cAMP Receptor Research Articles

The ABC transporter, AbcB3, mediates cAMP export in D. discoideum development

Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development.

Regulation of the ahpC gene encoding alkyl hydroperoxide reductase in Mycobacterium smegmatis.

The ahpC (MSMEG_4891) gene encodes alkyl hydroperoxide reductase C in Mycobacterium smegmatis mc2155 and its expression is induced under oxidative stress conditions. Two well-defined inverted repeat sequences (IR1 and IR2) were identified in the upstream region of ahpC. Using a crp (cAMP receptor protein: MSMEG_6189) mutant and in vitro DNA-binding assay, it was demonstrated that the IR1 sequence serves as a Crp-binding site and that Crp functions as an activator in the regulation of ahpC expression. The expression level of ahpC was shown to be proportional to intracellular cAMP levels. Intracellular levels of cAMP were increased in M. smegmatis, when it was treated with oxidative stress inducers. The IR2 sequence is very similar to the known consensus sequence of FurA-binding sites and involved in the negative regulation of ahpC expression. Taken together, these results suggest that the induction of ahpC expression under oxidative stress conditions probably results from a combinatory effect of both inactivation of FurA by oxidative stress and activation of Crp in response to increased levels of cAMP.

Progesterone Receptor Membrane Component 1 Is a Functional Part of the Glucagon-like Peptide-1 (GLP-1) Receptor Complex in Pancreatic β Cells

Glucagon-like peptide-1 (GLP-1) is an incretin hormone that regulates glucose homeostasis. Because of their direct stimulation of insulin secretion from pancreatic β cells, GLP-1 receptor (GLP-1R) agonists are now important therapeutic options for the treatment of type 2 diabetes. To better understand the mechanisms that control the insulinotropic actions of GLP-1, affinity purification and mass spectrometry (AP-MS) were employed to uncover potential proteins that functionally interact with the GLP-1R. AP-MS performed on Chinese hamster ovary cells or MIN6 β cells, both expressing the human GLP-1R, revealed 99 proteins potentially associated with the GLP-1R. Three novel GLP-1R interactors (PGRMC1, Rab5b, and Rab5c) were further validated through co-immunoprecipitation/immunoblotting, fluorescence resonance energy transfer, and immunofluorescence. Functional studies revealed that overexpression of PGRMC1, a novel cell surface receptor that associated with liganded GLP-1R, enhanced GLP-1-induced insulin secretion (GIIS) with the most robust effect. Knockdown of PGRMC1 in β cells decreased GIIS, indicative of positive interaction with GLP-1R. To gain insight mechanistically, we demonstrated that the cell surface PGRMC1 ligand P4-BSA increased GIIS, whereas its antagonist AG-205 decreased GIIS. It was then found that PGRMC1 increased GLP-1-induced cAMP accumulation. PGRMC1 activation and GIIS induced by P4-BSA could be blocked by inhibition of adenylyl cyclase/EPAC signaling or the EGF receptor-PI3K signal transduction pathway. These data reveal a dual mechanism for PGRMC1-increased GIIS mediated through cAMP and EGF receptor signaling. In conclusion, we identified several novel GLP-1R interacting proteins. PGRMC1 expressed on the cell surface of β cells was shown to interact with the activated GLP-1R to enhance the insulinotropic actions of GLP-1.

Elevated placental adenosine signaling contributes to the pathogenesis of preeclampsia

Purpose: Dephosphorylation of the myosin II regulatory light chain (MLC) promotes barrier integrity of cellular monolayers through relaxation of the actin cytoskeleton. This study has investigated the influence of adenosine (ADO) on MLC phosphorylation in cultured bovine corneal endothelial cells (BCEC).Methods: MLC phosphorylation was assessed by urea-glycerol gel electrophoresis and immunoblotting. Elevation of cAMP in response to agonists of A2b receptors (subtype of P1 purinergic receptors) was confirmed by phosphorylation of the cAMP response element binding protein (CREB), which was determined by Western blotting. Activation of MAP kinases (i.e. activated ERK1 and ERK2) was assessed by Western blotting to examine their influence on MLC phosphorylation. Transepithelial electrical resistance (TER) of cells grown on porous filters was measured to assess the altered barrier integrity.Results: Exposure to ADO (200 μm; 30 min) and N-ethyl (carboxamido) adenosine (NECA; 50 μm; 30 min), known agonists of A2b receptors, induced phosphorylation of CREB similar to forskolin (FSK, 20 μm; 30 min), a direct activator of adenylate cyclase. Exposure to ADO, NECA, and FSK led to dephosphorylation of MLC by 51, 40, and 47%, respectively. ADO-induced dephosphorylation was dose-dependent with as much as 31% dephosphorylation at 1 μm ADO. CGS-21680, a selective A2a agonist, neither induced MLC dephosphorylation nor CREB phosphorylation. ADO phosphorylated MAP kinases which could be prevented by exposure to the MAP kinase-specific inhibitor, U0126 (10 μM). NECA and FSK also induced ERK1 and ERK2 activation similar to ADO. Exposure to U0126 inhibited MLC phosphorylation under basal conditions by 17%. ADO-induced MLC dephosphorylation was enhanced by a simultaneous exposure to U0126 (25% increase in dephosphorylation). Exposure to ADO caused an increase in TER from 17 to 22 ohms cm2.Conclusions: (1) CREB phosphorylation in response to ADO and NECA, which indicates activation of the cAMP-PKA axis, suggests expression of A2b receptors in BCEC. (2) ERK1 and ERK2, activated by cAMP and A2b receptors, promote MLC phosphorylation. However, the net result of cAMP elevation is MLC dephosphorylation, presumably because the competing pathways involving inactivation of MLCK and/or ROCK are dominant (Rho-associated coiled coil-containing protein kinase or Rho kinase). (3) Consistent with MLC dephosphorylation, exposure to ADO increases TER, which suggests increased barrier integrity.

Three genes encoding citrate synthases in Saccharopolyspora erythraea are regulated by the global nutrient-sensing regulators GlnR, DasR, and CRP.

Saccharopolyspora erythraea has three citrate synthases encoded by gltA-2, citA, and citA4. Here, we characterized and identified the expression and regulatory properties of these synthases. Three pleiotropic global regulatory proteins of S. erythraea - CRP, GlnR, and DasR - are involved in carbon metabolism, nitrogen metabolism, and amino-sugar (chitin and GlcNAc) metabolism. Using electrophoretic mobility shift assays (EMSAs), we identified these regulators as proteins that bind directly to the promoter regions of all citrate synthase genes (gltA-2, citA, and citA4). Footprinting assays indicated the exact protect sequences of CRP, GlnR, and DasR on the promoter region of gltA-2, revealing binding competition between GlnR and DasR. Moreover, by comparing the transcription levels of citrate synthase genes between parental and glnR mutant or dasR mutant strains, or by comparing the transcription response of citrate synthases under various nutrient conditions, we found that GlnR and DasR negatively regulated citA and citA4 transcription but had no regulatory effects on the gltA-2 gene. Although no CRP mutant was available, the results indicated that CRP was a cAMP-binding receptor affecting gltA-2 transcription when the intracellular cAMP concentration increased. Thus, an overall model of CS regulation by C and/or N metabolism regulators and cAMP receptor protein was proposed.

Coregulation of host-adapted metabolism and virulence by pathogenic yersiniae.

Deciphering the principles how pathogenic bacteria adapt their metabolism to a specific host microenvironment is critical for understanding bacterial pathogenesis. The enteric pathogenic Yersinia species Yersinia pseudotuberculosis and Yersinia enterocolitica and the causative agent of plague, Yersinia pestis, are able to survive in a large variety of environmental reservoirs (e.g., soil, plants, insects) as well as warm-blooded animals (e.g., rodents, pigs, humans) with a particular preference for lymphatic tissues. In order to manage rapidly changing environmental conditions and interbacterial competition, Yersinia senses the nutritional composition during the course of an infection by special molecular devices, integrates this information and adapts its metabolism accordingly. In addition, nutrient availability has an impact on expression of virulence genes in response to C-sources, demonstrating a tight link between the pathogenicity of yersiniae and utilization of nutrients. Recent studies revealed that global regulatory factors such as the cAMP receptor protein (Crp) and the carbon storage regulator (Csr) system are part of a large network of transcriptional and posttranscriptional control strategies adjusting metabolic changes and virulence in response to temperature, ion and nutrient availability. Gained knowledge about the specific metabolic requirements and the correlation between metabolic and virulence gene expression that enable efficient host colonization led to the identification of new potential antimicrobial targets.

LdrP, a cAMP receptor protein/FNR family transcriptional regulator, serves as a positive regulator for the light-inducible gene cluster in the megaplasmid of Thermus thermophilus.

LdrP (TT_P0055) (LitR-dependent regulatory protein) is one of the four cAMP receptor protein (CRP)/FNR family transcriptional regulators retained by the extremely thermophilic bacterium Thermus thermophilus. Previously, we reported that LdrP served as a positive regulator for the light-induced transcription of crtB, a carotenoid biosynthesis gene encoded on the megaplasmid of this organism. Here, we showed that LdrP also functions as an activator of the expression of genes clustered around the crtB gene under the control of LitR, an adenosyl B12-bound light-sensitive regulator. Transcriptome analysis revealed the existence of 19 LitR-dependent genes on the megaplasmid. S1 nuclease protection assay confirmed that the promoters preceding TT_P0044 (P44), TT_P0049 (P49) and TT_P0070 (P70) were activated upon illumination in the WT strain. An ldrP mutant lost the ability to activate P44, P49 and P70, whilst disruption of litR resulted in constitutive transcription from these promoters irrespective of illumination, indicating that these genes were photo-dependently regulated by LdrP and LitR. An in vitro transcription experiment demonstrated that LdrP directly activated mRNA synthesis from P44 and P70 by the Thermus RNA polymerase holocomplex. The present evidence indicated that LdrP was the positive regulator essential for the transcription of the T. thermophilus light-inducible cluster encoded on the megaplasmid.

Cell substratum adhesion during early development of Dictyostelium discoideum.

Vegetative and developed amoebae of Dictyostelium discoideum gain traction and move rapidly on a wide range of substrata without forming focal adhesions. We used two independent assays to quantify cell-substrate adhesion in mutants and in wild-type cells as a function of development. Using a microfluidic device that generates a range of hydrodynamic shear stress, we found that substratum adhesion decreases at least 10 fold during the first 6 hr of development of wild type cells. This result was confirmed using a single-cell assay in which cells were attached to the cantilever of an atomic force probe and allowed to adhere to untreated glass surfaces before being retracted. Both of these assays showed that the decrease in substratum adhesion was dependent on the cAMP receptor CAR1 which triggers development. Vegetative cells missing talin as the result of a mutation in talA exhibited slightly reduced adhesive properties compared to vegetative wild-type cells. In sharp contrast to wild-type cells, however, these talA mutant cells did not show further reduction of adhesion during development such that after 5 hr of development they were significantly more adhesive than developed wild type cells. In addition, both assays showed that substrate adhesion was reduced in 0 hr cells when the actin cytoskeleton was disrupted by latrunculin. Consistent with previous observations, substrate adhesion was also reduced in 0 hr cells lacking the membrane proteins SadA or SibA as the result of mutations in sadA or sibA. However, there was no difference in the adhesion properties between wild type AX3 cells and these mutant cells after 6 hr of development, suggesting that neither SibA nor SadA play an essential role in substratum adhesion during aggregation. Our results provide a quantitative framework for further studies of cell substratum adhesion in Dictyostelium.

Functional characterization of Yersinia pestis aerobic glycerol metabolism

Yersinia pestis biovar Orientalis isolates have lost the capacity to ferment glycerol. Herein we provide experimental validation that a 93 bp in-frame deletion within the glpD gene encoding the glycerol-3-phosphate dehydrogenase present in all biovar Orientalis strains is sufficient to disrupt aerobic glycerol fermentation. Furthermore, the inability to ferment glycerol is often insured by a variety of additional mutations within the glpFKX operon which prevents glycerol internalization and conversion to glycerol-3-phosphate. The physiological impact of functional glpFKX in the presence of dysfunctional glpD was assessed. Results demonstrate no change in growth kinetics at 26 °C and 37 °C. Mutants deficient in glpD displayed decreased intracellular accumulation of glycerol-3-phosphate, a characterized inhibitor of cAMP receptor protein (CRP) activation. Since CRP is rigorously involved in global regulation Y. pestis virulence, we tested a possible influence of a single glpD mutation on virulence. Nonetheless, subcutaneous and intranasal murine challenge was not impacted by glycerol metabolism. As quantified by crystal violet assay, biofilm formation of the glpD-deficient KIM6+ mutant was mildly repressed; whereas, chromosomal restoration of glpD in CO92 resulted in a significant increase in biofilm formation.

Active Site Coupling in PDE:PKA Complexes Promotes Resetting of Mammalian cAMP Signaling

Cyclic 3′5′ adenosine monophosphate (cAMP)-dependent-protein kinase (PKA) signaling is a fundamental regulatory pathway for mediating cellular responses to hormonal stimuli. The pathway is activated by high-affinity association of cAMP with the regulatory subunit of PKA and signal termination is achieved upon cAMP dissociation from PKA. Although steps in the activation phase are well understood, little is known on how signal termination/resetting occurs. Due to the high affinity of cAMP to PKA (KD ∼ low nM), bound cAMP does not readily dissociate from PKA, thus begging the question of how tightly bound cAMP is released from PKA to reset its signaling state to respond to subsequent stimuli. It has been recently shown that phosphodiesterases (PDEs) can catalyze dissociation of bound cAMP and thereby play an active role in cAMP signal desensitization/termination. This is achieved through direct interactions with the regulatory subunit of PKA, thereby facilitating cAMP dissociation and hydrolysis. In this study, we have mapped direct interactions between a specific cyclic nucleotide phosphodiesterase (PDE8A) and a PKA regulatory subunit (RIα isoform) in mammalian cAMP signaling, by a combination of amide hydrogen/deuterium exchange mass spectrometry, peptide array, and computational docking. The interaction interface of the PDE8A:RIα complex, probed by peptide array and hydrogen/deuterium exchange mass spectrometry, brings together regions spanning the phosphodiesterase active site and cAMP-binding sites of RIα. Computational docking combined with amide hydrogen/deuterium exchange mass spectrometry provided a model for parallel dissociation of bound cAMP from the two tandem cAMP-binding domains of RIα. Active site coupling suggests a role for substrate channeling in the PDE-dependent dissociation and hydrolysis of cAMP bound to PKA. This is the first instance, to our knowledge, of PDEs directly interacting with a cAMP-receptor protein in a mammalian system, and highlights an entirely new class of binding partners for RIα. This study also highlights applications of structural mass spectrometry combined with computational docking for mapping dynamics in transient signaling protein complexes. Together, these results present a novel and critical role for phosphodiesterases in moderating local concentrations of cAMP in microdomains and signal resetting.

Metabolomic analysis reveals rewiring of Synechocystis sp. PCC 6803 primary metabolism by ntcA overexpression.

NtcA is a cAMP receptor protein-type transcription factor conserved among cyanobacteria and is essential for gene expression in response to nitrogen status. NtcA has been widely studied; however, no metabolomic analysis has been conducted using the ntcA mutant. Here, we generated a strain that overexpresses ntcA in Synechocystis sp. PCC 6803, named NOX10, and performed physiological, transcriptomic and metabolomic analyses. NOX10 grew faster than the wild-type strain under photoautotrophic conditions, but slower under light-activated heterotrophic conditions. Transcriptome analysis revealed that the expression of genes related to primary metabolism was altered by ntcA overexpression particularly under nitrogen-depleted conditions. Metabolomic analysis revealed that metabolite levels in sugar, purine/pyrimidine nucleotide, organic acid and amino acid metabolism were widely altered by ntcA overexpression. The protein levels of nitrogen-regulated transcriptional regulators were altered by ntcA overexpression during nitrogen starvation. These results demonstrate the alteration of primary metabolism by genetic engineering of NtcA, and they contribute to the current understanding of metabolic regulation of unicellular cyanobacteria.

Arrestins function in cAR1 GPCR-mediated signaling and cAR1 internalization in the development of Dictyostelium discoideum.

Oscillation of chemical signals is a common biological phenomenon, but its regulation is poorly understood. At the aggregation stage of Dictyostelium discoideum development, the chemoattractant cAMP is synthesized and released at 6-min intervals, directing cell migration. Although the G protein-coupled cAMP receptor cAR1 and ERK2 are both implicated in regulating the oscillation, the signaling circuit remains unknown. Here we report that D. discoideum arrestins regulate the frequency of cAMP oscillation and may link cAR1 signaling to oscillatory ERK2 activity. Cells lacking arrestins (adcB(-)C(-)) display cAMP oscillations during the aggregation stage that are twice as frequent as for wild- type cells. The adcB(-)C(-) cells also have a shorter period of transient ERK2 activity and precociously reactivate ERK2 in response to cAMP stimulation. We show that arrestin domain-containing protein C (AdcC) associates with ERK2 and that activation of cAR1 promotes the transient membrane recruitment of AdcC and interaction with cAR1, indicating that arrestins function in cAR1-controlled periodic ERK2 activation and oscillatory cAMP signaling in the aggregation stage of D. discoideum development. In addition, ligand-induced cAR1 internalization is compromised in adcB(-)C(-) cells, suggesting that arrestins are involved in elimination of high-affinity cAR1 receptors from cell surface after the aggregation stage of multicellular development.

Transposon-mediated directed mutation controlled by DNA binding proteins in Escherichia coli.

Transposon-mediated directed mutation controlled by DNA binding proteins in Escherichia coli.

A cAMP-independent carbohydrate-driven mechanism inhibits tnaA expression and TnaA enzyme activity in Escherichia coli.

When Escherichia coli is grown in a medium lacking glucose or another preferred carbohydrate, the concentration of cAMP-cAMP receptor protein (cAMP-CRP) increases, and this latter complex regulates the expression of more than 180 genes. To respond rapidly to changes in carbohydrate availability, E. coli must maintain a suitable intracellular concentration of cAMP by either exporting or degrading excess cAMP. Currently, cAMP export via the TolC protein is thought to be more efficient at reducing these levels than is CpdA-mediated degradation of cAMP. Here, we compared the contributions of TolC and CpdA by measuring the expression of cAMP-regulated genes that encode tryptophanase (TnaA) and β-galactosidase. In the presence of exogenous cAMP, a tolC mutant produced intermediate levels of these enzymes, suggesting that cAMP levels were held in check by CpdA. Conversely, a cpdA mutant produced much higher amounts of these enzymes, indicating that CpdA was more efficient than TolC at reducing cAMP levels. Surprisingly, expression of the tnaA gene halted rapidly when glucose was added to cells lacking both TolC and CpdA, even though under these conditions cAMP could not be removed by either pathway and tnaA expression should have remained high. This result suggests the existence of an additional mechanism that eliminates intracellular cAMP or terminates expression of some cAMP-CRP-regulated genes. In addition, adding glucose and other carbohydrates rapidly inhibited the function of pre-formed TnaA, indicating that TnaA is regulated by a previously unknown carbohydrate-dependent post-translational mechanism.

Spacing requirements for Class I transcription activation in bacteria are set by promoter elements.

The Escherichia coli cAMP receptor protein (CRP) activates transcription initiation at many promoters by binding upstream of core promoter elements and interacting with the C-terminal domain of the RNA polymerase α subunit. Previous studies have shown stringent spacing is required for transcription activation by CRP. Here we report that this stringency can be altered by the nature of different promoter elements at target promoters. Several series of CRP-dependent promoters were constructed with CRP moved to different upstream locations, and their activities were measured. The results show that (i) a full UP element, located immediately downstream of the DNA site for CRP, relaxes the spacing requirements for activation and increases the recruitment of RNAP and open complex formation; (ii) the distal UP subsite plays the key role in this relaxation; (iii) modification of the extended −10 element also affects the spacing requirements for CRP-dependent activation. From these results, we conclude that the spacing requirements for CRP-dependent transcription activation vary according to the sequence of different promoter elements, and our results are important for understanding the organization of promoters in many different bacteria which are controlled by transcription factors that use activatory mechanisms similar to CRP.

Engineering global regulator cAMP receptor protein (CRP) of E. coli for improved biobutanol tolerance

Engineering global regulator cAMP receptor protein (CRP) of E. coli for improved biobutanol tolerance

Genomic mapping of cAMP receptor protein (CRPMt) inMycobacterium tuberculosis: relation to transcriptional start sites and the role of CRPMtas a transcription factor

Chromatin immunoprecipitation identified 191 binding sites of Mycobacterium tuberculosis cAMP receptor protein (CRPMt) at endogenous expression levels using a specific α-CRPMt antibody. Under these native conditions an equal distribution between intragenic and intergenic locations was observed. CRPMt binding overlapped a palindromic consensus sequence. Analysis by RNA sequencing revealed widespread changes in transcriptional profile in a mutant strain lacking CRPMt during exponential growth, and in response to nutrient starvation. Differential expression of genes with a CRPMt-binding site represented only a minor portion of this transcriptional reprogramming with ∼19% of those representing transcriptional regulators potentially controlled by CRPMt. The subset of genes that are differentially expressed in the deletion mutant under both culture conditions conformed to a pattern resembling canonical CRP regulation in Escherichia coli, with binding close to the transcriptional start site associated with repression and upstream binding with activation. CRPMt can function as a classical transcription factor in M. tuberculosis, though this occurs at only a subset of CRPMt-binding sites.

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

Pyrimidine-based compounds modulate CXCR2-mediated signaling and receptor turnover.

Chemokine receptor CXCR2 is expressed on various immune cells and is essential for neutrophil recruitment and angiogenesis at sites of acute and chronic inflammation caused by tissue injury or infection. Because of its role in inflammation, it has been implicated in a number of immune-mediated inflammatory diseases such as psoriasis, arthritis, COPD, cystic fibrosis, asthma, and various types of cancer. CXCR2 and its ligands are up-regulated in cancer cells as well as the tumor microenvironment, promoting tumor growth, angiogenesis, and invasiveness. Although pharmaceutical companies have pursued the development of CXCR2-specific small-molecule inhibitors as anti-inflammatory agents within the last decades, there are currently no clinically approved CXCR2 inhibitors. Using a high-throughput, cell-based assay specific for CXCR2, we screened an in-house library of structurally diverse compounds and identified a class of pyrimidine-based compounds that alter CXCR2-mediated second messenger signaling. Our lead compound, CX797, inhibited IL8-mediated cAMP signaling and receptor degradation while specifically up-regulating IL8-mediated β-arrestin-2 recruitment. CX797 also inhibited IL8-mediated cell migration. Mechanistic comparison of CX797 and a previously reported CXCR2 inhibitor, SB265610, show these two classes of compounds have a distinct mechanism of action on CXCR2.

Involvement of cAMP-CRP in transcription activation and repression of the pck gene encoding PEP carboxykinase, the key enzyme of gluconeogenesis.

cAMP receptor protein (CRP) is the best characterized global regulator of Escherichia coli. After genomic SELEX screening, a total of minimum 378 promoters have been identified as its regulation targets on the E.coli genome. Among a number of promoters carrying two CRP-binding sites, several promoters carry two CRP-binding sites, one upstream but another downstream of transcription initiation sites. The regulatory role of downstream CRP site remains unsolved. Using the pck gene encoding phosphoenolpyruvate carboxykinase as a model promoter, we analyzed the role of CRP-associated downstream of the transcription initiation site. Gel shift assay and AFM observation indicate that CRP binds to both the promoter-distal site (CRP box-1) at -90.5 and the site (CRP box-2) at +13.5 downstream of transcription initiation site. The binding affinity is higher for CRP box-1. Roles of two CRP sites were examined using in vitro transcription assay and in vivo reporter assay. In both cases, transcription repression was observed in the presence of high concentrations of CRP. Taken together, we propose that cAMP-CRP associated at downstream CRP box-2 plays as a repressor for pck transcription only in the presence of high levels of cAMP-CRP.