Cytochrome-b Gene Research Articles

Population genetic analysis of the Humboldt’s flying squirrel using high-throughput sequencing

Abstract The San Bernardino flying squirrel (Glaucomys oregonensis californicus) is thought to be the southernmost population of the Humboldt’s flying squirrel (G. oregonensis) and is restricted to the San Bernardino and San Jacinto Mountains in California. However, recent surveys indicate they have been extirpated from the latter locality. In this study, we characterized the intraspecific genetic structure and diversity of G. oregonensis. We amplified and sequenced at least 300 bp of the mitochondrial cytochrome-b gene and 11 nuclear microsatellites to provide baseline genetic data for this species and subspecies, investigate G. oregonensis genetic structure with a focus on the subspecies distributed in California, and finally evaluate the genetic diversity within G. o. californicus. Population and phylogenetic analyses were performed on a total of 147 samples (tissue, hair, and museum specimen) using the Illumina high-throughput sequencing (HTS) platform, thereby bioinformatically coding microsatellite alleles using established pipelines. Our results indicate reduced genetic diversity in G. o. californicus and highlight genetic distinctiveness of the San Jacinto population. In addition, the differences in genetic diversity between the mitochondrial and nuclear markers suggest sex-biased dispersal and historic separation of the species in multiple refugia followed by more recent gene flow among subpopulations in northern California. This study contributes valuable information toward understanding the genetic variation within G. oregonensis, provides information for future conservation decisions for G. o. californicus, and has novel implications for HTS genotyping-by-sequencing.

Assessing freshwater fish biodiversity of Kumbe River, Papua (Indonesia) through environmental DNA metabarcoding

Context The ability to accurately assess biodiversity is a critical first step towards effective conservation and management. However, assessment of biodiversity using conventional monitoring programs is often constrained by high cost and a lack of taxonomic expertise. Environmental DNA (eDNA) metabarcoding may be a useful tool to efficiently catalogue biodiversity in areas that cannot be easily assessed using other methods. Aims Here, we evaluated the potential of eDNA metabarcoding for assessing fish biodiversity and distribution in the Kumbe River, Papua Province, Indonesia. Methods We selected four sampling locations and collected seven eDNA samples from each location. We used eDNA metabarcoding of the Cytochrome-b gene to characterise the fish community. Key results A total of 23 species were detected, three of which comprised 92% of sequence reads detected: Melanotaenia goldiei (32%), Craterocephalus randi (31%), and the invasive tilapia Oreochromis niloticus (29%). Only five species that were previously detected using conventional methods were detected by metabarcoding: M. goldiei, Craterocephalus stercusmuscarum, O. niloticus, Neoarius graeffei, and Arius arius. We detected 18 species (70% native) that have never been recorded from the Kumbe River. Conclusions This work has demonstrated that fish biodiversity is substantially underestimated in the Kumbe River. Environmental DNA metabarcoding is a promising rapid, non-invasive and cost-effective method for assessing fish biodiversity in Papua. Implications The findings support future investment in eDNA metabarcoding to characterise the fish biodiversity in Papua. This will assist in allocating the limited resources for conservation and management to areas most at risk from anthropogenic impacts.

Molecular Phylogeny of Myllocerus viridanus (Fabricius) by mitochondrial Cytochrome B gene Sequencing

In order to create accurate control techniques against insect pests, correct taxonomic identification is critical. This paper describes the molecular phylogeny of Grey weevil, Myllocerus viridanus (Fabricius) by the sequencing of their mitochondrial cytochrome B gene. The development of a simple and most elegant tools of DNA barcoding has made taxonomy and phylogeny studies a much facile process. M. viridanus is among the important polyphagous pests of plants of agricultural and horticultural importance. The sequencing of Cyt B gene yielded a 273 bp nucleotide product. Phylogentic analysis was carried out in Mega 11 software. Gen Bank deposition indicated the novel and first time records of cytochromeb gene barcode of M. viridanus and first time deposit of a species from the genus Myllocerus. The deposit was provided with an accession number OM223090. Further analysis showed that the partial sequence of mitochondrial cytochrome B of M.viridanus has 88.89% similarity with that of Romualdius bifoveolatus (KX087356) .The identity of M.viridanus(OM223090)ranged from 88.17 to 83.68% when nucleotide BLAST was carried out with nearest 21 species of curculionids (NCBI). The result indicated that cytochrome b gene barcoding can be successfully used to resolve species level identification of the members of the family Curculionidae and the genus Myllocerus of the order Coleoptera. Thus mitochondrial Cytochrome b gene like mitochondrial COX 1 gene, can be used as an efficient tool for the species level identification of the members of Coleopterans. Further interpretation on phylogeny was done by constructing neighbor joining tree using Kimura -2 Parameter. This approach was very informative and it helped in the better understanding of genetic variation among closely related species of Curculionids.

Two new species of Peromyscus (Cricetidae: Neotominae) from the Transverse Volcanic Belt of Mexico.

Specimens of the Peromyscus boylii species group distributed in the western and northeastern montane regions of Michoacán, México, historically have been assigned to P. levipes. Previous studies indicated that these specimens possessed mitochondrial DNA haplotypes that were distinct from both P. levipes and P. kilpatricki, a recently named species in the P. boylii species group from northeastern Michoacán and western Morelos. Herein karyotypic, DNA sequence, and morphological data were analyzed from those populations to evaluate their taxonomic affinity. Karyotypic data indicated that individuals from western Michoacán (Dos Aguas and Aguililla) and from a newly discovered population in northeastern Michoacán (Zinapécuaro) were chromosomally similar to P. carletoni (FN = 68) but distinct from other taxa assigned to the P. boylii species group. Analyses of cranial characteristics indicated that, relative to other species in the P. boylii species group, two morphologically distinct groups were present that corresponded to the Dos Aguas/Aguililla and Zinapécuaro populations, respectively. The latter population, although represented by a small sample size (n = 5 specimens), appeared to exhibit some trenchant morphological distinctions compared with other cryptic species in the P. boylii group. Phylogenetic analyses (parsimony, Bayesian, and likelihood) of DNA sequences obtained from the mitochondrial cytochrome-b gene indicated that although the individuals from Dos Aguas/Aguililla and Zinapécuaro formed a sister group relationship, they formed monophyletic clades that differed genetically (2.54%)-a level approaching that seen between other sister species of Peromyscus. Further, the Dos Aguas/Aguililla and Zinapécuaro clade was more closely aligned with a clade containing representatives of P. carletoni and P. levipes instead of with those from closer geographic proximities (P. kilpatricki) located in eastern Michoacán. Together, these results indicated that these two populations seemingly represent two undescribed species in the P. boylii species group for which we propose the names Peromyscus greenbaumi for populations in western Michoacán (circa Dos Aguas and Aguililla) and Peromyscus ensinki for populations in northeastern Michoacán (circa Zinapécuaro).

Universal primer design for crustacean and bivalve-mollusc authenticity based on cytochrome-b gene

Abstract. Dwiyitno D, Hoffman S, Parmentier K, Keer CV. 2021. Universal primer design for crustacean and bivalve-mollusc authenticity based on cytochrome-b gene. Biodiversitas 23: 17-24. Fish and seafood authenticity is important to support traceability practices and protect the public from economic fraud and adulteration. Molecular-based techniques of PCR are known as the most common methods for identifying seafood species. Nevertheless, these techniques rely on the appropriate primer set designed to amplify specific DNA fragments on targeted species. For efficiency application on a wide range of species, a universal primer set is more valuable than a specific primer. The present study developed universal primers, especially for identifying crustaceans and molluscs based on the cytochrome b mitochondrial DNA (Cyt b). The initial primer pair of CytBL1/CytBH originally designed for fish species was applicable to amplify the Cyt b gene on most selected fish samples, but not for crustacean and mollusc samples. Based on annealing profile, sequence evaluation (92-100% similarity), and RT-PCR analysis, the universal primer couple of CytBL1C/CytBHW designed in the present study potentially applied to identify crustacean and mollusc samples, especially shrimp and bivalve-mollusc.

Microbiomes in Canidae.

Because of their range expansion across North America, coyotes (Canis latrans) now occur sympatrically with numerous other predator species, including red foxes (Vulpes vulpes). This raises several interesting ecological questions, including if and how sympatry affects the diet and gut microbiomes of coyotes and red foxes. We examined the gut microbiomes of sympatric populations of coyotes and red foxes within two different National Parks in Virginia, USA, that differ in land use, vegetation, and anthropogenic disturbance: Prince William Forest Park (PRWI) and Manassas National Battlefield Park (MANA). From 2012 to 2017, scat samples from PRWI and MANA were collected and analyzed. Polymerase chain reaction (PCR) amplification of a region of the mitochondrial cytochrome‐b gene followed by restriction enzyme digestion of the PCR product was used to determine the origin of each scat sample. Next‐Generation DNA sequencing of a hypervariable 16S rRNA gene region was used to determine gut microbiome information about the scat samples. There was no evidence for a difference between the gut microbiomes of red foxes in either location, or for a difference between the gut microbiomes of red foxes at either location and coyotes at the location with lower human disturbance, PRWI. However, the gut microbiomes of coyotes at the location with higher anthropogenic disturbances, MANA, revealed a marked change from those found in red foxes at either location and from those in coyotes at the location with lower disturbances. The gut microbiomes of coyotes subjected to greater human impact may provide evidence of dysbiosis, indicative of increased physiological stress and reduced health. We discuss our observations in the context of understanding anthropogenic impacts on coyote and red fox interactions. Our results suggest that physiological stress in the form of human disturbance may play an important role in the composition of the gut microbiome of coyotes, which can affect their overall health.

A comprehensive overview of the genetic diversity in Thylamys elegans (Didelphimorphia: Didelphidae): establishing the phylogeographic determinants

BackgroundFor the genus Thylamys, the rivers have been reported as barriers to dispersal, limiting current and historical distribution of its lineages. We hypothesized that the Maipo river has affected the genetic structure of northern and southern lineages of Thylamys elegans, recovering a phylogenetic relationships with reciprocally monophyletic sister groups on opposite river banks. We evaluated the role of other rivers in the Mediterranean zone of Chile as historical and recent modulators of the biogeographic processes of this species.MethodsWe applied a phylogeographic approach, using the cytochrome-b mitochondrial gene for 93 individuals of T. elegans, from 37 localities in a latitudinal gradient between 21°25’ and 35˚56’S, encompassing a geographic area between the Atacama Desert and most of the Mediterranean Chilean zone.ResultsThe phylogenetics results recovered six lineages within T. elegans: Thylamys elegans elegans, Thylamys elegans coquimbensis, the Loa lineage and three other lineages not described previously (Aconcagua, South 1 and South 2). We suggest that following rivers play a role like primary barrier: the Maipo river in the genetic differentiation of northern and southern ancestral lineages, and the Mataquito river and its tributary Teno river for the South 1 and South 2 lineages. On the other hand, the Quilimarí river preserve the genetic divergence in T. e. coquimbensis and Aconcagua lineage and the Aconcagua river in Aconcagua lineage and T. e. elegans acting like secondary barriers.ConclusionsWe concluded that the genetic diversity and biogeographic history of T. elegans was shaped by mountain glaciers, changes in river water levels during the Pleistocene glaciations and hyperaridity, promoting the differentiation and persistance of the T. elegans lineages.

Mitochondrial DNA indicate paraphyletic relationships and resolve disjunct distributions in the Neotoma mexicana species group

Woodrats (genus Neotoma) comprise 24 species found primarily in the US and Mexico. The Neotoma mexicana species group reaches its southernmost distribution in the highlands of southern Mexico and Central America. Previous research suggested that N. mexicana has a disjunct distribution, and it, N. ferruginea and N. picta have allopatric distributions and limit each other around the lowlands of the Isthmus of Tehuantepec. However, these hypotheses were suggested with incomplete subspecific sampling near the isthmus. We used new samples of N. m. parvidens from the Oaxacan Sierra Madre del Sur and N. m. tropicalis from the Sierra Norte de Oaxaca to assess their taxonomic affinity. With new sequences of the mitochondrial cytochrome-b gene, we found that both subspecies belong to N. ferruginea, not N. mexicana. We therefore suggest that N. mexicana is continuously distributed from the US to the Transmexican Volcanic Belt, N. picta inhabits the Guerreran Sierra Madre del Sur, and N. ferruginea ranges from the Oaxacan Sierra Madre del Sur to Central America. Our findings indicate that the Isthmus of Tehuantepec did not promote speciation in these woodrats, but we did detect intraspecific genetic differentiation between samples of N. ferruginea from east and west of the isthmus.

Molecular Studies of Some Herpetofauna of Sudan

This study aimed to survey and identifies some species of reptiles from various regions in the Sudan using molecular information. Genomic DNA was extracted from the tail tips and amplified by polymerase chain reaction (PCR) using primers for cytochrome-b mitochondrial gene. PCR products were sequenced and the resulting cytochrome-b gene sequences were aligned with homologous sequences obtained from the GenBank database. Phylogenetic trees were constructed to set up relationships of the gecko and lizard species. The phylogenetic relationships were compared to relevant species recorded from different world locations.

First record of the Northern Ecuadorian Shrew, Cryptotis niausa Moreno Cárdenas & Albuja, 2014 (Eulipotyphla, Soricidae), in Colombia

In Colombia, seven species of small-eared shrews of the genus Cryptotis Pomel, 1848 have been reported, and five of them endemic to the country. Here, we present the first confirmed record from Colombia of Cryptotis niausa Moreno Cárdenas & Albuja, 2014, a species that was previously known from only nine localities in Ecuador. The Colombian record comes from the Departamento de Nariño, in extreme southwestern Colombia, and it is supported by morphology and cytochrome-b gene evidence. This record increases to eight the number of species of Cryptotis from Colombia.

A preliminary review of Nephelomys albigularis (Tomes, 1860) (Rodentia: Cricetidae), with the description of a new species from the Peruvian montane forests.

Nephelomys albigularis is a sigmodontine rodent of the tribe Oryzomyini distributed in the Andean forests from central Ecuador to central Peru. Although several studies recognize this species as monotypic, significant morphological variation has been reported in Peruvian populations that were not properly assessed by direct comparisons with the type series from central Ecuador. We present a preliminary review of N. albigularis with an integrative approach and emphasis on Peruvian populations. We analyzed specimens using morphological and morphometric methods, complemented with phylogenetic analyses and species delimitation using sequence data from the cytochrome-b gene. Our results reveal that N. albigularis (sensu lato) comprises two taxa: N. albigularis s.s., from the montane forests in central and southern Ecuador and northwestern Peru, and Nephelomys sp. nov. from montane forest east of the Maran River. These taxa are morphologically distinct and are separated by a genetic distance of 5.90 1.01%. Nephelomys sp. nov. differs from N. albigularis s.s. by longer rump hairs, narrow hypothenar pads, faintly bicolor tail; absent interorbital ridges, low zygomatic plates, smoothly squared posterior margin of the hard palate or with a small median postpalatal process, smoothly edged ventral margin of the external auditory meatus, and slightly angular mandibular sigmoid notches. In this work, we present a diagnosis and description of the new species of Nephelomys and discuss the role of the Maran River as a potential driver for speciation in the genus Nephelomys.

Rejection of the monotypic status of Peromyscus furvus (Rodentia: Cricetidae), with consequences for its species group

Previous studies using Cytochrome-b or ND3-ND4 mitochondrial gene have yielded intriguing evidence about the phylogenetic relationships among populations of Peromyscus furvus; however, those studies each based on phylogenies for a single type of genes, yielded conflicting topologies. In addition, analyses with traditional morphometrics have revealed differences in skull size among certain populations of the species. Therefore, in order to reassess the systematic and taxonomic status of P. furvus, we incorporated a suite of genetic and morphometric characters and employed cladistic analyses. Herein, we present results mostly derived from our genetic analyses (results from the phylogenetic examination of skull size and shape will appear later). Phylogenetic analyses were conducted using four mitochondrial genes (Cytb and ND3-ND4L-ND4) with the respective data analyzed separately or combined, followed by an analysis with genetic and morphometric data (size and shape characters). Most phylogenetic constructions were made with parsimonious methods, but probabilistic methods also were used in the analyses with the genes separated by type. Similar topologies were recovered from all analyses of the Cytb gene and from all parsimony analyses of the NADH genes; however, conflicting topologies were obtained with the probabilistic methods for the NADH genes. Additionally, to better understand the genetic variation in each type of gene, analyses for genetic divergence were conducted within and among genetic groups and haplotype networks were constructed. All the topologies obtained using genetic data questioned the monotypic status of P. furvus, as two additional clades were identified that seemingly correspond to unrecognized entities. The first of these, P. latirostris, occurs in the northern region and could be considered as either a species or subspecies. An unknown Peromyscus species nova that occurs to the south is considered as a valid species. Further, P. furvus s. s. becomes a polytypic species by recognizing at least two subspecies (P. f. angustirostris and P. f. furvus). Phylogenetic analyses also rejected membership of P. melanocarpus and P. ochraventer within the furvus species group. Instead, P. melanocarpus showed a greater affinity to P. mexicanus totontepecus, whereas, P. ochraventer either joined to the clade containing P. melanocarpus and P. m. tototepecus or to Megadontomys cryophilus in a sister clade. Finally, Osgoodomys banderanus (subgenus Haplomylomys) always remained basally positioned and segregated from all members of the subgenus Peromyscus.

An overview of the mammals of the Gila region, New Mexico

A study of the mammals of the Gila region of New Mexico was conducted from 2012 through 2020, with 2,919 voucher specimens collected through fieldwork and collaborations with commercial trappers, in addition to data from camera traps, review of major holdings at 46 museums (n = 12,505 georeferenced specimens), and literature review. Specimens cover a 170-year span, dating back to 1850 and were unevenly distributed spatially and temporally across the Gila region. Most areas were very poorly represented and when summed across all mammal species, ranged from 0.02 to 3.7 specimens per km2. The survey documented 108 species (104 now extant) for the region. High species richness, greater than that reported for 38 states in the United States, is likely due to the juxtaposition of multiple biomes in the Gila, including the Sonoran, Chihuahuan, and Great Basin deserts, the Rocky Mountains and Sierra Madre Occidental, and nearby “sky islands’’ of the Southwest. Two species, Leptonycteris yerbabuenae and Zapus luteus, are documented for the first time from the study area. Expansions of the known range of these species, and Sciurus arizonensis are described from specimen and camera data. Preliminary phylogeographic studies of four species (Notiosorex crawfordi, Neotoma albigula, Perognathus flavus, and Thomomys bottae) using the mitochondrial cytochrome-b gene reveal the dynamic biogeographic history of the region and reinforce how landscape complexity and climate change have jointly contributed to diversification and thus high mammalian diversity in the region.

Evidence of differential genetic introgression at multiple localities between Neotoma floridana and N. micropus

To determine the extent of genetic introgression along the parapatric border between Neotoma floridana and N. micropus, 140 woodrats were sampled from 21 localities in Kansas, Oklahoma, and Texas, at varying distances from the proposed species boundaries. All individuals were examined at the mitochondrial cytochrome-b gene (Cytb) and two nuclear introns: intron seven of the Beta fibrinogen gene (Fgb-I7) and intron 2 of the vertebrate alcohol dehydrogenase gene (Adh1-I2). Additionally, individuals from a putative contact zone were genotyped using six microsatellite loci to better analyze population structure. Evidence of mixed ancestry was detected in 55 of 140 (39 %) individuals, at 10 of 21 (48 %) localities up to ~150 km from the proposed parapatric boundary. A pattern of differential admixture detected between the two nuclear markers suggested variation in selection pressures at the Adh1-I2 and Fgb-I7 markers is dependent upon the genomic makeup of the individual. Together, the mitochondrial and nuclear markers indicate evidence of historical hybridization and suggest that hybrid zones within this system are transient in nature.

A re-examination of the molecular systematics and phylogeography of taxa of the Peromyscus aztecus species group, with comments on the distribution of P. winkelmanni

The objectives of this study are to examine the available molecular data from the mitochondrial cytochrome-b gene (Cytb) and a concatenated dataset with this gene and two nuclear introns (Adh-1-I2 and Fgb-I7) to reexamine the systematic and phylogeographic conclusions reached by Sullivan et al. (1997) concerning the Peromyscus aztecus species group. The divergence of samples of P. aztecus oaxacensis across the Isthmus of Tehuantepec are further examined and taxonomic revisions are suggested. In addition, this study reviews the sources of data that lead to the conclusion that P. winkelmanni occurred in the Sierra Madre del Sur in Guerrero including a morphometric examination of a reported voucher. Bayesian and maximum likelihood analyses were conducted on a dataset of 31 Cytb sequences of all taxa in the P. aztecus group except for P. a. cordillerae and a concatenated dataset including five individuals of this group. Representative taxa of the P. boylii, P. mexicanus, and P. truei groups were included in both analyses. Body and cranial measurements of the voucher of the P. winkelmanni from Guerrero from which a Cytb sequence is reported to have been obtained was compared with measurements from specimens taken from the vicinity of Dos Aguas, Michoacán, including the type locality. We identified seven instances involving problematic identifications in GenBank. Once these issues were addressed, well-supported monophyletic sister clades of the P. aztecus and P. boylii species groups were recovered from phylogenetic analyses of Cytb sequences (Fig 1). Phylogenetic analyses of the Cytb and the concatenated datasets recover similar topologies that support the relationships of taxa of the aztecus group proposed by an earlier molecular study. Populations of P. a. oaxacensis southeast of the Isthmus of Tehuantepec represent a distinct species. Measurements of the voucher from Guerrero identified as the source of a P. winkelmanni Cytb sequence are smaller than P. winkelmanni for several characters. The divergent populations of P. a. oaxacensis from southeast of the Isthmus of Tehuantepec are recognized as two subspecies of P. cordillerae, P. c. cordillerae and P. c. hondurensis, whereas those northwest of the Isthmus are retained as P. a. oaxacensis. The lack of genetic divergence observed between P. a. evides and P. a. oaxacensis questions whether these two taxa should continue to be recognized as separate subspecies. Northern and southern populations of P. spicilegus demonstrate moderate divergence and additional examination of morphological and molecular differentiation within this taxon is warranted. The distribution of P. winkelmanni should be restricted to the vicinity of Dos Aguas, Michoacán, due to the lack of a voucher specimen that would confirm its reported occurrence in Guerrero.

Use of genetic similarity analysis for identification and study of the origin of Indonesian local goats based on X-Y sex chromosome karyotyping and cytochrome-b genes sequence

The history and origins of Indonesian local goats are still compiled and described based on information on phenotypic characters, and there is still limited research that studies the origin of goats based on cellular and molecular analysis. The purpose of this study was to identify the origin of local goats in Indonesia based on the emergence of the profile of the sex chromosome band and the results of the Cytochrome b (Cyt-b) gene sequence. The research method is a case study with analysis of sex chromosome band profile results of preparation with G-banding and Cyt-B gene sequences. Genetic similarity analysis was performed using mitochondrial DNA (mtDNA). The sample used was whole blood from six Senduro goats, three male Etawah Grade and three Etawah goats. Chromosome preparation was done by G-Staining and analyzed by cytovision then analyzed its similarity with ancestor breeds. The whole blood sample was isolated with the Blood DNA Preparation Kit by Jena Bioscience. The primers used are Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 and Reverse (Cytb_R) 5’GGATTTGCC GGGGTATAGTT ’3. The PCR results were sequenced by the Sanger method. Gene sequence analysis is performed using MEGA-X software. The results showed that the genetic distance between intraspesies and interspesies of Senduro goats and PE goats was 0% or ⩽ 2%. Conclusions based on genetic similarity from this study are Senduro goats and Etawah Peranakan goats, and Etawah has a close kinship, instead there is a distant kinship with the comparison of Capra Hircus, but it has a close kinship between individuals.

Halal Food Safety: PCR Based Detection of Porcine DNA in Imported Chocolate

Halal food and food products consumption is a major part of living in Muslim community. Pork meat or meat items are not considered halal in Muslim countries and consumers. Ensuring pork-free food items is a challenge for the food industry and exporters to Muslim nations. This study aims to detect porcine DNA in imported chocolate products in Bangladesh for halal safety assurance. The imported chocolate samples were collected from various multi shops in Dhaka. Polymerase chain reaction (PCR) method is used in our research to detect the porcine DNA. Two primer sets are used for the detection of porcine mitochondrial cyt-b (cytochrome-b) gene fragments in chocolate samples. To visualize the amplified DNA, agarose gel (1%) was used. After electrophoresis, DNA band in agarose gel indicated that the gene fragments are amplified properly. In our research, out of 42 chocolate samples, only 2 samples were found positive. The chocolate samples were branded as Wild Berry Flavor Chocolate and Cadbury Milk Tray Chocolate. In comparison with the positive pork sample, these two samples also containing the 165bp and 359bp fragment of the porcine cytochrome b gene. We reported that chocolate products contain the pork contamination were not labeled as halal. While other samples that did not have any halal logo originated from outside Bangladesh and imported also showed negative result. The present study established the DNA-based porcine detection system based on mitochondrial cyt-b that is viable in highly processed products. It can be used in the halal certification process to determine the pork items presence in food and halal safety. Our research also reported that imported chocolates should halal certify before release into the market.

Taxonomic revision of the populations assigned to Octodon degus (Hystricomorpha: Octodontidae): With the designation of a neotype for Sciurus degus G. I. Molina, 1782 and the description of a new subspecies

The caviomorph Octodon degus is likely the most studied Chilean mammal species. Several studies have centered in its natural history, ecology, behavior, and physiology; in addition, the species is used as model organism in biomedicine and neurobiology research. However, basic aspects such as its genetic and morphological variation throughout its distribution have not been adequately assessed. In fact, the last taxonomic study focused on populations of O. degus dates to the first half of the last century. Here we integrate morphologic (137 specimens from 23 localities) and genetic (cytochrome-b gene sequences of 47 individuals from 17 localities) evidence to assess the level and pattern of geographic variation along the whole species distribution. We found that specimens of O. degus present one of two morphotypes that are quali and quatitative differentiable. A gracile morphotype is found towards the north and a robust morphotype towards the south. Skull size variation correlates with precipitation, temperature and primary productivity. In addition, genealogical analysis uncovered two mains clades, one of them formed by haplotypes from specimens from the north and the other formed by haplotypes from specimens from the south of the distribution. We consider these differences warrant recognition at the subspecies level. As such, after assigning a neotype for Sciurus degus (= O. degus) that attaches this name to the southern morph, we described and named a new subspecies for the northern populations of O. degus.

The taxonomic status of Myotis nesopolus larensis (Chiroptera, Vespertilionidae) and new insights on the diversity of Caribbean Myotis.

Myotisnesopolus currently comprises two subspecies. The nominate subspecies (M.n.nesopolus) occurs on the Caribbean islands of Curaçao and Bonaire, Netherlands Antilles, whereas M.n.larensis is known from mainland South America in northeastern Colombia and northwestern Venezuela. Our Maximum Likelihood phylogenetic analyses of cytochrome-b gene sequences recovered M.nesopolus as a paraphyletic group, with M.n.nesopolus and M.n.larensis as non-sister lineages. The haplotype network indicates that these two subspecies do not share any haplotypes and are in different evolutionary trajectories. Additionally, these two subspecies can be distinguished on the basis of qualitative and quantitative morphological traits. This pattern supports the recognition of M.nesopolus and M.larensis as full species. Our results also reveal that the assemblage of Caribbean Myotis do not form a monophyletic group. Caribbean species are phylogenetically close to mainland species from northern South America and Central America, suggesting that colonization of Caribbean islands happened multiple times.

Phylogeography of sika deer (Cervus nippon) inferred from mitochondrial cytochrome-b gene and microsatellite DNA.

The genetic diversity and phylogenetic relationships of sika deer of different subspecies are uncertain. In order to explore the phylogenetic relationship of different sika deer subspecies, this study used a wider sample collection to analyze mitochondrial sequences and nuclear microsatellites of sika deer. The full lengths of cytochrome-b gene of 134 sika deer were sequenced, and 16 haplotypes were obtained. Based on phylogenetic and haplotype networks analysis, the sika deer was not clustered according to subspecies but was divided into four lineages. Lineage I includes individuals from C.n.kopschi, C.n.sichuanicus, and C.n.hortulorum subspecies; Lineage II includes individuals from C.n.hortulorum subspecies; Lineage III includes individuals from C.n.centralis, C.n.yakushime, C.n.mageshimae, and C.n.keramae subspecies, namely southern Japanese population; Lineage IV includes individuals from C.n.centralis and C.n.yesoensis subspecies, namely northern Japanese population. The microsatellite analysis showed that the sika deer in China and Japan originated independently. The three subspecies of China have significant genetic differentiation, while the three subspecies of Japan have no significant differentiation. This study provides reference for the research of genetic diversity and phylogenetic relationship of sika deer, and also provides scientific data for the evaluation, protection, and utilization of sika deer resources.