Cucumber Mosaic Virus Research Articles

Current knowledge and breeding strategies for management of aphid-transmitted viruses of pepper (Capsicum spp.) in Africa

Aphid-transmitted viruses cause significant losses in pepper production worldwide, negatively affecting yield and quality. The emergence of new aphid-transmitted viruses or development of variants as well as the occurrence in mixed infections make management a challenge. Here, we overview the current status of the distribution, incidence and phylogeny of aphids and the viruses they transmit in pepper in Africa; outline the available genetic resources, including sources of resistance, resistance genes and molecular markers; and discuss the recent advances in understanding the genetic basis of resistance to the predominant African viruses infecting pepper. Pepper veinal mottle virus (PVMV; Potyvirus); Potato virus Y (PVY; Potyvirus), Chili veinal mottle virus (ChiVMV; Potyvirus), Cucumber mosaic virus (CMV; Cucumovirus) and Pepper veins yellow virus (PeVYV; Polerovirus) have been reported to be the most widespread and devastating aphid-transmitted viruses infecting pepper across Africa. Co-infection or mixed infection between aphid-transmitted viruses has been detected and the interrelationship between viruses that co-infect chili peppers is poorly understood. Establishing and evaluating existing and new diversity sets with more genetic diversity is an important component of developing host resistance and implementing integrated management strategies. However, more work needs to be done to characterize the aphid-transmitted viral strains across Africa and understand their phylogeny in order to develop more durable host resistance. In addition, a limited number of QTLs associated with resistance to the aphid-transmitted virus have been reported and QTL data are only available for PVY, ChiVMV and CMV mainly against European and Asian strains, although PVMV is likely the most important aphid-transmitted viral disease in Africa. There is a need to identify germplasm resources with resistance against various aphid-transmitted virus strains, and subsequent pyramiding of the resistance using marker-assisted selection could be an effective strategy. The recent advances in understanding the genetic basis of the resistance to the virus and the new breeding techniques that can be leveraged to accelerate breeding for aphid-transmitted virus in pepper are proposed as strategies to more efficiently develop resistant cultivars. The deployment of multi-genetic resistances in pepper is an effective and desirable method of managing viral-diseases in Africa and limit losses for farmers in a sustainable manner.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

WEEDS AND WILD PLANTS AS NATURAL HOSTS OF CUCUMBER MOSAIC VIRUS: A CASE STUDY FROM WESTERN SLOVAKIA

Cucumber mosaic virus (Bromoviridae) is a worldwide widespread pathogen affecting more than 1200 plant species. Although more attention is paid to CMV research on agricultural crops, vegetables or ornamental plants, this work was focused on the analysis of several weeds and wild plants as potential natural hosts of CMV. For this purpose, samples from two different agroecological locations were tested by DAS-ELISA using CMV-specific antibodies, revealing nine CMV-positive plant species. CMV isolates from greater burdock (Arctium lappa L.), rough hawksbeard (Crepis biennis L.), wood avens (Geum urbanum L.), prickly lettuce (Lactuca serriola L.), black medick (Medicago lupulina L.), bitter dock (Rumex obtusifolius L.), field sowthistle (Sonchus arvensis L.), white clover (Trifolium repens) and white violet (Viola alba Besser.) were further characterized by sequencing the complete CP gene, disclosing their affiliation to the CMV Group II. We have shown that weeds and wild plant species can be effective hosts for CMV and can serve as virus reservoirs from which the virus can be spread to cultivated crops.

Use of silver nanoparticles to suppress Cucumber mosaic virus (CMV) in ginger (Zingiber officinale Roscoe) and turmeric (Curcuma longa L.)

Plant viruses have remained a nuisance to profitable and sustainable crop cultivation; and concerted efforts have been exercised to salvage this menace. In this study, the efficacy of silver nanoparticles (AgNPs) against Cucumber mosaic virus (CMV) in ginger and turmeric plants was investigated using the technique of quantitative real-time PCR (qRT-PCR) using SYBR Green. The plants comprising three groups; treated, untreated and healthy controls were mechanically inoculated with a purified CMV suspension at early plant growth. The virus concentration was then measured after the inoculation before silver nanoparticles were applied at 20 ppm per treated plant. The virus concentration significantly declined after the suppressive effect by AgNPs (p < 0.01) in the treated plants from one-month post-inoculation (MPI) and sustained through 5 MPI. Thus, AgNPs have provided an avenue for the management of CMV infection in ginger and turmeric.

First Report of cucumber mosaic virus in Zinnia elegans in Indonesia

First Report of cucumber mosaic virus in Zinnia elegans in Indonesia

An asymptomatic geminivirus activates autophagy and enhances plant defenses against diverse pathogens

Plant viral diseases cause great losses in agricultural production. Virus cross-protection is a strategy in which a mild virus is employed to shield plants against subsequent infections by severe viral strains. However, this approach is restricted to protection against the same viruses. In this study, we observed that pre-inoculation with apple geminivirus (AGV) reduced the accumulation of secondarily infected heterologous viruses, such as cucumber mosaic virus, potato virus X, and tobacco mosaic virus in Nicotiana benthamiana, tomato, and pepper plants. Transcriptional expression analysis showed that autophagy-related genes were transcriptionally up-regulated upon AGV inoculation at an early stage of infection. Accordingly, autophagic activity was observed to be elevated following AGV infection. Interestingly, AGV accumulation was reduced in autophagy-deficient plants, suggesting that autophagy activation promotes AGV infection in the plant. Moreover, pre-inoculation with AGV provided cross-protection against infection with a phytopathogenic bacterium (Pseudomonas syringae) and fungus (Botrytis cinerea) in Nicotiana species. In summary, our study showed that AGV, an asymptomatic virus, could protect plants against severe viral, fungal, and bacterial diseases to some extent through the activation of autophagy pathways, highlighting its potential as a biocontrol agent for managing a wide range of plant crop diseases in the field.

Complete Genome of Achromobacter xylosoxidans, a Nitrogen-Fixing Bacteria from the Rhizosphere of Cowpea (Vigna unguiculata [L.] Walp) Tolerant to Cucumber Mosaic Virus Infection.

Achromobacter xylosoxidans is one of the nitrogen-fixing bacteria associated with cowpea rhizosphere across Africa. Although its role in improving soil fertility and inducing systemic resistance in plants against pathogens has been documented, there is limited information on its complete genomic characteristics from cowpea roots. Here, we report the complete genome sequence of A. xylosoxidans strain DDA01 isolated from the topsoil of a field where cowpea plants tolerant to cucumber mosaic virus (CMV) were grown in Ibadan, Nigeria. The genome of DDA01 was sequenced via Illumina MiSeq and contained 6,930,067 nucleotides with 67.55% G + C content, 73 RNAs, 59 tRNAs, and 6421 protein-coding genes, including those associated with nitrogen fixation, phosphate solubilization, Indole3-acetic acid production, and siderophore activity. Eleven genetic clusters for secondary metabolites, including alcaligin, were identified. The potential of DDA01 as a plant growth-promoting bacteria with genetic capabilities to enhance soil fertility for resilience against CMV infection in cowpea is discussed. To our knowledge, this is the first complete genome of diazotrophic bacteria obtained from cowpea rhizosphere in sub-Saharan Africa, with potential implications for improved soil fertility, plant disease resistance, and food security.

Antiviral RNA interference inhibits virus vertical transmission in plants

Known for over a century, seed transmission of plant viruses promotes trans-continental virus dissemination and provides the source of infection to trigger devastating disease epidemics in crops. However, it remains unknown whether there is a genetically defined immune pathway to suppress virus vertical transmission in plants. Here, we demonstrate potent immunosuppression of cucumber mosaic virus (CMV) seed transmission in its natural host Arabidopsis thaliana by antiviral RNA interference (RNAi) pathway. Immunofluorescence microscopy reveals predominant embryo infection at four stages of embryo development. We show that antiviral RNAi confers resistance to seed infection with different genetic requirements and drastically enhanced potency compared with the inhibition of systemic infection of whole plants. Moreover, we detect efficient seed transmission of a mutant CMV lacking its RNAi suppressor gene in mutant plants defective in antiviral RNAi, providing further support for the immunosuppression of seed transmission by antiviral RNAi.

Diverse RNA viruses discovered in multiple seagrass species.

Seagrasses are marine angiosperms that form highly productive and diverse ecosystems. These ecosystems, however, are declining worldwide. Plant-associated microbes affect critical functions like nutrient uptake and pathogen resistance, which has led to an interest in the seagrass microbiome. However, despite their significant role in plant ecology, viruses have only recently garnered attention in seagrass species. In this study, we produced original data and mined publicly available transcriptomes to advance our understanding of RNA viral diversity in Zostera marina, Zostera muelleri, Zostera japonica, and Cymodocea nodosa. In Z. marina, we present evidence for additional Zostera marina amalgavirus 1 and 2 genotypes, and a complete genome for an alphaendornavirus previously evidenced by an RNA-dependent RNA polymerase gene fragment. In Z. muelleri, we present evidence for a second complete alphaendornavirus and near complete furovirus. Both are novel, and, to the best of our knowledge, this marks the first report of a furovirus infection naturally occurring outside of cereal grasses. In Z. japonica, we discovered genome fragments that belong to a novel strain of cucumber mosaic virus, a prolific pathogen that depends largely on aphid vectoring for host-to-host transmission. Lastly, in C. nodosa, we discovered two contigs that belong to a novel virus in the family Betaflexiviridae. These findings expand our knowledge of viral diversity in seagrasses and provide insight into seagrass viral ecology.

A resilient mutualistic interaction between cucumber mosaic virus and its natural host to adapt to an excess zinc environment and drought stress.

A perennial pseudometallophyte Arabidopsis halleri is frequently infected with cucumber mosaic virus (CMV) in its natural habitat. The purpose of this study was to characterize the effect of CMV infection on the environmental adaptation of its natural host A. halleri. The CMV(Ho) strain isolated from A. halleri was inoculated into clonal virus-free A. halleri plants, and a unique plant-virus system consisting of CMV(Ho) and its natural wild plant host was established. In a control environment with ambient zinc supplementation, CMV(Ho) infection retarded growth in the above-ground part of host plants but conferred strong drought tolerance. On the other hand, in an excess zinc environment, simulating a natural edaphic environment of A halleri, host plants hyperaccumulated zinc and CMV(Ho) infection did not cause any symptoms to host plants while conferring mild drought tolerance. We also demonstrated in Nicotiana benthamiana as another host that similar effects were induced by the combination of excess zinc and CMV(Ho) infection. Transcriptomic analysis indicated that the host plant recognized CMV(Ho) as a mutualistic symbiont rather than a parasitic pathogen. These results suggest a resilient mutualistic interaction between CMV(Ho) and its natural host A. halleri in its natural habitat.

Arctium lappa is a new Natural Host of Tomato Spotted Wilt Virus in Korea.

Burdock (Arctium lappa L., belongs to the family Asteraceae), is an edible plant and an oriental medicinal herb in Korea (Han and Koo, 1993). In July 2023, burdocks showing chlorotic ringspots and yellowing on the leaves were observed in nine of approximately 4,000 plants in a greenhouse in Daegu, South Korea. To determine the causal virus species, nine symptomatic leaves from each individual plant were collected and tested using commercially available immunostrips (Agdia, Elkhart, USA) for cucumber mosaic virus (CMV) and tomato spotted wilt virus (TSWV). Seven out of nine samples tested positive for TSWV only. TSWV in South Korea was first reported on sweet pepper from Yesan in 2004 (Kim et al., 2004) and has since spread to various crops. The first report of TSWV infecting burdock plants in the world was from Hawaii in 1995 (Bautista et al., 1995), but TSWV-infected burdock has not been reported in Korea. To further confirm the presence of TSWV, total RNA was extracted from TSWV-positive burdock leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used in reverse transcription-polymerase chain reaction (RT-PCR) assays with a specific primer set that amplifies 777 bp of nucleocapsid gene (N gene) of TSWV (Yoon et al., 2014). To obtain the complete genome sequence of this TSWV in the burdock plant, named TSWV-DG, fragments of L, M, and S segments were amplified and sequenced. The complete genome sequences of the L (8914 nt), M (4773 nt), and S (2946 nt) segments were obtained by overlapping RT-PCR amplicons. RT-PCR products were cloned into the pGEM-T Easy vector, and selected DNA clones were sequenced using Sanger method (Bioneer, Korea). The complete genome sequences were deposited to GenBank (LC790665, LC790666, and LC790667, respectively). BLASTn analysis showed that sequences of each TSWV-DG segment had maximum nucleotide identities of 99.5%, 99.5%, and 99.5% with TSWV-L, TSWV-M, and TSWV-S (OM154971, OM154970, and OM154969, respectively), which were isolated from water dropwort (Oenanthe crocata) in China (Qiu et al., 2023). To assess the biological activity of TSWV-DG, A. lappa and Nicotiana benthamiana were inoculated mechanically with sap from infected burdock leaves and maintained for visual inspection of virus symptoms at 25 ℃ at 3 weeks. TSWV-DG produced symptoms on the systemic leaves of A. lappa, that included chlorotic spots and yellowing, and on the leaves of N. benthamiana, that included chlorotic spots and mosaic patterns from 14 days-post-inoculation. Meanwhile, mock-inoculated A.lappa and N.benthamiana remained symptomless. The presence of TSWV on the inoculated leaves was subsequently confirmed through Immunostrip and RT-PCR analyses. TSWV may pose a significant threat to the production of A. lappa, which is cultivated as both leafy greens and root vegetables in Korea. Furthermore, A. lappa may not only be at risk of damage from TSWV infection but also act as a potential source of TSWV infection, thereby posing a risk of transmission to other key crops in Korea, such as pepper or potato (Yoon et al., 2014). This is the first report TSWV infecting burdock in South Korea.

Response of Some Pepper Genotypes to Cucumber Mosaic Virus (CMV) and Discrimination of Kilis Isolates Using High-Resolution Melting (HRM) Method

The escalating global population, diminishing agricultural lands, and the overarching global climate crisis are significantly impacting pepper cultivation. These challenges exacerbate the vulnerability of pepper plants to various biotic and abiotic factors, particularly viral diseases, resulting in diminished yield and quality. Cucumber mosaic virus (CMV), a notable concern for peppers in the Solanaceae family, is causing substantial quality and yield losses, with no effective chemical control methods currently available. This study focuses on exploring the genetic structure of CMV isolates obtained from pepper production areas in Kilis province and comparing these regions through the High-Resolution Melting (HRM) method. CMV isolates, cultivated in tobacco plants, have their partial coat protein sequences compared with those of other CMV isolates registered in the gene bank. The nucleotide sequences of identified CMV isolates are phylogenetically grouped and compared using an HRM graph. The HRM graph effectively distinguishes Kilis 3 and Kilis 4 isolates, clustered similarly to sequence patterns, from other isolates. The study highlights the utility of HRM analyses in identifying differences between isolates before determining sequence patterns. In the gene bank comparison, Kilis CMV isolates distinguished from others. Similarities were observed with isolates from Iran's Balsam (Impatiens balsamina - LC066478), Türkiye's Radish (Raphanus sativus - LC0665051), and Wild Turnip (Rapistrum rugosum - LC066514, LC066511, LC066517). The study found that Kilis 7 CMV isolate, transferred mechanically to 24 different pepper genotypes (C. annuum) from the local population, revealed susceptibility to CMV in the 24 lines developed from the Elbeyli population in Kilis province.

Strain-specific differences in the interactions of the cucumber mosaic virus 2b protein with the viral 1a and host Argonaute 1 proteins.

The cucumber mosaic virus (CMV) 2b protein was among the first discovered viral suppressors of RNA silencing. It has additional pro-viral functions through effects on plant defensive signaling pathways mediated by salicylic acid and jasmonic acid, the abscisic acid pathway and virus-induced drought resistance, and on host plant interactions with insect vectors. Many of these effects occur due to interaction with the important host RNA silencing component Argonaute 1 (AGO1). It was thought that only 2b proteins of "severe" CMV strains interacted with AGO1 and inhibited its microRNA-mediated "slicing" of cellular mRNAs and that the lack of interaction with AGO1 explained the moderate symptoms typically seen in plants infected with mild CMV strains. Our work overthrows this paradigm by showing that mild strain CMV 2b proteins can interact with AGO1, but their in vivo localization prevents them from interacting with AGO1 molecules present in the infected cell cytoplasm.

Acyl hydrazone derivatives with trifluoromethylpyridine as potential agrochemical for controlling plant diseases.

Crops are consistently under siege by a multitude of pathogens. These pathogenic microorganisms, including viruses and bacteria, result in substantial reductions in quality and yield globally by inducing detrimental crop diseases, thus posing a significant challenge to global food security. However, the biological activity sepectrumof commercially available pesticides is limitedand the pesticide efficacy is poor, necessitating the urgent development of broad-spectrum and efficient strategies for crop disease prevention and control. The bioassay results revealed that certain target compounds demonstrated outstanding in vivo antiviral efficacy against cucumber mosaic virus and tobacco mosaic virus. In particular, compound D6 showed remarkable antiviral activity against CMV, significantly higher than that of the control agent ningnanmycin. Mechanism of action studies have shown that compound D6 could enhance the activity of defense enzymes and upregulate the expression of genes related to disease resistance, thereby enhancing the antiviral effects in plants. In addition, these compounds displayed superior inhibitory activity against plant bacterial diseases. For Xoo, compound D10 showed an excellent inhibitory effect that was better than that of the control agent bismerthiazol. Scanning electron microscopy and fluorescence double-staining experiments revealed that compound D10 effectively inhibited bacterial growth by disrupting the cell membrane. A series of trifluoromethyl hydrazone derivatives were designed and synthesized, and it was found that they have control effects on plant viruses and bacterial diseases. In addition, this study revealed the mechanism of action of the active compounds and demonstrated their potential as multifunctional crop protectants. © 2024 Society of Chemical Industry.

Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China

Purple coneflower (Echinacea purpurea L.), which is a perennial herbaceous plant belonging to the Asteraceae family, is extensively cultivated because of its medicinal applications. However, in Hohhot, Inner Mongolia, China, purple coneflowers in the field exhibited symptoms such as mottle, mosaic, and crinkle. This study aimed to explore the biological and molecular characteristics of the cucumber mosaic virus (CMV) infecting the purple coneflowers in China. We observed isometric particles approximately 30 nm in diameter in the symptomatic leaf specimens. Infection with the CMV was confirmed via high-throughput sequencing and RT-PCR validation. Mechanical inoculation assays demonstrated that the CMV-SGJ isolate could infect both Nicotiana benthamiana and Nicotiana tabacum. Three viral genomic components were identified: RNA1 with 3321 nucleotides, RNA2 with 3048 nucleotides, and RNA3 with 2209 nucleotides. Phylogenetic analysis revealed that the CMV-SGJ isolate clustered into phylogenetic subgroup IA, exhibiting a nucleotide identity of 92.2–95% with subgroup IA CMV isolates in GenBank. This report is the first documentation of the complete genome of the CMV infecting purple flowers in China.

Evaluation of Pumpkin Cultivars against Cucumber Mosaic Virus Disease under Field Condition

The family Cucurbitaceae includes pumpkin (Cucurbita moschata Duch.), one of the most significant vegetable crops cultivated both in India and overseas. Various biotic and abiotic factors affect pumpkin production, and one of the biggest threats to its cultivation is the cucumber mosaic virus disease. An experiment was conducted in the experimental field of the Department of Plant Pathology, Biswanath College of Agriculture, Assam Agricultural University, Assam during 2022–2023 with the aim of screening out various varieties of pumpkin and identifying the one that was most resistant to cucumber mosaic virus in view of the disease's significance. Out of eighteen pumpkin cultivars evaluated against cucumber mosaic virus disease, six were moderately susceptible, eleven were susceptible and one cultivar was observed to be highly resistant against the disease.

Molecular characterization of cucumber mosaic virus isolates infecting Sugar beet (Beta vulgaris) and other crops in Egypt

Molecular characterization of cucumber mosaic virus isolates infecting Sugar beet (Beta vulgaris) and other crops in Egypt

Interplay between drought and plant viruses co-infecting melon plants

Drought affects crops directly, and indirectly by affecting the activity of insect pests and the transmitted pathogens. Here, we established an experiment with well-watered or water-stressed melon plants, later single infected with either cucumber mosaic virus (CMV: non-persistent), or cucurbit aphid-borne yellow virus (CABYV: persistent), or both CMV and CABYV, and mock-inoculated control. We tested whether i) the relation between CMV and CABYV is additive, and ii) the relationship between water stress and virus infection is antagonistic, i.e., water stress primes plants for enhanced tolerance to virus infection. Water stress increased leaf greenness and temperature, and reduced leaf water potential, shoot biomass, stem dimensions, rate of flowering, CABYV symptom severity, and marketable fruit yield. Virus infection reduced leaf water potential transiently in single infected plants and persistently until harvest in double-infected plants. Double-virus infection caused the largest and synergistic reduction of marketable fruit yield. The relationship between water regime and virus treatment was additive in 12 out of 15 traits at harvest, with interactions for leaf water content, leaf:stem ratio, and fruit set. We conclude that both virus-virus relations in double infection and virus-drought relations cannot be generalized because they vary with virus, trait, and plant ontogeny.

The Internal Extra Sequence Regions in Satellite RNA TA-Tb Are Important for Suppressing RNA Accumulations of Cucumber Mosaic Virus to Attenuate the Virulence of the Helper Virus

The Internal Extra Sequence Regions in Satellite RNA TA-Tb Are Important for Suppressing RNA Accumulations of Cucumber Mosaic Virus to Attenuate the Virulence of the Helper Virus

Reduction in vertical transmission rate of bean common mosaic virus in bee-pollinated common bean plants

Vertical transmission, the transfer of pathogens across generations, is a critical mechanism for the persistence of plant viruses. The transmission mechanisms are diverse, involving direct invasion through the suspensor and virus entry into developing gametes before achieving symplastic isolation. Despite the progress in understanding vertical virus transmission, the environmental factors influencing this process remain largely unexplored. We investigated the complex interplay between vertical transmission of plant viruses and pollination dynamics, focusing on common bean (Phaseolus vulgaris). The intricate relationship between plants and pollinators, especially bees, is essential for global ecosystems and crop productivity. We explored the impact of virus infection on seed transmission rates, with a particular emphasis on bean common mosaic virus (BCMV), bean common mosaic necrosis virus (BCMNV), and cucumber mosaic virus (CMV). Under controlled growth conditions, BCMNV exhibited the highest seed transmission rate, followed by BCMV and CMV. Notably, in the field, bee-pollinated BCMV-infected plants showed a reduced transmission rate compared to self-pollinated plants. This highlights the influence of pollinators on virus transmission dynamics. The findings demonstrate the virus-specific nature of seed transmission and underscore the importance of considering environmental factors, such as pollination, in understanding and managing plant virus spread.