Cyclic AMP Receptor Protein Binding Research Articles

Quantitative model for genome-wide cyclic AMP receptor protein binding site identification and characteristic analysis

Cyclic AMP receptor proteins (CRPs) are important transcription regulators in many species. The prediction of CRP-binding sites was mainly based on position-weighted matrixes (PWMs). Traditional prediction methods only considered known binding motifs, and their ability to discover inflexible binding patterns was limited. Thus, a novel CRP-binding site prediction model called CRPBSFinder was developed in this research, which combined the hidden Markov model, knowledge-based PWMs and structure-based binding affinity matrixes. We trained this model using validated CRP-binding data from Escherichia coli and evaluated it with computational and experimental methods. The result shows that the model not only can provide higher prediction performance than a classic method but also quantitatively indicates the binding affinity of transcription factor binding sites by prediction scores. The prediction result included not only the most knowns regulated genes but also 1089 novel CRP-regulated genes. The major regulatory roles of CRPs were divided into four classes: carbohydrate metabolism, organic acid metabolism, nitrogen compound metabolism and cellular transport. Several novel functions were also discovered, including heterocycle metabolic and response to stimulus. Based on the functional similarity of homologous CRPs, we applied the model to 35 other species. The prediction tool and the prediction results are online and are available at: https://awi.cuhk.edu.cn/∼CRPBSFinder.

CAMP Receptor Protein Controls Vibrio cholerae Gene Expression in Response to Host Colonization.

ABSTRACTThe bacterium Vibrio cholerae is native to aquatic environments and can switch lifestyles to cause disease in humans. Lifestyle switching requires modulation of genetic systems for quorum sensing, intestinal colonization, and toxin production. Much of this regulation occurs at the level of gene expression and is controlled by transcription factors. In this work, we have mapped the binding of cAMP receptor protein (CRP) and RNA polymerase across the V. cholerae genome. We show that CRP is an integral component of the regulatory network that controls lifestyle switching. Focusing on a locus necessary for toxin transport, we demonstrate CRP-dependent regulation of gene expression in response to host colonization. Examination of further CRP-targeted genes reveals that this behavior is commonplace. Hence, CRP is a key regulator of many V. cholerae genes in response to lifestyle changes.

Cholera Toxin Production Induced upon Anaerobic Respiration is Suppressed by Glucose Fermentation in Vibrio cholerae.

The causative agent of pandemic cholera, Vibrio cholerae, infects the anaerobic environment of the human intestine. Production of cholera toxin (CT), a major virulence factor of V. cholerae, is highly induced during anaerobic respiration with trimethylamine N-oxide (TMAO) as an alternative electron acceptor. However, the molecular mechanism of TMAO-stimulated CT production is not fully understood. Herein, we reveal that CT production during anaerobic TMAO respiration is affected by glucose fermentation. When the seventh pandemic V. cholerae O1 strain N16961 was grown with TMAO and additional glucose, CT production was markedly reduced. Furthermore, an N16961 Δcrp mutant, devoid of cyclic AMP receptor protein (CRP), was defective in CT production during growth by anaerobic TMAO respiration, further suggesting a role of glucose metabolism in regulating TMAO-mediated CT production. TMAO reductase activity was noticeably decreased when grown together with glucose or by mutation of the crp gene. A CRP binding region was identified in the promoter region of the torD gene, which encodes a structural subunit of the TMAO reductase. Gel shift assays further confirmed the binding of purified CRP to the torD promoter sequence. Together, our results suggest that the bacterial ability to respire using TMAO is controlled by CRP, whose activity is dependent on glucose availability. Our results reveal a novel mechanism for the regulation of major virulence factor production by V. cholerae under anaerobic growth conditions.

Paralogous cAMP receptor proteins in Mycobacterium smegmatis show biochemical and functional divergence.

The cyclic AMP receptor protein (CRP) family of transcription factors consists of global regulators of bacterial gene expression. Here, we identify two paralogous CRPs in the genome of Mycobacterium smegmatis that have 78% identical sequences and characterize them biochemically and functionally. The two proteins (MSMEG_0539 and MSMEG_6189) show differences in cAMP binding affinity, trypsin sensitivity, and binding to a CRP site that we have identified upstream of the msmeg_3781 gene. MSMEG_6189 binds to the CRP site readily in the absence of cAMP, while MSMEG_0539 binds in the presence of cAMP, albeit weakly. msmeg_6189 appears to be an essential gene, while the Δmsmeg_0539 strain was readily obtained. Using promoter-reporter constructs, we show that msmeg_3781 is regulated by CRP binding, and its transcription is repressed by MSMEG_6189. Our results are the first to characterize two paralogous and functional CRPs in a single bacterial genome. This gene duplication event has subsequently led to the evolution of two proteins whose biochemical differences translate to differential gene regulation, thus catering to the specific needs of the organism.

Transposon-mediated directed mutation controlled by DNA binding proteins in Escherichia coli.

Transposon-mediated directed mutation controlled by DNA binding proteins in Escherichia coli.

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

A Novel Indirect Sequence Readout Component in the E. coli Cyclic AMP Receptor Protein Operator

The cyclic AMP receptor protein (CRP) from Escherichia coli has been extensively studied for several decades. In particular, a detailed characterization of CRP interaction with DNA has been obtained. The CRP dimer recognizes a consensus sequence AANTGTGANNNNNNTCACANTT through direct amino acid nucleobase interactions in the major groove of the two operator half-sites. Crystal structure analyses have revealed that the interaction results in two strong kinks at the TG/CA steps closest to the 6-base-pair spacer (N6). This spacer exhibits high sequence variability among the more than 100 natural binding sites in the E. coli genome, but the exact role of the N6 region in CRP interaction has not previously been systematic examined. Here we employ an in vitro selection system based on a randomized N6 spacer region to demonstrate that CRP binding to the lacP1 site may be enhanced up to 14-fold or abolished by varying the N6 spacer sequences. Furthermore, on the basis of sequence analysis and uranyl (UO2(2+)) probing data, we propose that the underlying mechanism relies on N6 deformability.

Plasticity of Regulation of Mannitol Phosphotransferase System Operon by CRP-cAMP Complex in Vibrio cholerae

ObjectiveThe complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. MethodsThe crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. ResultsIn this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. ConclusionThe five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism.

Cyclic AMP Receptor Protein Regulates cspE , an Early Cold-Inducible Gene, in Escherichia coli

cspE, a member of the cspA family of cold shock proteins in Escherichia coli, is an early cold-inducible protein. The nucleic acid melting ability and transcription antiterminator activity of CspE have been reported to be critical for growth at low temperature. Here, we show that the cyclic AMP receptor protein (CRP), a global regulator involved in sugar metabolism, upregulates cspE in E. coli. Sequence analysis of the cspE upstream region revealed a putative CRP target site centered at -61.5 relative to the transcription start. The binding of CRP to this target site was demonstrated using electrophoretic mobility shift assays. The presence of this site was shown to be essential for P(cspE) activation by CRP. Mutational analysis of the binding site indicated that the presence of an intact second core motif is more important than the first core motif for CRP-P(cspE) interaction. Based on the promoter architecture, we classified P(cspE) as a class I CRP-dependent promoter. This was further substantiated by our data demonstrating the involvement of the AR1 domain of CRP in P(cspE) transcription. Furthermore, the substitutions in the key residues of the RNA polymerase α-subunit C-terminal domain (α-CTD), which are important for class I CRP-dependent transcription, showed the involvement of 265 and 287 determinants in P(cspE) transcription. In addition, the deletion of crp led to a growth defect at low temperature, suggesting that CRP plays an important role in cold adaptation.

Enhanced expression of membrane proteins in E. coli with a PBAD promoter mutant: synergies with chaperone pathway engineering strategies

BackgroundMembrane proteins (MPs) populate 20-30% of genomes sequenced to date and hold potential as therapeutic targets as well as for practical applications in bionanotechnology. However, MP toxicity and low yields in normally robust expression hosts such as E. coli has curtailed progress in our understanding of their structure and function.ResultsUsing the seven transmembrane segments H. turkmenica deltarhodopsin (HtdR) as a reporter, we isolated a spontaneous mutant in the arabinose-inducible PBAD promoter leading to improved cell growth and a twofold increase in the recovery of active HtdR at 37°C. A single transversion in a conserved region of the cyclic AMP receptor protein binding site caused the phenotype by reducing htdR transcript levels by 65%. When the mutant promoter was used in conjunction with a host lacking the molecular chaperone Trigger Factor (Δtig cells), toxicity was further suppressed and the amount of correctly folded HtdR was 4-fold that present in the membranes of control cells. More importantly, while improved growth barely compensated for the reduction in transcription rates when another polytopic membrane protein (N. pharonis sensory rhodopsin II) was expressed under control of the mutant promoter in wild type cells, a 4-fold increase in productivity could be achieved in a Δtig host.ConclusionsOur system, which combines a downregulated version of the tightly repressed PBAD promoter with a TF-deficient host may prove a valuable alternative to T7-based expression for the production of membrane proteins that have so far remained elusive targets.

Two non-consensus Clp binding sites are involved in upregulation of the gum operon involved in xanthan polysaccharide synthesis in Xanthomonas campestris pv. campestris

Biosynthesis of xanthan polysaccharide, a virulence factor of phytopathogenic Xanthomonas campestris pv. campestris (Xcc), involves the gum operon and the cyclic AMP receptor protein (CRP) homologue Clp. Clp was shown to have the same DNA binding specificity as the CRP at positions 5, 6, and 7 (GTG motif) of the left arm. Therefore, Clp binding sites (CBSs) have typically been identified by pattern searching of the Xcc genome using the consensus CRP binding sequence. Here, results of a reporter assay and electrophoretic mobility shift assay suggest that Clp upregulates the gum operon by binding to two non-consensus sites, in which a more conserved right arm may compensate for the lack of conservation in the left arm, a high GC content in the central region (6 bp) may be important for binding, and binding may be enhanced if the GC-rich central region is palindromic. These suggest that atypical CBSs exist in Xcc promoters and that Clp, while retaining the capacity to bind typical CBSs, has evolved to bind atypical CBS because: 1) Clp shares only moderate homology with the CRP and is modulated by cyclic di-GMP; and 2) Xcc has a higher GC content (65%) than Escherichia coli (50%).

The AraC/XylS Family Activator RhaS Negatively Autoregulates rhaSR Expression by Preventing Cyclic AMP Receptor Protein Activation

The Escherichia coli RhaR protein activates expression of the rhaSR operon in the presence of its effector, L-rhamnose. The resulting RhaS protein (plus L-rhamnose) activates expression of the L-rhamnose catabolic and transport operons, rhaBAD and rhaT, respectively. Here, we further investigated our previous finding that rhaS deletion resulted in a threefold increase in rhaSR promoter activity, suggesting RhaS negative autoregulation of rhaSR. We found that RhaS autoregulation required the cyclic AMP receptor protein (CRP) binding site at rhaSR and that RhaS was able to bind to the RhaR binding site at rhaSR. In contrast to the expected repression, we found that in the absence of both RhaR and the CRP binding site at the rhaSR promoter, RhaS activated expression to a level comparable with RhaR activation of the same promoter. However, when the promoter included the RhaR and CRP binding sites, the level of activation by RhaS and CRP was much lower than that by RhaR and CRP, suggesting that CRP could not fully coactivate with RhaS. Taken together, our results indicate that RhaS negative autoregulation involves RhaS competition with RhaR for binding to the RhaR binding site at rhaSR. Although RhaS and RhaR activate rhaSR transcription to similar levels, CRP cannot effectively coactivate with RhaS. Therefore, once RhaS reaches a relatively high protein concentration, presumably sufficient to saturate the RhaS-activated promoters, there will be a decrease in rhaSR transcription. We propose a model in which differential DNA bending by RhaS and RhaR may be the basis for the difference in CRP coactivation.

Direct and negative regulation of the sycO-ypkA-ypoJ operon by cyclic AMP receptor protein (CRP) in Yersinia pestis

BackgroundPathogenic yersiniae, including Y. pestis, share a type III secretion system (T3SS) that is composed of a secretion machinery, a set of translocation proteins, a control system, and six Yop effector proteins including YpkA and YopJ. The cyclic AMP receptor protein (CRP), a global regulator, was recently found to regulate the laterally acquired genes (pla and pst) in Y. pestis. The regulation of T3SS components by CRP is unknown.ResultsThe sycO, ypkA and yopJ genes constitute a single operon in Y. pestis. CRP specifically binds to the promoter-proximate region of sycO, and represses the expression of the sycO-ypkA-yopJ operon. A single CRP-dependent promoter is employed for the sycO-ypkA-yopJ operon, but two CRP binding sites (site 1 and site 2) are detected within the promoter region. A CRP box homologue is found in site 1 other than site 2. The determination of CRP-binding sites, transcription start site and core promoter element (-10 and -35 regions) promotes us to depict the structural organization of CRP-dependent promoter, giving a map of CRP-promoter DNA interaction for sycO-ypkA-yopJ.ConclusionThe sycO-ypkA-yopJ operon is under the direct and negative regulation of CRP in Y. pestis. The sycO-ypkA-yopJ promoter-proximate regions are extremely conserved in Y. pestis, Y. pseudotuberculosis and Y. enterocolitica. Therefore, data presented here can be generally applied to the above three pathogenic yersiniae.

Regulation of the Vibrio vulnificus hupA Gene by Temperature Alteration and Cyclic AMP Receptor Protein and Evaluation of Its Role in Virulence

Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40 degrees C compared to cells grown at 30 degrees C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter P(hupA), and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection.

The Cyclic AMP Receptor Protein, CRP, Is Required for Both Virulence and Expression of the Minimal CRP Regulon in Yersinia pestis Biovar microtus

The cyclic AMP receptor protein (CRP) is a bacterial regulator that controls more than 100 promoters, including those involved in catabolite repression. In the present study, a null deletion of the crp gene was constructed for Yersinia pestis bv. microtus strain 201. Microarray expression analysis disclosed that at least 6% of Y. pestis genes were affected by this mutation. Further reverse transcription-PCR and electrophoretic mobility shift assay analyses disclosed a set of 37 genes or putative operons to be the direct targets of CRP, and thus they constitute the minimal CRP regulon in Y. pestis. Subsequent primer extension and DNase I footprinting assays mapped transcriptional start sites, core promoter elements, and CRP binding sites within the DNA regions upstream of pla and pst, revealing positive and direct control of these two laterally acquired plasmid genes by CRP. The crp disruption affected both in vitro and in vivo growth of the mutant and led to a >15,000-fold loss of virulence after subcutaneous infection but a <40-fold increase in the 50% lethal dose by intravenous inoculation. Therefore, CRP is required for the virulence of Y. pestis and, particularly, is more important for infection by subcutaneous inoculation. It can further be concluded that the reduced in vivo growth phenotype of the crp mutant should contribute, at least partially, to its attenuation of virulence by both routes of infection. Consistent with a previous study of Y. pestis bv. medievalis, lacZ reporter fusion analysis indicated that the crp deletion resulted in the almost absolute loss of pla promoter activity. The plasminogen activator encoded by pla was previously shown to specifically promote Y. pestis dissemination from peripheral infection routes (subcutaneous infection [flea bite] or inhalation). The above evidence supports the notion that in addition to the reduced in vivo growth phenotype, the defect of pla expression in the crp mutant will greatly contribute to the huge loss of virulence of this mutant strain in subcutaneous infection.

New targets for the cyclic AMP receptor protein in theEscherichia coliK-12 genome

Recent genomic studies with Escherichia coli K-12 have suggested scores of previously unexplored targets for the cyclic AMP receptor protein (CRP) global transcription regulator. Eleven of these loci were cloned and CRP binding was demonstrated at eight of these targets. It is shown that CRP can activate transcription at five of these targets and the functional DNA sites for CRP are identified. It is reported that CRP functions as a Class I activator at the aer promoter and as a Class II activator at the gatY, sdaC, ychH and malX promoters.

Measurement of DNA helical change for the binding of cyclic AMP receptor protein to lac DNA.

Cyclic AMP receptor protein (CRP) binds to DNA and induces DNA bending. DNA bending plays an important role in transcription activation of many genes in Escherichia coli. To know DNA helical change by CRP, we used molar cyclization factor (j(M)), which is sensitive to helical twist or torsional alignment. Six consecutive DNA fragments were constructed that contained phasing sequence at left arm and CRP binding site in center. j(M) values measured in this study were approximately 10 times increased by CRP relative to that measured for DNA only. The analysis of set of j(M) values indicated that CRP induced DNA bending without the helical change like helical twisting or torsional alignment change.

The PaaX repressor, a link between penicillin G acylase and the phenylacetyl-coenzyme A catabolon of Escherichia coli W.

The pac gene, encoding the penicillin G acylase from Escherichia coli W, is regulated by the PaaX repressor of the phenylacetate catabolic pathway. pac expression depends on the synthesis of phenylacetyl-coenzyme A. PaaX and the cyclic AMP receptor protein (CRP) bind in vitro to the Ppac promoter region. A palindromic sequence proposed as the PaaX operator is located upstream of the -35 box overlapping a CRP binding site, an unusual position that suggests a novel regulatory mechanism.

The cyclic AMP-cyclic AMP receptor protein complex regulates activity of the traJ promoter of the Escherichia coli conjugative plasmid pRK100.

The TraJ protein is a central activator of F-like plasmid conjugal transfer. In a search for regulators of traJ expression, we studied the possible regulatory role of the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex in traJ transcription using a traJ-lacZ reporter system. A comparison of the enzyme activities in the wild-type Escherichia coli strain MC4100 with those in cya and crp mutants indicated that disruption of the formation of the cAMP-CRP complex negatively influenced the activity of the traJ promoter of the F-like plasmid pRK100. The defect in the cya mutant was partially restored by addition of exogenous cAMP. Competitive reverse transcription-PCR performed with RNA isolated from the wild-type and mutant strains showed that the cAMP-CRP complex exerted its effect at the level of transcription. Electrophoretic mobility shift assays with purified CRP demonstrated that there was direct binding of CRP to the traJ promoter region. DNase I footprint experiments mapped the CRP binding site around position -67.5 upstream of the putative traJ promoter. Targeted mutagenesis of the traJ promoter region confirmed the location of the CRP binding site. Consistent with the demonstrated regulation of TraJ by the cAMP-CRP complex, mutants with defects in cya or crp exhibited reduced conjugal transfer from pRK100.

Interaction of cAMP receptor protein from Escherichia coli with cAMP and DNA studied by dynamic light scattering and time-resolved fluorescence anisotropy methods.

Cyclic AMP receptor protein (CRP) regulates the expression of more than 100 genes in Escherichia coli when complexed with cyclic AMP. Dynamic light scattering (DLS) and fluorescence decay anisotropy measurements of CRP were performed in solution, in the absence and presence of cAMP. We have also measured the effect of DNA sequences, including lac and gal promoter sequences, on the shape of CRP-DNA complexes. DLS measurements show that upon cAMP binding at low nucleotide concentration, the Stokes radius decreases from the value of 2.8 nm for apo-CRP to the value of 2.7 nm. At higher cAMP concentration, only a very small further decrease was detected. Fluorescence anisotropy decay measurements, with the use of CRP labeled at Cys-178 with 1,5-I-AENS, indicate that apo-CRP exhibits two rotational correlation times. The longer time, theta1 = 23.3 ns, corresponds to the overall motion of the protein, and the shorter time, theta2 = 1.4 ns, exhibits segmental mobility of the C-terminal domain of CRP. Binding of cAMP into CRP induced substantial increase of theta1 to the value of 30.7 ns, whereas theta2 remained unchanged. The DLS measurements indicate that the binding of CRP into a fragment of DNA possessing a sequence of lac promoter induces a larger increase in the Stokes radius of lac-CRP complex than in case of gal-CRP complex. Similarly, a higher change was detected in rotational correlation time, theta1, in the case of lac-CRP complex than in case of gal-CRP. Because the lac and gal promoters are characteristic for the two different classes of CRP-dependent promoters, one can expect that the observed differences in lac-CRP and gal-CRP complexes are important in activation of transcription in Escherichia coli.