Cytochrome-b Gene Research Articles

Revealing the Genetic Differentiation of Rattus norvegicus (Berkenhout 1769) Populations by Analyzing Two Mitochondrial Markers

Rattus norvegicus (Brown rat) has a great importance for public health and economy because it lives in close association with human populations. However, molecular systematic studies on global populations of R. norvegicus are very few. In this study, sequences obtained from Europe, Asia, Africa, and America regions were analyzed using mitochondrial Cytochrome-b and Cytochrome oxidase-I gene regions and genetic differentiation levels between these populations were revealed. Accordingly, samples belonging to the studied populations did not split in Bayesian Inference trees and Median-joining networks; these samples also formed common haplotypes, and mean genetic distance and fixation index values were generally low. The results of the study showed that gene flow between these populations may be continuing due to the transportation activity by humans.

Molecular species identification from seized dried genital organs: a case study of suspected Bengal monitor lizard (Varanus bengalensis)

The bifurcated hemipenes of any of the four species of Monitor lizards found in India is illegally traded under the name ‘Hatha Jodi’ (a plant root from Martynia annua). A rare plant root is misrepresented as a powerful charm capable of bringing property and good fortune to its possessor. As a result, there is a suspected large-scale poaching of monitors in India to fuel the trade of ‘Hatha Jodi’. With this regard, here we report a case where the Tamil Nadu Forest Department officers seized dried genital organs. We extracted DNA from the seized dried genital organs and amplified a partial fragment of the mitochondrial cytochrome-b gene (cytb). Then, generated DNA sequences were analyzed and confirmed that the dried genital organs were consistent with the Bengal monitor lizard with 99% similarity. In forensic case analysis, dried and processed samples are not preferred for DNA-based analysis. This is due to the low yield of DNA and increased PCR inhibitors, which lead to low success in such experiments. However, the present study demonstrated species identification through DNA analysis from seized dried genital organs and supported law enforcement in successfully prosecuting the case.

Molecular genetic diversity analysis of the Nigerian laughing dove (Streptopelia senegalensis) and related species using selected mitochondrial genes

Nigerian laughing doves (Streptopelia senegalensis) are small birds with long tail and living in bushes of the Sub-Saharan regions of African continent, the middle East and Asia, especially India. They are used for food, medicinal and religious purposes in Nigeria. Despite their usage, there is a lack of information on the genetic diversity of laughing doves in Nigeria. This study investigates taxonomic order and diversity of Nigerian laughing doves based on the mitochondrial cytochrome oxidase subunit I (COI) and cytochrome B (CYTB). The results showed 20 haplotypes within the 28 Nigerian coupled with Global Streptopelia genus using concatenated sequences. The Nigerian laughing dove constitute 16 distinct haplotypes. The haplotype diversity was 0.743 ± 0.070, and nucleotide diversity 0.154 ± 0.101 within Nigerian population using COI sequences. Phylogenetic tree showed that Nigerian laughing doves were in the same monophyletic clade with other Streptopela orientalis, S. decocto and S. chinensis; and this confirmed that Nigerian laughing doves might have shared descendant. The median-joining network further grouped Nigerian laughing doves into two: the first group consisting of Nigerian populations only, while the second group are with Saudi Arabian and Djiboutian populations. Population expansion was revealed in Nigerian dove individuals. This study revealed 16 unique haplotypes among Nigerian laughing dove population using concatenated sequences. Interestingly, CYTB showed clustering in African laughing doves (For instance, Nigerian individuals shared haplotypes with Sao Tome and Principe, an island country in the Gulf of Guinea, the western equatorial coast of Central Africa). The current data is the first report on genetic diversity of Nigerian laughing dove using mitochondrial COI and CYTB genes.

Five new unexpected populations of endangered tuco-tuco Ctenomys rionegrensis (Rodentia, Ctenomyidae) help understanding its distribution and historical biogeography

In this study, we conducted a survey of newly discovered populations of tuco-tuco (subterranean rodents of the genus Ctenomys) in the Entre Ríos province, in an area characterized by its unexplored nature and its climatic and biogeographic complexity within Argentina, which includes two National Parks. We characterize the nucleotide sequences of the cytochrome-b gene, revealing the presence of seven novel haplotypes within Ctenomys rionegrensis, a species known to inhabit both sides of the Uruguay River. Through Bayesian analyses, we estimated the divergence times of the oldest lineages of C. rionegrensis, as well as those of the haplotypes located east of the Uruguay River, dating back approximately 630,000 years before present (ybp) and 526,000 ybp, respectively. These estimates correspond with significant paleogeographic events in the region. Our findings may raise questions regarding the taxonomic classification of the species and suggest potential modifications to its current endangered status as designated by the International Union for Conservation of Nature (IUCN). Consequently, this research provides valuable insights that may inform future revisions of the species' conservation status and guide the development of informed management strategies/policies.

Analysis of Genetic Diversity and Population Structure of Endemic Endangered Goose (Anser cygnoides) Breeds Based on Mitochondrial CYTB.

The analysis of the genetic diversity and historical dynamics of endemic endangered goose breeds structure has attracted great interest. Although various aspects of the goose breed structure have been elucidated, there is still insufficient research on the genetic basis of endemic endangered Chinese goose breeds. In this study, we collected blood samples from Lingxiang White (LX), Yan (YE), Yangjiang (YJ), Wuzong (WZ), Xupu (XP), and Baizi (BZ) geese (Anser cygnoides) and used Sanger sequencing to determine the partial sequence of the cytochrome b (CYTB) gene in a total of 180 geese. A total of 117 polymorphic sites were detected in the 707 bp sequence of the mtDNA CYTB gene after shearing and correction, accounting for approximately 16.55% of the entire sequence. The AT content (51.03%) of the processed sequence was slightly higher than the GC content (48.97%), indicating a preference for purine bases. The YJ, YE, and WZ breeds had the highest population genetic diversity, with a haplotype diversity greater than 0.9 (Hd > 0.9) and average population nucleotide difference of 8.01 (K > 8.01). A total of 81 haplotypes were detected and divided into six major branches. Among the six goose breeds, there were frequent genetic exchanges among LX, YJ, YE, and WZ geese (Nm > 15.00). We analyzed the distribution of base-mismatch differences in goose breeds and tested their historical dynamics for neutrality in Tajima's D and Fu's Fs. For YJ and WZ geese, Tajima's D > 0, but the difference was not significant (p > 0.05). The actual values for the two breeds exhibited multimodal Poisson distributions. The population patterns of the WZ and YJ geese are purportedly relatively stable, and the breeds have not experienced population expansions or bottleneck effects, which is consistent with the neutrality test results. This study provides new insights into the diverse genetic origins and historical dynamics that sustain endemic endangered goose breeds.

Monilia and Monilinia : In silico genetic analysis of plant pathogenic fungi

Species of phytopathogenic fungi Monilia [J. Hill, 1751] and Monilinia [E.E. Honey, 1936] of the phylum Ascomycota have two host plant families of stone- and pome fruit trees of Rosaceae; and bushes of Ericaceae (e.g., blueberry, cranberry, heather, etc.). They infect both plants, and human (i.e., moniliasis). Due to the lack of sexual developmental stage (i.e., imperfect fungi; anamorphic fungi) the species of the order Moniliales spread by vegetative spores (i.e., conidia) and not by sexual (i.e., meiotic) ascospores. Here we report in silico data mining carried out by analyses of DNA, RNA, and protein sequences to reveal genetic distances in -and-among Monilia and Monilinia species. Sequences of the (+)ssRNA genomes of mitoviruses, which hyper parasitize the fungi cells, which parasitize the plant cells, during the ecocycles, are also analyzed. Genome size analysis of Monilinia were found to be between 30-55 x 106 bp; the cytochrome-b (cytb) genes (1543 bp of mtDNA); the transcribed cytb-mRNAs; the translated cytb proteins (381-391 aa); and the (+)ssRNA genomes of mitoviruses have showed that Botrytis cinerea (‘grey mold’) has the closest molecular similarity to Monilia and Monilinia clade (‘brown rot’). The cladogram of transcribed cytb-mRNAs (1175 nt) grouped Monilinia vaccinii-corymbosi in a distinct clade, which indicate a far genetic linkage. The application of mitovirus-infected hypovirulent phytopathogenic fungi for plant protection (i.e., virocontrol / biocontrol) is discussed.

The Origin of Indonesian Guinea Pig (Cavia porcellus) Inferred from Mitochondrial Cytochrome-b Gene

The Origin of Indonesian Guinea Pig (Cavia porcellus) Inferred from Mitochondrial Cytochrome-b Gene

Mitochondrial Genome-Encoded Long Noncoding RNA Cytochrome B and Mitochondrial Dysfunction in Diabetic Retinopathy.

Aims: Mitochondrial dysfunction is closely associated with the development of diabetic complications. In diabetic retinopathy, electron transport chain is compromised and mitochondrial DNA (mtDNA) is damaged, downregulating transcription of mtDNA-encoded cytochrome B (CYTB) and its antisense long noncoding RNA, long noncoding RNA cytochrome B (LncCytB). Our goal was to investigate the role of LncCytB in the regulation of CYTB and mitochondrial function in diabetic retinopathy. Methods: Using human retinal endothelial cells, genetically manipulated for LncCytB (overexpression or silencing), the effect of high glucose (20 mM d-glucose) on LncCytB-CYTB interactions (by chromatin isolation by RNA purification), CYTB gene expression (by real-time quantitative polymerase chain reaction), complex III activity, mitochondrial free radicals, and oxygen consumption rate (OCR, by Seahorse XF analyzer) was investigated. Key results were confirmed in the retinal microvessels from streptozotocin-induced diabetic mice. Results: High glucose decreased LncCytB-CYTB interactions, and while LncCytB overexpression ameliorated glucose-induced decrease in CYTB gene transcripts, complex III activity and OCR and increase in mitochondrial reactive oxygen species, LncCytB-siRNA further attenuated CYTB gene transcription, complex III activity, and OCR. Similar decrease in LncCytB-CYTB interactions and CYTB transcription was observed in diabetic mice. Furthermore, maintenance of mitochondrial homeostasis by overexpressing superoxide dismutase or sirtuin 1 in mice ameliorated diabetes-induced decrease in LncCytB-CYTB interactions and CYTB gene transcripts, and also improved complex III activity and mitochondrial respiration. Innovation and Conclusion: LncCytB downregulation in hyperglycemic milieu downregulates CYTB transcription, which inhibits complex III activity and compromises mitochondrial stability and OCR. Thus, preventing LncCytB downregulation in diabetes has potential of inhibiting the development of diabetic retinopathy, possibly via maintaining mitochondrial respiration. Antioxid. Redox Signal. 39, 817-828.

Combination of PCR analysis and sequencing on cytochrome-b gene Canis lupus familiaris for halal authentication

The adulteration of beef with lower-priced meat, such as dog meat, is common to get economic profit. Dog meat is one type of meat that is not halal for consumption. There are several ways in which beef can be adulterated, including the use of dog meat. Specific primers for cytochrome-b (CYTBCA3-kh) can be used to identify the presence of dog meat contamination. This study aimed to identify dog meat using these primers. After conducting conventional PCR and agarose electrophoresis tests, the specificity of the primers was confirmed. Following this, the DNA base sequence was analyzed using a sequencing method to ensure accurate identification of dog meat contamination in beef. Specific dog primers tested on cattle, pigs, wild boars, goats, chickens, rabbits, and rats were confirmed using conventional PCR and agarose gel electrophoresis. Amplicon length verification was analyzed in a silico sequencing method using MUSCLE and BLAST NCBI software. The results showed that the primer CYTBCA3-kh amplified the canine Cyt-b mt-DNA gene specifically. The amplicon length obtained was 111 base pairs (bp), with a similarity value of 99.12% with Canis lupus familiaris mitochondrion, complete genome. The specific primer CYTBCA3-kh can be used to identify dog ​​meat contamination in meatball products for halal authentication. Keywords: CYTB gene, Halal Authentication, PCR, Sequencing, Canis lupus familiaris

Low genetic diversity and shallow population structure in the broom hare, Lepus castroviejoi (Lagomorpha: Leporidae)

Abstract The broom hare (Lepus castroviejoi) is a threatened Iberian endemic, for which there is limited knowledge. We use genetic non-invasive sampling (gNIS; N = 185 faeces samples) and specimens from hunting and roadkills (N = 22) in conjunction with a 15-microsatellite panel and a 541-bp fragment of cytochrome-b to assess the genetic diversity, population structure and evolutionary history of this species. Populations from the other four European hare species were also analysed to accurately compare the genetic diversity patterns and infer admixture. Species identification from gNIS was inferred using small fragments of cytochrome-b and transferrin genes and individual identification was obtained using microsatellites. The broom hare population showed the lowest level of nuclear DNA diversity of all analysed hare species (N = 76; Na = 2.53, He = 0.186 and Fis = 0.341) and very low mitochondrial DNA diversity (N = 64; Hd = 0.743 and π = 0.01543). Only the Italian hare (L. corsicanus) showed a similar pattern of low genetic diversity. No hybridization with the neighbouring hare species was detected. However, two mitochondrial DNA lineages, corresponding to two ancient events of introgression of mountain hare (L. timidus) origin, were characterized. There was evidence for shallow spatial population differentiation of the broom hare. The described reduced genetic diversity, associated with a narrow distribution range and recent population declines, represents a risk of population extinction, and highlights the need for conservation measures of this endemic threatened hare species.

A comparative analysis of different DNA extraction methods for fish tissues

Nucleic acids extraction is the initial stage of molecular genetic research. The effectiveness of using a certain method of DNA extraction is determined by the amount of extracted DNA, the degree of probe degradation, the time consuming and laboriousness of the procedure. When researching rare, endangered species and populations, special attention is paid to extracting DNA from sources that do not cause destruction or death of individual. The current study was aimed at comparison the effectiveness of the most common methods of genomic DNA isolation from fish tissues for further use in the polymerase chain reaction. Essentially three DNA extraction methods were employed and compared for the quality of isolated DNA ‒ the phenol-chloroform extraction method, the salt extraction method, and the sodium perchlorate extraction method. Samples of fins, liver and caver taken from sterlet individuals fixed in ethanol served as material for research. The study of the effect of DNA probe quality on PCR course was carried out using two types of PCR ‒ site-specific, amplifying the fragment of cytochrome-b gene, and multilocus ‒ ISSR-PCR with a trinucleotide primer (AGC)6T. A comparison of DNA extraction methods confirmed that all of them enable obtaining high-quality DNA from both fresh and archival fish tissue samples for site-specific amplification. The yield of nucleic acids using different fish tissues (fins, liver and caver) is not the same. Therefore, when it is necessary to obtain the maximum amount of DNA, it is advisable to use the salt extraction method. In case of ISSR-PCR, different degrees of DNA purification affected the course of amplification. Additional purification by the method of sorption on Silica allows removing possible PCR inhibitors and obtaining clear spectra of electrophoretic separation of amplification products, regardless of primary DNA quality. Key words: DNA extraction methods, sterlet tissues, site-specific PCR, multilocus PCR.

Genetic Diversity of Jinshaia sinensis (Cypriniformes, Balitoridae) Distributed Upstream of the Yangtze River

The upper reaches of the Yangtze River (upper YR) are a biological zone with extremely rich fish diversity, especially endemic fish. However, long-term human interference, such as environmental pollution and cascade hydropower construction, has significantly changed the habitat of many fish and is threatening the number and genetic diversity of fish populations. Jinshaia sinensis is a typical small and endemic but rare fish that is found in the upper YR, and its genetic diversity and structure still need further study. To understand the current levels of genetic diversity in J. sinensis, we analyzed the genetic diversity, population history, genetic structure, etc., of three J. sinensis populations based on two mitochondrial genes (the cytochrome-c oxidase subunit I, COI, and cytochrome-b gene, Cytb) and two nuclear genes (recombination-activating protein 1, RAG1, and rhodopsin, RH). The genetic diversity analysis indicated that J. sinensis had high genetic diversity, with high haplotype diversity (h) and nucleotide diversity (Pi). Population pairwise FST analysis revealed a significant genetic divergence between the Lijiang and Luzhou populations for all genes and between the Panzhihua and Luzhou populations, except for the COI gene; however, analyses of molecular variance (AMOVA) showed no significant geographic genetic structure among populations, and gene flow analysis also indicated a certain degree of gene exchange among populations. Haplotype network structure analyses revealed low levels of shared haplotypes among populations. Neutrality test and mismatch distribution results indicated that only the Lijiang population had experienced obvious population expansion. Overall, these results indicate that J. sinensis is still a single evolutionarily significant unit, but when considering the threat of habitat disturbance to the population, it is still necessary to carry out long-term genetic monitoring on J. sinensis and on other endemic fishes with similar ecological habits in order to maintain the genetic diversity of fishes in the upper YR.

Historical DNA of rare yellow-eared bats Vampyressa Thomas, 1900 (Chiroptera, Phyllostomidae) clarifies phylogeny and species boundaries within the genus

Patterns of rarity, endemism, and vulnerability are known for four species of yellow-eared bats of the genus Vampyressa: V. melissa, V. voragine, V. elisabethae, and V. sinchi, the last two described based on skull and external morphology. We extracted DNA from the holotypes of V. elisabethae and V. sinchi using strict ancient DNA protocols and sequenced the complete cytochrome-b gene of the mtDNA to investigate the phylogenetic relationships within the genus and employed species-delimitation tests to evaluate the validity of all the currently named species of Vampyressa. The resulting tree topology and our species-delimitation analyses corroborate the validity of V. elisabethae and V. voragine, but places V. sinchi in V. melissa. Based on these results and phenotypic variation, we recognize five valid species in Vampyressa and treat sinchi as a subspecies of a polytypic V. melissa; for which we provide a rediagnosis. Our results show that V. elisabethae is as highly divergent genetically as it is morphologically, and suggest that V. thyone, one of the two species of Vampyressa known to have wide distributions, is a species complex requiring further investigation.

Prevalence and pathology of Cephalopina titillator infestation in Camelus bactrianus from Xinjiang, China

BackgroundIn camels, nasopharyngeal myiasis is caused by the larvae of Cephalopina titillator, which parasitize the tissues of nasal and paranasal sinuses, pharynx, and larynx. C. titillator infestation adversely affects the health of camels and decreases milk and meat production and even death. However, the C. titillator infestation in Bactrian camels has not been widely studied.MethodsThe present study was conducted to determine the prevalence and risk factors of C. titillator in Bactrian camels of northwestern Xinjiang. Suspected larvae recovered from infested camels were evaluated for C. titillator by microscopy and polymerase chain reaction. Nucleotide sequences of the partial mitochondrial cytochrome c oxidase subunit I (COX1) and cytochrome b (CYTB) genes from the C. titillator of camels were aligned from the NCBI database. Furthermore, the gross and histopathological alterations associated with C. titillator infestation were evaluated via pathological examination.ResultsOf 1263 camels examined 685 (54.2%) camels were infested with suspected C. titillator larvae. Different larval stages were topically detected in the nasal passages and pharynx of the camel heads. Microscopy analysis of the pharyngeal mucosa tissue revealed necrotic tissue debris and some inflammatory cells. Molecular detection of the larval COX1 and CYTB genes indicated that pathogen collected in Bactrian camels was C. titillator. The epidemiological study demonstrated that the prevalence rate of C.titillator infestation was significantly higher in camels of Bestierek Town Pasture (67.2%) and Karamagai Town Pasture (63.6%) compared to Kitagel Town Pasture (38.7%) and Qibal Town Pasture (35.8%) (P < 0.05). No significant difference was observed between the prevalence rates in male (52.6%) and female (54.6%) camels (P > 0.05). The prevalence was higher in warm (64.2%) than that in cold (48.4%) seasons (P < 0.001). The prevalence in camels with non-nomadic method (67.2%) was significantly higher than in animals with nomadic method (47.5%) (P < 0.001). The prevalence of C.titillator infestation was significantly higher in animals of aged 5–10 (60.1%) and aged > 10 (61.1%) years old compared to those of aged < 5 (31.7%) years old camels (P < 0.001).ConclusionOur results confirm that there is a high prevalence of C. titillator in Bactrian camels from Xinjiang, closely related to age, season, pasture environment, and husbandry methods. Developing prevention, diagnosis, and control programs to prevent transmission is necessary.

Unveiling the Genetic Diversity of Declining Population of the Harvest Mouse Micromys minutus in Italy

The Italian peninsula represented one of the main glacial refugia during climatic oscillations of the Pleistocene, currently being a biodiversity hotspot. In this work, we analysed for the first time the genetic diversity of harvest mouse populations in Italy, and we compared them with those of the rest of Eurasia. Mitochondrial cytochrome-b gene was amplified from 12 samples from throughout the Italian range. We recorded a very low genetic diversity, in line with the rest of the harvest mouse range. In the comparative phylogenetic tree, Northern Italy samples clustered together as a sister group of the rest of Europe, whereas those from Central Italy clustered with Central Europe samples. Harvest mice have recently conquered Southern Europe, i.e., possibly at the start of the Holocene. The global genetic homogeneity might be due to accidental human-mediated introductions or to the sharp decline of the habitat of the harvest mouse, which may in turn have caused severe bottlenecks in the populations of this small rodent.

Application of the Cytochrome-b gene region in Population Study of Striped Snakehead (Channa striata) by Molecular Approach

Snakehead fish with different geographical differences can have an impact on genetic diversity. DNA barcoding is a system designed to identify a species precisely and accurately by using short and standardized gene regions. This study aims to determine the diversity of snakehead fish populations in four areas in East Java. This study used the Cytochrome b (Cyt b) gene sequence in mitochondrial DNA to determine genetic variation in the wild population of Channa striata. The results of DNA barcodes with Cytochrome c oxidase subunit I (COI) showed that all samples were validly C. striata species (99.84-99.85%), while Cyt-b sequences had percentage identity with the same sequence species ranging from 99.74 to 100%. The phylogenetic tree reconstructed using MEGAX resulted in a separate clade in the sequences from East Java. This strengthens the similarity of the population of C. striata species in the Brantas watershed.

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

470-P: Mitochondrial Long Noncoding RNA and the Compromised Electron Transport Chain Machinery in Diabetic Retinopathy

Purpose: Diabetic retinopathy has a complex pathogenesis, and mitochondrial damage is considered to play a central role. Diabetes dysfunctions the mitochondria and damages their DNA (mtDNA) , decreasing the transcription of mtDNA-encoded genes including Cytochrome B (CYTB) , which is important for the functioning of complex III of the electron transport chain system (ETC) . This propagate the vicious cycle of free radicals. Diabetes also decreases mtDNA-encoded long non-coding RNA Cytochrome B (LncCytB) . Although long noncoding RNAs have no open reading frame for translation, they can bind to the DNA or RNA in a sequence specific manner and alter the gene expression. Our aim was to investigate the role of LncCytB in regulating CYTB-ETC system in diabetic retinopathy. Methods: Human retinal endothelial cells, incubated in 5mM (normal) or 20mM (high) D-glucose, were used to quantify the expressions of LncCytB (by strand-specific PCR) and CYTB (qRT-PCR) . The binding of LncCytB at CYTB promoter was determined by Chromatin isolation by RNA Purification method. Role of LncCytB in regulating CYTB expression and mitochondrial damage was performed in the cells overexpressing LncCytB. Results: Compared to cells in normal glucose, LncCytB and CYTB levels were decreased by over 50% in the cells exposed to high glucose, the binding of LncCytB at CYTB promoter was reduced by ∼40% and the activity of the complex III was inhibited. Overexpression of LncCytB ameliorated glucose-induced decrease in CYTB gene transcripts, and increase in mtDNA damage and in mitochondrial reactive oxygen species. Conclusions: Due to decreased interactions between LncCytB-CYTB in hyperglycemic milieu, CYTB transcripts are decreased, and this compromises the ETC system, resulting in increased mitochondrial ROS. Thus, regulating LncCytB levels in diabetes could halt the self-propagating cycle of free radicals, and prevent the development of diabetic retinopathy. Funding EY014370, EY017313, and EY022230

Analysis of mitochondrial DNA cytochrome-b (CYB) and ATPase-6 gene mutations in COVID-19 patients.

Coronavirus disease of 2019 (COVID‐19) is a pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2). Mutations of mitochondrial DNA (mtDNA) are becoming increasingly common in various diseases. This study aims to investigate mutations in the cytochrome‐b (CYB) and adenosine triphosphatase‐6 (ATPase‐6) genes of mtDNA in COVID‐19 patients. The association between mtDNA mutations and clinical outcomes is investigated here. In the present study, mutations of the mtDNA genes CYB and ATPase‐6 were investigated in COVID‐19 (+) (n = 65) and COVID‐19 (−) patients (n = 65). First, we isolated DNA from the blood samples. After the PCR analyses, the mutations were defined using Sanger DNA sequencing. The age, creatinine, ferritin, and CRP levels of the COVID 19 (+) patients were higher than those of the COVID‐19 (−) patients (p = 0.0036, p = 0.0383, p = 0.0305, p < 0.0001, respectively). We also found 16 different mutations in the CYB gene and 14 different mutations in the ATPase‐6 gene. The incidences of CYB gene mutations A15326G, T15454C, and C15452A were higher in COVID‐19 (+) patients than COVID‐19 (−) patients; p < 0.0001: OR (95% CI): 4.966 (2.215−10.89), p = 0.0226, and p = 0.0226, respectively. In contrast, the incidences of A8860G and G9055A ATPase‐6 gene mutations were higher in COVID‐19 (+) patients than COVID‐19 (−) patients; p < 0.0001: OR (95%CI): 5.333 (2.359−12.16) and p = 0.0121 respectively. Yet, no significant relationship was found between mtDNA mutations and patients' age and biochemical parameters (p > 0.05). The results showed that the frequency of mtDNA mutations in COVID‐19 patients is quite high and it is important to investigate the association of these mutations with other genetic mechanisms in larger patient populations.

Genetic Indications for Anadromous Hilsa Shad (Tenualosa ilisha) in Shatt Al-Arab River Using mtDNA Cytochrome B Gene

Hilsa species are broadly described as largely anadromous fish with a large valuable population size. It is well-known as one of the most critical commercial and occurs in marine, estuarine and riverine environments Hilsa shad, Tenualosa ilisha locally known as Sbour, migrates to the freshwater environment of the Shatt Al-Arab River systems for breeding. It was determined the genetic variation in 70 specimens of T. ilisha from four sites at the Shatt Al-Arab River, the mtDNA cytochrome-b gene was selected as a molecular marker for detecting genetic diversity, origin, and divergence of the population through comparing them with 6 samples from different locations at Indo-Pacific. The AMOVA analysis showed that the variation between groups is 60.97% and 39.02% within population indicating statistically significant P value (P&lt;0.05). Furthermore, the maximum likelihood phylogenetic tree showed two main clusters of all T. ilisha groups representing two stocks of separated breeding grounds have a common ancestor.