Cyperus Difformis Research Articles

Ecology and Management of Sedges in Direct-seeded Rice: A Review

Sedges, resilient weeds from the Cyperaceae family, pose a significant threat to direct-seeded rice cultivation due to their perennial nature and robust propagules, which endure harsh conditions. Their emergence, growth and seed production during fallow periods contribute significantly to seed banks, making their management challenging compared to other weed types. Water levels in paddy fields dictate weed composition, favouring sedges and grasses under saturated conditions but shifting to grass weeds during cropping seasons, influenced by factors like soil conditions and rainfall. Managing sedges requires a multifaceted approach due to their perennial hydrophilic and pro-alkaline nature with extensive propagules. Sedges possessing strong root system with morphological similarities necessitate continuous weed control throughout the cropping season during the critical period ranging from 15 to 60 days after sowing for wet and dry direct-seeded rice. Effective weed management practices proved crucial for minimizing yield losses caused by infestation of Cyperus difformis, Fimbristylis miliacea and Schoenoplectus juncoides by many researchers. Various methods, including cultural practices like stale seedbeds, physical methods like summer tillage, biological approaches such as integrating poultry and chemical interventions like herbicide application, are utilized for sedge management in rice fields. Higher efficacy of ethoxysulfuron for management of majority of sedge weeds in rice has been reported by many workers. However, relying on a single strategy is insufficient to keep sedge populations below the threshold, necessitating a comprehensive and adaptable approach to weed control in rice cultivation.

Assessment of florpyrauxifen-benzyl in water-seeded rice systems as affected by application timing

Florpyrauxifen-benzyl (FPB) is a novel auxin mimic rice herbicide used to control selected grasses, sedges, and broadleaves. Field experiments were conducted in 2020–2022 to 1) characterize the effects of FPB on rice crop safety and weed control when applied alone or in a mixture, 2) determine the FPB application timing to optimize smallflower umbrella sedge (SMF) control, and 3) evaluate the effect of late season application on rice flower sterility. In the first study, FPB was applied alone at 15, 30, and 60 g ai ha−1 and in mixture with bispyribac-sodium, penoxsulam, and propanil. FPB applied alone at 30 g ha−1 at 4–5-leaf (LF) rice stage controlled more than 80% of watergrasses, ricefield bulrush, and SMF and more than 99% of all broadleaf weeds at 28 days after treatment (DAT). The mixture treatments of FPB plus bispyribac-sodium applied at maximum use rate had the greatest grass weed control whereas, FPB plus propanil at the maximum use rate provided the greatest sedge control. In the second study, FPB at 40 g ha−1 was applied at 1-LF, 10-, 15-, 20-, and 25-cm tall SMF, where treatments controlled 95%, 86%, 89%, 87%, and 85% of SMF at 42 DAT, respectively. In the third study, FPB at 40 and 80 g ha−1 rate was applied at rice panicle initiation (PI) and 50% flowering (FL) growth stages. While the weed control was more than 90% at 42 DAT for all applications, the FL stage application caused 26% and 35% rice panicle blanking at 40 and 80 g ha−1 rate, respectively. This research suggests, the window of FPB application should be from 2-LF rice to rice PI stage to ensure crop safety and highest weed control.

Germination Biology of Three Cyperaceae Weeds and Their Response to Pre- and Post-Emergence Herbicides in Paddy Fields

(1) Background: Cyperaceae weeds have become a major type of weed in local paddy fields in China. (2) Methods: We assessed the impact of environmental factors, including temperature, light, salinity, water stress and soil depth, on the germination and emergence of three dominant Cyperaceae weeds: Cyperus difformis L., C. iria L. and Fimbristylis littoralis Gaudich. Using the dish dipping method, the performances of the pre- and post-emergence herbicides commonly used in paddy fields on three Cyperaceae weeds were evaluated using the pot method. (3) Results: The seeds optimally germinated at 35 °C in constant conditions and 25 °C/40 °C in alternating conditions. The seeds of the three Cyperaceae weeds were sensitive to light and could not germinate under dark conditions. The germination rate of the three weeds decreased with the increase in the NaCl concentration and water potential; the three weeds could not germinate at a 320 mmol·L−1 NaCl concentration and −0.1 MPa water potential. When the pH levels were 4 to 9, the germination rates of the three weeds were all greater than 80%. The burial depths to inhibit 50% of the emergence of C. difformis, C. iria and F. littoralis were 0.27, 1.06 and 0.42 cm, respectively. The control efficacy of the pre-emergence herbicides of pretilachlor, butachlor and oxyfluorfen on the three weeds were all above 90% at the recommended dose in the field. Halosulfuron-methyl, florpyrauxifen-benzyl and bentazone could effectively control the three Cyperaceae weeds; their performances on the three weeds at the 3- to 4-leaf stage were all above 82%. (4) Conclusions: The three Cyperaceae weed seeds have a strong adaptability to temperature, water potential, salinity and soil depth, and these weeds are sensitive to most pre- and post-emergence herbicides. Therefore, taking Cyperaceae weed seeds into the deep soil layer by tillage or selecting appropriate herbicides according to their growth stages can effectively control Cyperaceae weeds in rice fields.

Weed control and water‐seeded rice response to pyraclonil applied at different timings and in herbicide combinations

AbstractPyraclonil is a new herbicide to control weeds in California water‐seeded rice (Oryza sativa L.). The objectives of this research were to evaluate weed control and rice response from pyraclonil applied alone at different timings and when applied in combinations with other herbicides. In one field study, pyaclonil was applied at 0.3 lbs a.i. ac−1 on pre‐seed bare ground, 1‐inch flood, 4‐inch flood and 3 days after flooding in water‐seeded rice. In another study, pyraclonil was applied at 0.3 lbs a.i. ac−1 at day of rice seeding and followed by various registered herbicides. Pyraclonil applications resulted in similar weed control across timings. Pyraclonil provided greater than 92% control of smallflower umbrella sedge (Cyperus difformis L.) and broadleaf weeds but less than 60% control of ricefield bulrush [Schoenoplectus mucronatus (L.) Palla] at 42 days after treatment. Watergrass (Echinochloa spp.) control was achieved with pyraclonil if applied before emergence. Early‐season rice injury from pyraclonil was observed; however, rice appeared uninjured later in the season. The addition of other herbicides after a pyraclonil application increased weed control levels across weed species and resulted in grain yields from 6,925 to 8,623 and 9,182 to 10,865 lbs ac−1 in 2019 and 2021, respectively. Pyraclonil provides early‐season weed control and, when incorporated with other herbicides, will be a useful herbicide in water‐seeded rice.

Dynamics of weeds and main pests in different rice planting systems supplemented with biodecomposer

Biodecomposers are used as an alternative in pest and weed management by utilizing antagonistic microbes. This study aimed to identify the optimal treatment for suppressing weed growth and controlling the main rice pests, promoting environmentally friendly agricultural practices. Observations were made on three phases of rice growth on land that used biodecomposer and did not use biodecomposer. Weed sampling used a quadrant, which represents each treatment. All weeds were analyzed for density and summed dominance ratio. Pests were observed from the sweep net method. Pests were analyzed with the Shannon-Wiener diversity index (H’). Ten species of weeds are found; the most common and dominant was Cyperus difformis, while the least were Ipomoea aquatica and Ludwigia octovalvis. There were seven pest species; the most common was Nephothettix virescens, while the least was Valanga nigricornis. Using bio-decomposers combined with a two-row planting system was effective in suppressing the development of weeds and pests with a decreasing trend as the rice growing phase increases. Biodecomposers are environmentally friendly even though the process is slow, and have the potential to reduce weeds and pests.Keywords: biodecomposers, Jarwo 2:1, Tegel, trichoderma

An Ecological Weed Control Strategy in Paddy Fields: Light Interception from Duckweed Mulching

Rice–duckweed coculturing as an advanced technique has proven effective for weed control. However, the complex environmental interactions underlying its effectiveness remain unclear. In this study, a controlled pot experiment was conducted to isolate the shading effect of duckweeds (Landoltia punctata and Spirodela polyrhiza) from their intricate environmental interactions with paddy weeds (Cyperus difformis, Eclipta prostrata, and Ammannia auriculata). The results revealed that as the duckweeds grew, there were notable decreases in total weed density (52.41–77.01%) and biomass (42.33–99.23%) while rice biomass remained unaffected. Duckweed covering allowed less than 8.64% of light to pass through and led to decreases in environmental temperature, pH, and dissolved oxygen concentration in the floodwater, but had little impact on inorganic nitrogen levels. Through screening with random forest analysis and structural equation modelling, it was found that weed density and biomass were predominantly influenced by the reduced light transmittance (54.1% and 77.2%, p ≤ 0.001) resulting from duckweed covering while the decline in dissolved oxygen content partly influenced weed density (18%). In conclusion, this study’s results bring a different perspective, confirming the sunlight-shading effect of duckweed as a critical mechanism significantly inhibiting the germination and growth of weeds. These findings provide a scientific basis for the improved application of ecological weed control methods in paddy fields.

Effect of planting geometry and weed-management practices on yield of scented rice (Oryza sativa) varieties

A field experiment was conducted at the Shaheed Gundadhur College of Agriculture and Research Station, of the Indira Gandhi Krishi Vishwavidhyalaya, Jagdalpur, Chhattisgarh during rainy season (Kharif) of 2019, to evaluate the effect of planting geometry and weed-management practices in transplanted scented rice varieties. Treatments consisting combination of 2 varieties, 2 planting geometry and 4 weed management practices were replicated thrice in a split-split plot design. The dominant weeds in transplanted rice were: Ludwigia peploides (Kunth) P.H. Raven., Spilanthes acmella (L.) C.B. Clarke ex Hook. f., Echinochloa colona L., Cyperus difformis L., Cyperus iria L., Commelina benghalensis L. and Fimbristylis miliacea (L.) Vahl. Significantly lowest population of different weed species, and the highest grain and straw yields, and harvest index were found with variety, ‘Tarunbhog Selection 1’ while the maximum test weight was observed with ‘Dubraj Selection 1’. The planting geometry of 20 cm × 20 cm recorded the minimum weed population and the highest yield and benefit cost ratio. Application of pyrazosulfuron ethyl 10% WP @ 20 g/ha at 3 Days after transplanting (DAT) + 1 hand weeding (HW) at 25 DAT was found the most effective for broad-spectrum weed control and increased the rice grain yield. The highest net returns and benefit cost were recorded with the pre-emergence application of pyrazosulfuron ethyl 10 % WP @ 20 g/ha.

Emergence timing of smallflower umbrella sedge (Cyperus difformis), barnyardgrass (Echinochloa crus-galli), and bearded sprangletop (Leptochloa fusca spp. fascicularis) in California water-seeded rice

Abstract Late-season weed emergence in California rice fields complicates decisions concerning the timing of control measures. The objective of this study was to predict the emergence of three problematic weed species in rice using thermal time models. Smallflower umbrella sedge, barnyardgrass, and bearded sprangletop seedlings were counted and removed daily at three locations across the Sacramento Valley rice-growing region in 2018. The accumulation of thermal time (growing degree days; GDD) commenced with the initial flooding of the fields at each location, utilizing the specific base temperatures corresponding to each species. The pattern of emergence as a function of GDD was modeled with a Weibull function. Root-mean-square values for comparing actual and model-predicted cumulative emergence values were 6% to 23%. Percent cumulative emergence initially increased rapidly for smallflower umbrella sedge and reached 90% emergence with accumulation of 13 GDD. Barnyardgrass emerged after smallflower umbrella sedge and reached 90% emergence with an accumulation of 124 GDD. Bearded sprangletop had a delay of 64 GDD compared to barnyardgrass to reach first emergence and reached 90% emergence at 215 GDD. The period of weed emergence at all field sites differed across the three species and led to a continuous spectrum of weed emergence over time. This study characterizes the emergence of three economically important rice weeds and provides useful information for the timing of weed management. Typical herbicide applications on the day of seeding may have less efficacy on the late-emerging weeds, causing reduced weed control. Delayed herbicide application, overlay of residual herbicides, or use of herbicides with longer residual activity are suggested to control late-emerging weeds.

Integrated Control of Echinochloa oryzoides, Echinochloa crus-galli and Cyperus difformis Based on Pre-Sowing Herbicide and Some Herbicide Combinations in Rice

Cosmopolitan weeds are even constant elements where rice cultivation started just a century ago. There are few but important weed species with high adaptation in rice, which requires monoculture production systems and aquatic environment. Rotation difficulty resulted in the proliferation of highly competitive weed species strongly adapted to the aquatic environment. Constant use of herbicides with the same mechanisms of action leads to an evaluation of herbicide-resistant weed population and an increased number of herbicide-resistant populations in Türkiye. Chemical weed control and alternative integrated weed management strategies in rice production systems have significantly evolved throughout the years as well as rice herbicide traits and weed spectrum. The study was carried out in rice fields with resistance problems in two different locations, in the Black Sea and the Marmara Regions. The clamozone 480 EC, oxadiazon 200 CS, glyphosate potassium 441 g/l, glyphosate IPA 360 g/lt +carfentrazone-ethyl 5 g/l, cyhalofop-butyl 200 EC, penoxsulam 25.2 OD +bentazon-sodium 480 SL active ingredients and combinations’ efficacy were investigated on ALS and ACCase inhibitor herbicides resistant Cyperus difformis, Echinochloa oryzoides and Echinochloa crus-galli populations. At the end of the study, it was determined that including pre-sowing herbicides such as clomazone and oxadiazon in the weed control program would help control the ALS and ACCase-resistant this species. Implementing integrated weed management strategies for managing existing herbicide-resistant weeds and reducing future development of herbicide resistance is one of our most influential and economical long-term strategies.

Target and nontarget mechanisms of AHAS inhibitor cross-resistance patterns in Cyperus difformis

Weed resistance to acetohydroxyacid synthase (AHAS) inhibiting herbicides has been a critical issue for rice growers worldwide since the early 1990's. In California, resistance to bensulfuron-methyl was first detected in Cyperus difformis in 1993. Since then, populations of most major weeds of rice in California have been reported to show resistance to at least one AHAS inhibitor. We sought to describe the magnitude and mechanisms of AHAS inhibitor cross-resistance in California populations of C. difformis. Sixty-two populations were collected and screened for cross-resistance to bensulfuron-methyl (BEN), halosulfuron-methyl (HAL), bispyribac‑sodium (BIS), and penoxsulam (PEN), revealing six major patterns of cross-resistance. Representative C. difformis populations from each cross-resistance pattern were then subjected to dose-response, cytochrome P450 inhibition, AHAS gene sequencing, and metabolic studies with the same herbicides as in the screening. Dose-response confirmed the detected resistances in the representative populations, and suggested that the majority of observed resistance was dose-dependent. Cytochrome P450 inhibition via malathion revealed evidence of increased metabolic activity in resistant populations to BEN, BIS, and PEN. AHAS gene sequencing revealed amino acid substitutions in five of six populations: R3 (Pro197-Ser), R4 (Pro97-His), R10 (Asp376), R41 (Ala122-Asn), and R18 (Trp574-Leu). Metabolic studies confirmed evidence of increased activity of cytochrome P450s in all populations. Metabolic BEN and HAL analysis did not yield similar results to malathion inhibition, suggesting different P450's or other pathways. Taken together, the results of the studies confirm the complexity of AHAS inhibitor cross-resistance in C. difformis, and the presence of both target-site and metabolic resistance in most of the representative populations underscores the importance of proper herbicide selection, rotation, and scouting in fields.

Molecular Basis of Resistance to Bensulfuron-Methyl in a Smallflower Umbrella Sedge (Cyperus difformis L.) Population from China

Smallflower umbrella sedge (Cyperus difformis L.) is an invasive weed, and infestations of C. difformis are increasing in rice (Oryza sativa L.) fields in China. Bensulfuron-methyl is a widely used sulfonylurea herbicide that inhibits the acetolactate synthase (ALS) enzyme and has been used in recent years for effectively controlling annual weeds in the Cyperaceae family. In this study, a suspected resistant population of C. difformis (BBHY1) was collected from a rice field in Huaiyuan County, Anhui Province, China, that survived treatment with bensulfuron-methyl at the field-recommended rate (FRR). Single-dose tests and whole-plant bioassays confirmed that the BBHY1 population was resistant to bensulfuron-methyl and had evolved a high level of resistance, with a resistance index (RI) of 12.87. Sequencing of the ALS gene revealed a CCT to CAT point mutation at codon 197, which caused a P-to-H substitution in the resistant plants. Analysis of the relative expression of ALS revealed no significant differences between the resistant and susceptible populations. Inhibiting the activity of cytochrome P450s (P450s) or glutathione S-transferases (GSTs) had no significant effect on bensulfuron-methyl resistance. The BBHY1 population exhibited cross-resistance to pyrazosulfuron-ethyl, penoxsulam, and bispyribac-sodium, with RIs ranging from 5.48 to 20.63, but remained susceptible to MCPA sodium, florpyrauxifen-benzyl, and bentazon, with RIs of <1.00. These herbicides could be potentially used as alternatives for controlling resistant populations and managing herbicide resistance in other aggressive weeds in rice fields.

Effect of mutations on acetohydroxyacid synthase (AHAS) function in Cyperus difformis L.

Cyperus difformis L. is a troublesome weed in paddy fields and has attracted attention due to its resistance to acetohydroxyacid synthase (AHAS) inhibitors. It was found that the amino acid mutation in AHAS was the primary cause for the resistance of Cyperus difformis. However, the effect of different mutations on AHAS function is not clear in Cyperus difformis. To confirm the effect of mutations on AHAS function, six biotypes were collected, including Pro197Arg, Pro197Ser, Pro197Leu, Asp376Glu, Trp574Leu and wild type, from Hunan, Anhui, Jiangxi and Jiangsu provinces, China and the function of AHAS was characterized. The AHAS in vitro inhibition assay results indicated that the mutations decreased the sensitivity of AHAS to pyrazosulfuron-ethyl, in which the I50 (the half maximal inhibitory concentration) of wild type AHAS was 0.04 μmol L–1 and Asp376Glu, Pro197Leu, Pro197Arg, Pro197Ser and Trp574Leu mutations were 3.98, 11.50, 40.38, 38.19 and 311.43 μmol L–1, respectively. In the determination of enzyme kinetics parameters, the Km and the maximum reaction velocity (Vmax) of the wild type were 5.18 mmol L–1 and 0.12 nmol mg–1 min–1, respectively, and the Km values of AHAS with Asp376Glu, Trp574Leu, Pro197Leu and Pro197Ser mutations were 0.38–0.93 times of the wild type. The Km value of the Pro197Arg mutation was 1.14 times of the wild type, and the Vmax values of the five mutations were 1.17–3.33-fold compared to the wild type. It was found that the mutations increased the affinity of AHAS to the substrate, except for the Pro197Arg mutation. At a concentration of 0.0032–100 mmol L–1 branched-chain amino acids (BCAAs), the sensitivity of the other four mutant AHAS biotypes to feedback inhibition decreased, except for the Pro197Arg mutation. This study elucidated the effect of different mutations on AHAS function in Cyperus difformis and provided ideas for further study of resistance development.

Molecular detection of rice tungro bacilliform virus (RTBV) on weed host in South Sulawesi

Rice tungro bacilliform Virus (RTBV) is one of the viruses that cause tungro disease in rice plants causing leaf yellow and plant stunting. Some weed species have also been described as potential hosts for RTBV in addition to rice. However, RTBV cannot be diagnosed in weeds only by looking at their morphological symptoms because weeds infected with RTBV do not show typical symptoms. Hence this research was conducted to detect the presence of RTBV molecularly on several weed hosts in rice fields in South Sulawesi. The polymerase Chain Reaction technique with coat protein gene-specific primers was used to detect RTBV. A total of 29 leaf samples consisting of 12 weed species collected from Sidrap, Pinrang, Maros, and Gowa were then extracted genomic DNA from the leaf samples for PCR analysis. The results of PCR analysis showed that weed samples that tested positive for RTBV were Panicum repens (Lawawoi/Sidrap), Echinochloa crusgalli (Lawawoi/Sidrap), Cyperus difformis (Lanrang/Sidrap), Echinochloa crusgalli (Palangga/Gowa), Fimbristilys miliacea (Lanrang/Sidrap), and Eleusine indica (Lawawoi/Sidrap) which were indicated by the presence of RTBV virus DNA fragments with 430 bp in length in all these weeds. Weeds infected by RTBV formed 2 clusters. The first cluster consisted of RTBV in P.repens and E.crusgalli from Lawawoi/Sidrap, RTBV in C.difformis and F.miliacea from Lanrang/Sidrap, and RTBV in E.indica from Palangga/Gowa. At the same time, the second cluster consisted of RTBV in E.indica from Lawawoi/Sidrap.

Seed Size, Not Dispersal Syndrome, Determines Potential for Spread of Ricefield Weeds by Gulls.

Recent field data suggest that migratory gulls disperse many rice field weeds by gut passage (endozoochory), most of which are dry fruited and widely assumed to have no long-distance dispersal mechanisms, except via human activity. We investigated this mechanism with a feeding experiment, in which seeds of five common rice field weeds (in order of increasing seed size: Juncus bufonius, Cyperus difformis, Polypogon monspeliensis, Amaranthus retroflexus, and the fleshy-fruited Solanum nigrum) were fed to seven individuals of lesser black-backed gulls Larus fuscus held in captivity. We quantified seed survival after collecting faeces at intervals for 33 h after ingestion, then extracting intact seeds and running germination tests, which were also conducted for control seeds. All five species showed high seed survival after gut passage, of >70%. Gut retention times averaged 2-4 h, but maxima exceeded 23 h for all species. Germinability after gut passage was 16-54%, and gut passage accelerated germination in J. bufonius and S. nigrum, but slowed it down in the other species. All species had lower germinability after gut passage compared to control seeds (likely due to stratification prior to the experiment), but the loss of germinability was higher in smaller seeds. There was no evidence that the different dispersal syndromes assigned to the five species (endozoochory, epizoochory or barochory) had any influence on our results. In contrast, mean gut retention time was strongly and positively related to seed size, likely because small seeds pass more quickly from the gizzard into the intestines. Non-classical endozoochory of dry-fruited seeds by waterbirds is a major but overlooked mechanism for potential long-distance dispersal, and more research into this process is likely essential for effective weed management.

Double-spraying with different routes significantly improved control efficacies of herbicides applied by unmanned aerial spraying system: A case study with rice herbicides

An unmanned aerial spraying system (UASS) is one of the most important systems for herbicide applications. To date, no study has compared the control efficacies of herbicides applied by UASSs with different application strategies against weeds. We applied post-emergence (POST) herbicides using a six-rotor UASS on rice (Oryza sativa) fields with different spraying volumes (22.5, 30, 45, and 60 L ha−1) and different spraying route strategies (one-time spraying or two flight sorties routed in length and breadth). The spraying volume significantly affected (P < 0.05) control efficacies against Echinochloa spp., Leptochloa chinensis, Ammannia baccifera, Monochoria vaginalis, Cyperus difformis, and overall weeds. The spraying route strategy significantly affected control efficacies against Echinochloa spp., Leptochloa chinensis, Ammannia baccifera, and overall weeds. Treatment with the double-spraying strategy significantly increased the control efficacies against Echinochloa spp. and Leptochloa chinensis compared with one-time spraying. For weeds susceptible to herbicides applied, treatments with a spraying volume of 30 L ha−1 showed control efficacies >90%; for grassy weeds, UASS applications with double-spraying routed in length and breadth with a spraying volume of 60 L ha−1 did not show a significant difference with the manual spraying with a spraying volume of 450 L ha−1 in control efficacies. This study revealed different optimal spraying volumes for controlling different groups of rice weeds and demonstrated a new spraying strategy for UASS applications that can be used to improve herbicide application practices with UASSs.

Discovery of 3-(1-Amino-2-phenoxyethylidene)-6-methyl-2H-pyran-2,4(3H)-dione Derivatives as Novel Herbicidal Leads

Natural products are one of the resources for discovering novel pesticide leads. Here, by molecular hybridization between the natural enamino diketone skeleton and the reported herbicide lead compound I, a series of 3-(1-aminoethylidene)-6-methyl-2H-pyran-2,4(3H)-dione derivatives (APD) were rationally designed, synthesized and tested for herbicidal activity in a greenhouse. The bioassay results showed that most of the target compounds possessed good herbicidal activity under pre-emergence conditions, of which the analog APD-II-15 displayed good pre-emergent herbicidal activity against Abutilon theophrasti Medicus, Amaranthus retroflexus L., Echinochloa crus-galli, Eragrostis curvula (Schrad.) Nees, Avena fatua L., Cyperus difformis L., Chenopodium album L., Ixeris denticulata, Plantago asiatica L., Capsella bursa-pastoris (Linn.) Medic and Flaveria bidentis (L.) Kuntze with &gt; 60% inhibition even at a dosage of 187.5 g ha−1, and displayed good crop safety for wheat, soybean, millet and sorghum at a dosage of 375 g ha−1. The preliminary study of the molecular mode of action by RNA sequencing suggested that a growth inhibition of weeds by APD-II-15 might result from the disruptions of carbon metabolism and formation of a cytoskeleton. The present work indicated that APD-II-15 might be used as a novel herbicidal lead compound for further optimization.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

Management of bispyribac-sodium-resistant populations of small-flowered umbrella sedge (Cyperus difformis) using alternative herbicides

Management of bispyribac-sodium-resistant populations of small-flowered umbrella sedge (Cyperus difformis) using alternative herbicides

SYNTHESIS OF PLANT-MEDIATED SILVER NANOPARTICLES USING CYPERUS DIFFORMIS FLOWER EXTRACT AND EVALUATION OF ITS ANTIOXIDANT AND ANTICANCEROUS ACTIVITY

Environment-friendly synthesis of silver nanoparticles is done by using Cyperus difformis flower extract. The AgNPs were synthesized by using a simple and cost-effective method. The synthesised AgNPs were characterized by using FTIR, XRD, FE-SEM/EDS, HR-TEM, ICP-AES and TGA. The HR-TEM shows particle size in the range of 4.03965+215.32112 nm-54.42014+4.13582 nm. The particle size of AgNPs by using HR-TEM analysis have good agreement with XRD analysis. These AgNPs show remarkable results for Anticancerous activity and antioxidant activity. The Anticancerous activity of biosynthesized AgNPs suggests their possible application in the medical industry.

Assessment of ethnopharmacological potential of Cyperus difformis L. in terms of its’ phytochemistry, antibacterial, antioxidant and anticancer attributes

The present research was carried out on Cyperus difformis L., commonly found sedge weed in rice field to evaluate its’ ethnopharmacological potential in terms of phytochemical constituents, antibacterial, antioxidant and anticancer activities. FTIR spectroscopy of powdered material of plant parts, rhizome (with roots), leaves and flowers showed the presence of three main chemical groups, i.e. -OH (alcohol), -C=O (carbonyl) and -CO-O-CO (anhydride). The phytochemical composition of n-Hexane, chloroform and ethanol crude extracts of same parts analysed by GC-MS and n-Hexane extract of various parts indicated 14 compounds with highest (10) in flowers extract followed by six compounds in chloroform and five in ethanol extracts of plant parts. The antibacterial activity was assessed against Salmonella enterica, E. coli and Staphylococcus aureus by using well diffusion method and similar resistance was shown by n-Hexane and ethanol extracts while noticeable inhibition by chloroform extract, especially by leaves showing zone of inhibition, 16.17±0.52mm, comparable with Gentamycin 18±0.11mm. The antioxidant activity in terms of DPPH Scavenging activity was found higher in n-Hexane and chloroform extracts, especially leaves i.e., 54.6±0.43 &amp; 43.45±0.53 as compared to that of ethanol extracts. The percentage activity was increased with an increase of concentration of extracts. Antiproliferative activity checked by SRB proliferative assay and the crude extracts of plant parts of C. difformis showed good activity against A2780 and HCT116 cancer cells in three days. C. difformis having therapeutic action as well as its’ ethnopharmacological history, being used as fodder, it may be recommended good herbal fodder for the dairy animals.