depressive-like behavior, whereas STSS reduced depressive-like behavioral symptoms. We then tested the hypothesis that the opposite behavioral outcomes of the two stress paradigms may be mediated by functional, epigenetically regulated changes of dopaminergic modulation in the hippocampal formation. We found that STSS exposure elevated dopamine receptor D1 (DRD1) gene expression and decreased gene expression of its downstream modulator DARPP-32 (32-kDa dopamine- and cAMP-regulated phosphoprotein), which was paralleled by decreased H3 acetylation at its gene promoter region. In contrast, LTSS elevated DARPP-32 gene expression, which was not paralleled by changes in histone acetylation and DRD1 gene expression. These findings indicate that short- and long-term neonatal exposure to ELA induces changes in dopaminergic molecular pathways, some of which are epigenetically regulated and which either alleviate or aggravate depressive-like symptoms later in life.

Fanconi anemia in twins with neutropenia: A case report.

Fanconi anemia (FA) is a rare inherited disease caused by mutations in genes that are primarily involved in DNA damage response or repair. The disease is often characterized by congenital malformations, progressive bone marrow failure, abnormal skin pigmentation patterns and susceptibility to cancer. The present study describes a pair of 4-year-old male twins, both of whom had been suffering from upper respiratory tract infections for >2 years. There was no indication of discomfort including fever, coughing, bleeding or fatigue from either child when the upper respiratory tract infection disappeared. Physical examination of the twins did not reveal anything significant, and no external anomalies were observed. In order to obtain additional diagnostic evidence, next-generation gene sequencing, chromosome breakage analysis and comet assays were performed. The results revealed double heterozygous mutations in the Fanconi Anemia Complementation Group D2 gene of the twins, therefore providing a conclusive diagnosis of FA. The case highlights how difficulties in clinical diagnosis may be overcome by including genetic screening tests into the range of diagnostic tests, which may also reveal unexpected results.

Advancing the Science of Human Cognition and Behavior

Academy of Management PerspectivesVol. 32, No. 3 From the EditorsAdvancing the Science of Human Cognition and BehaviorPhillip Phan and Mike WrightPhillip Phan and Mike WrightPublished Online:13 Jun 2018https://doi.org/10.5465/amp.2018.0058AboutSectionsView articleView Full TextPDF/EPUB ToolsDownload CitationsAdd to favoritesTrack Citations ShareShare onFacebookTwitterLinkedInRedditEmail View articleREFERENCESBarney, J., & Felin, T. (2013). What are microfoundations? Academy of Management Perspectives, 27(2), 138–155.Link , Google ScholarDreber, A., et al. (2009). The 7R polymorphism in the dopamine receptor D4 gene (DRD4) is associated with financial risk taking in men. Evolution and Human Behavior, 30(2), 85–92. Google ScholarFoss, N. J., & Pedersen, T. (2016). Microfoundations in strategy research. Strategic Management Journal, 37, E22–E34. Google ScholarGreen, C. S., & Bavelier, D. (2008). Exercising your brain: A review of human brain plasticity and training-induced learning. Psychology and Aging, 23(4), 692–701. Google ScholarMitchell, R. K., Busenitz, L., Lant, T., McDougall, P. P., Morse, E. A., & Smith, J. B. (2002). Toward a theory of entrepreneurial cognition: Rethinking the people side of entrepreneurship research. Entrepreneurship Theory and Practice, 27(2), 93–104. Google ScholarRumelt, R. P. (1991). How much does industry matter? Strategic Management Journal, 12(3), 167–185. Google ScholarShane, S., & Nicolaou, N. (2013). The genetics of entrepreneurial performance. International Small Business Journal, 31(5), 473–495. Google ScholarShikishima, C., Hiraishi, K., Yamagata, S., Ando, J., & Okada, M. (2015). Genetic factors of individual differences in decision making in economic behavior: A Japanese twin study using the allais problem. Frontiers in Psychology, 6, 1–9. Google ScholarZuckerman, M., & Kuhlman, D. M. (2000). Personality and risk‐taking: Common bisocial factors. Journal of Personality, 68, 999–1029. Google ScholarFiguresReferencesRelatedDetailsCited byOpportunity: Is There a Future in the Construct?Mike Wright and Phillip Phan8 September 2020 | Academy of Management Perspectives, Vol. 34, No. 3 Vol. 32, No. 3 Permissions Metrics in the past 12 months History Published online 13 June 2018 Published in print 1 August 2018 Information© Academy of Management PerspectivesDownload PDF

Two new species of Scapheremaeus from Southern Japan (Acari: Oribatida: Cymbaeremaeidae), with genetic information

The present paper deals with two new species of oribatid mites of the genus Scapheremaeus Berlese, 1910 from the subtropical islands in Southern Japan. Scapheremaeus nakanoshimensis sp. nov. and Scapheremaeus boninensis sp. nov. are proposed on the basis of adults. Furthermore, we present data on distribution, diversity and habitat ecology of all known species of Scapheremaeus in Japan, and a key is provided for identification of hitherto recorded species in this country. Majority of Scapheremaeus species found in Japan are known to be restricted to areas of Southern Japan and Eastern China. Only one of the species has a relatively broad distribution in South America and East Asia. Most species of Scapheremaeus in Japan are inhabitants of soil and litter of various forests, and mosses growing on rocks, but few of them are arboreal. The D3 fragments of the 28S rRNA (28S D3) and 18S rRNA genes of Scapheremaeus nakanoshimensis sp. nov. are sequenced and data are available in the sequence database. Comparison of the 28S D3 gene sequence of Scapheremaeus nakanoshimensis sp. nov. with other oribatid mites gene sequences identifies that the representatives of Scutoverticidae (Scutovertex, Provertex, Exochocepheus) and Eremaeozetidae (Eremaeozetes), Ameronothridae (Ameronothrus) and Phenopelopidae (Eupelops) are the closest relatives to Scapheremaeus with regard to the species included in this analysis.

The Association Between DRD3 Ser9Gly Polymorphism and Depression Severity in PD

Background: More and more evidence suggests that dopamine receptor D3 gene (DRD3) plays an important role in the clinical manifestations and the treatment of Parkinson's disease (PD). DRD3 Ser9Gly polymorphism is the most frequently studied variant point. Our aim was to investigate the potential effect of DRD3 Ser9Gly polymorphism on modulating resting-state brain function and associative clinical manifestations in PD patients. Methods: We consecutively recruited 61 idiopathic PD patients and 47 healthy controls (HC) who were evaluated by clinical scales, genotyped for variant Ser9Gly in DRD3 and underwent resting-state functional magnetic resonance imaging. Based on DRD3 Ser9Gly polymorphism, PD patients and HCs were divided into four subgroups. Then, two-way analysis of covariance (ANCOVA) was applied to investigate main effects and interactions of PD and DRD3 Ser9Gly polymorphism on the brain function via amplitude of low-frequency fluctuations (ALFF) approach. The association between DRD3 Ser9Gly-modulated significantly different brain regions and clinical manifestations was detected by Spearman's correlations. Findings: PD patients exhibited decreased ALFF values in right inferior occipital gyrus, lingual gyrus and fusiform gyrus. A significant difference in the interaction of groups × genotypes was observed in right medial frontal gyrus. The ALFF value of the cluster showing significant interactions was positive correlated with HAMD-17 scores (r=0.489, p=0.011) in PD patients with the Ser/Gly or Gly/Gly genotypes. Interpretation: D3 gene Ser9Gly polymorphism might be associated with depression severity in PD patients. Funding Statement: This work was supported by the National Natural Science Foundation of China (No.81671258), the Science and Technology Project of Jiangsu Provincial Commission of Health and Family Planning (No.H201602), the Natural science foundation of Jiangsu Province (No.BK20141494), the Jiangsu Provincial Personnel Department “the Great of Six Talented Man Peak” Project (No.2014-WSN-013), the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Science and Technology Project of Jiangsu Bureau of Traditional Chinese Medicine (No.YB2015163). Declaration of Interests: The authors declare none. Ethics Approval Statement: This study was approved by the ethics committee of the First Affiliated Hospital of Nanjing Medical University and all participants provided us with written informed consent before participating in the experiment.

Potential Role of Brain-Derived Neurotrophic Factor and Dopamine Receptor D2 Gene Variants as Modifiers for the Susceptibility and Clinical Course of Wilson's Disease.

Wilson's disease (WD), an inborn error of copper metabolism caused by mutations in the ATPase copper transporting beta (ATP7B) gene, manifests variable age of onset and different degrees of hepatic and neurological disturbances. This complex phenotypical outcome of a classical monogenic disease can possibly be explained by modifier loci regulating the clinical course of the disease. The brain-derived neurotropic factor (BDNF), critical for the survival, morphogenesis, and plasticity of the neurons, and the dopamine receptor D2 (DRD2), one of the most abundant dopamine receptors in the brain, have been highlighted in the pathophysiology of various neuropsychiatric diseases. This study aims to identify the potential association between BDNF and DRD2 gene polymorphisms and WD and its clinical characteristics. A total of 164 WD patients and 270 controls from India were included in this study. Two BDNF polymorphisms [p.Val66Met (c.G196A) and c.C270T] and the DRD2 Taq1A (A2/A1 or C/T) polymorphism were examined for their association with WD and some of its clinical attributes, using polymerase chain reaction, restriction fragment length digestion, and bidirectional sequencing. The C allele and CC genotype of BDNF C270T were significantly overrepresented among controls compared to WD patients. In addition, a significantly higher proportion of the allele coding for Val and the corresponding homozygous genotype of BDNF Val66Met polymorphism was found among WD patients with age of onset later than 10years. Furthermore, the A1A1 genotype of DRD2 Taq1A polymorphism was significantly more common among WD patients with rigidity. Our data suggest that both BDNF and DRD2 may act as potential modifiers of WD phenotype in the Indian context.

Anxiety behavior and hypothalamic-pituitary-adrenal axis altered in a female rat model of vertical sleeve gastrectomy.

Surgical weight loss results in a host of metabolic changes that culminate in net positive health benefit to the patients. However, the psychological impact of these surgeries has not been fully studied. On one hand, surgical weight loss has been reported to improve standard quality of life and resolution of symptoms of depression. But on the other hand, reports of self-harm and increased ER visits for self-harm suggest other psychological difficulties. Inability to handle anxiety following surgical weight loss has alarming potential ramifications for these gastric surgery patients. In the present study, we used models of diet-induced obesity and vertical sleeve gastrectomy (VSG) to ask whether anxiety behavior and hypothalamic-pituitary-adrenal (HPA) axis gene changes were affected by surgical weight loss under two diet regimens: i.e. low-fat diet (LFD) and high-fat diet (HFD). We show reduced exploratory behavior in the open field test but increased time in the open arms of the elevated plus maze. Furthermore, we show increased plasma levels of corticosterone in female VSG recipients in the estrus phase and increased levels of hypothalamic arginine-vasopressin (avp), pro-opiomelanocortin (pomc), and tyrosine hydroxylase (th). We report reduced dopamine receptor D1 (drd1) gene in prefrontal cortex (PFC) in VSG animals in comparison to Sham. Further we report diet-driven changes in stress-relevant gene targets in the hypothalamus (oxt, pomc, crhr1) and adrenal (nr3c1, nr3c2, mc2r). Taken together, these data suggest a significant impact of both surgical weight loss and diet on the HPA axis and further impact on behavior. Additional assessment is necessary to determine whether molecular and hormonal changes of surgical weight loss are the source of these findings.