Corynebacterium Sp Research Articles

Biostimulatory effect of organic and inorganic nutrients on soil biological indicators in diesel contaminated soil

Conventional soil remediation has been known to be expensive treatment. Thus, various strategies have been opted to investigate cost-effective solution to contaminated sites and an example is bio-stimulation. The study investigated effect of organic and inorganic nutrients on soil biological indicators of diesel – contaminated soil. The parameters investigated include determination of pH, conductivity, nitrate, phosphate, total organic carbon, moisture content, temperature, baseline, soil respiration, dehydrogenase activity, urease activity, soil microbial biomass carbon, protease activity, germination index (GI), total viable count technique (THBC and TCHUB), microscopic and biochemical characteristics in 56th days experimental period. The result revealed that the soil is neutral to slightly alkaline in pH, moderate in conductivity, low in nitrate, phosphate and total organic carbon contents, high in moisture content with moderate (mesophilic) temperature. The result of baseline study also revealed that soil respiration is 99.30 s days, dehydrogenase activity is 02.69 µg TPFg-1 dm (24 hr)-1), microbial biomass carbon is 02.69 mg/kg, urease activity is 24.52 µmol N-NH4 / g 2 hrs, protease activity is 36.66 µg / ml, GI is 09.24 %, THBC is 06.53 logCFU /g and TCHUB 06.73 logCFU /g. There were significant effect (P < 0.05) on dehydrogenase activities, urease activities, total heterotrophic bacteria counts (THBC) and total culturable hydrocarbon utilizing bacteria counts (TCHUBC) respectively but no significant effect (P > 0.05) on soil respiration, soil microbial biomass carbon, protease activity and germination index respectively by the organic and inorganic nutrients. There was negative and positive correlations between germination index, microbial count and other biological indicators measured. More so, the result revealed that the hydrocarbon utilizing bacterial isolates were Aeromonas sp., Serratia fonticola, Citrobacter freundii, Citrobacter diversus and Corynebacterium sp. Thus, application of organic and inorganic nutrients sources is suggested as a good strategy for bioremediation of diesel impacted soil.

Biostimulatory Effect of Organic and Inorganic Nutrients on Soil Biological Indicators in Diesel Contaminated Soil

Conventional soil remediation has been known to be expensive treatment. Thus, various strategies have been opted to investigate cost-effective solution to contaminated sites and an example is bio-stimulation. The study investigated effect of organic and inorganic nutrients on soil biological indicators of diesel – contaminated soil. The parameters investigated include determination of pH, conductivity, nitrate, phosphate, total organic carbon, moisture content, temperature, baseline, soil respiration, dehydrogenase activity, urease activity, soil microbial biomass carbon, protease activity, germination index (GI), total viable count technique (THBC and TCHUB), microscopic and biochemical characteristics in 56th days experimental period. The result revealed that the soil is neutral to slightly alkaline in pH, moderate in conductivity, low in nitrate, phosphate and total organic carbon contents, high in moisture content with moderate (mesophilic) temperature. The result of baseline study also revealed that soil respiration is 99.30 s days, dehydrogenase activity is 02.69 μg TPFg-1 dm (24 hr)-1), microbial biomass carbon is 02.69 mg/kg, urease activity is 24.52 μmol N-NH4 / g 2 hrs, protease activity is 36.66 μg / ml, GI is 09.24 %, THBC is 06.53 logCFU /g and TCHUB 06.73 logCFU /g. There were significant effect (P 0.05) on soil respiration, soil microbial biomass carbon, protease activity and germination index respectively by the organic and inorganic nutrients. There was negative and positive correlations between germination index, microbial count and other biological indicators measured. More so, the result revealed that the hydrocarbon utilizing bacterial isolates were Aeromonas sp., Serratia fonticola, Citrobacter freundii, Citrobacter diversus and Corynebacterium sp. Thus, application of organic and inorganic nutrients sources is suggested as a good strategy for bioremediation of diesel impacted soil.

A strategy to identify a ketoreductase that preferentially synthesizes pharmaceutically relevant (S)-alcohols using whole-cell biotransformation

IntroductionChemical industries are constantly in search of an expeditious and environmentally benign method for producing chiral synthons. Ketoreductases have been used as catalysts for enantioselective conversion of desired prochiral ketones to their corresponding alcohol. We chose reported promiscuous ketoreductases belonging to different protein families and expressed them in E. coli to evaluate their ability as whole-cell catalysts for obtaining chiral alcohol intermediates of pharmaceutical importance. Apart from establishing a method to produce high value (S)-specific alcohols that have not been evaluated before, we propose an in silico analysis procedure to predict product chirality.ResultsSix enzymes originating from Sulfolobus sulfotaricus, Zygosaccharomyces rouxii, Hansenula polymorpha, Corynebacterium sp. ST-10, Synechococcus sp. PCC 7942 and Bacillus sp. ECU0013 with reported efficient activity for dissimilar substrates are compared here to arrive at an optimal enzyme for the method. Whole–cell catalysis of ketone intermediates for drugs like Aprepitant, Sitagliptin and Dolastatin using E. coli over-expressing these enzymes yielded (S)-specific chiral alcohols. We explain this chiral specificity for the best-performing enzyme, i.e., Z. rouxii ketoreductase using in silico modelling and MD simulations. This rationale was applied to five additional ketones that are used in the synthesis of Crizotinib, MA-20565 (an antifungal agent), Sulopenem, Rivastigmine, Talampanel and Barnidipine and predicted the yield of (S) enantiomers. Experimental evaluation matched the in silico analysis wherein ~ 95% (S)-specific alcohol with a chemical yield of 23–79% was obtained through biotransformation. Further, the cofactor re-cycling was optimized by switching the carbon source from glucose to sorbitol that improved the chemical yield to 85–99%.ConclusionsHere, we present a strategy to synthesize pharmaceutically relevant chiral alcohols by ketoreductases using a cofactor balanced whole-cell catalysis scheme that is useful for the industry. Based on the results obtained in these trials, Zygosaccharomyces rouxii ketoreductase was identified as a proficient enzyme to obtain (S)-specific alcohols from their respective ketones. The whole–cell catalyst when combined with nutrient modulation of using sorbitol as a carbon source helped obtain high enantiomeric and chemical yield.

Bimodal applications of LDH-chitosan nanocomposite: water treatment and antimicrobial activity

Chitosan-LDH (layered doubled hydroxide) composite was prepared for removal heavy metals and antimicrobial activity. It was characterized by Fourier transform infrared spectrometer (FTIR), X-ray diffraction (XRD), Transmission electron microscopy (TEM), Scanning electronic microscope (SEM). Studying various physicochemical parameters such as the effects of pH, adsorbent amount, and contact time for removing heavy metals were performed. The adsorption kinetics and adsorption isotherm model were done to understand the adsorption process. The prepared composite exhibited strong antimicrobial activity against different gram positive (Lactobacillus sakei LMG 2313, Corynebacterium sp, Staphylococcus aureus 5247) and gram negative bacteria (Escherichia coli AO5). Results were recorded in terms of minimum inhibitory concentration (MIC), which is the lowest concentration of antimicrobial/antifungal agent that will inhibit the visible growth of a microorganism after overnight incubation.

Construction and Evaluation of a Korean Native Microbial Consortium for the Bioremediation of Diesel Fuel-Contaminated Soil in Korea.

A native microbial consortium for the bioremediation of soil contaminated with diesel fuel in Korea was constructed and its biodegradation ability was assessed. Microbial strains isolated from Korean terrestrial environments, with the potential to biodegrade aliphatic hydrocarbons, PAHs, and resins, were investigated and among them, eventually seven microbial strains, Acinetobacter oleivorans DR1, Corynebacterium sp. KSS-2, Pseudomonas sp. AS1, Pseudomonas sp. Neph5, Rhodococcus sp. KOS-1, Micrococcus sp. KSS-8, and Yarrowia sp. KSS-1 were selected for the construction of a microbial consortium based on their biodegradation ability, hydrophobicity, and emulsifying activity. Laboratory- and bulk-scale biodegradation tests showed that in diesel fuel-contaminated soil supplemented with nutrients (nitrogen and phosphorus), the microbial consortium clearly improved the biodegradation of total petroleum hydrocarbons, and all microbial strains constituting the microbial consortium, except for Yarrowia survived and grew well, which suggests that the microbial consortium can be used for the bioremediation of diesel fuel-contaminated soil in Korea.

Clinical Characteristics and Outcome of Lung Transplant Recipients with Respiratory Isolation of Corynebacterium spp.

Although chronic respiratory disease and immunosuppression are risk factors for Corynebacterium species respiratory infection, data are scarce regarding this disease in lung transplantation. Our aim was to describe the clinical characteristics and outcomes of lung transplant recipients (LTR) with respiratory isolation of Corynebacterium spp. This was a retrospective observational study performed at a referral center in Barcelona, Spain (2014 to 2016). We included all LTR in whom Corynebacterium spp. were isolated in at least one good-quality lower respiratory tract specimen. Overall, 24 of 527 (4.6%) LTR at risk during the study period were included. The main epidemiological, clinical, and microbiological data were analyzed. The most frequently isolated species were C. striatum (11/24), C. pseudodiphtheriticum (3/24), and C. amycolatum (3/24). All 19 (76%) patients who underwent bronchoscopy showed abnormalities, mainly mucosal plaques at the bronchial suture and purulent secretions. Clinical cure was achieved in 8/12 (67%) patients who fulfilled the CDC definition of lower respiratory tract infection (LRTI). To assess the clinical relevance of Corynebacterium spp., only patients with monomicrobial isolation (n = 18) were evaluated. LRTI was diagnosed in 9, and a nonsignificant association was found with a significant number of Corynebacterium sp. CFU/ml (7/9 LRTI versus 2/9 non-LRTI, P = 0.057). Persistent infection was associated with metallic bronchial stent implantation (4/4 versus 2/14, P = 0.005). The isolation of Corynebacterium spp. in respiratory specimens of lung transplant recipients may herald a respiratory tract infection or bronchial suture damage. Bronchial stent implantation is a risk factor for the persistence of Corynebacterium species infection.

Isolation of Hydrocarbonoclastic Bacteria and Plasmid Analysis for alk B Gene Primers

Hydrocarbonoclastic microorganisms elaborate a number of hydrocarbons utilising genes that enable them to use crude oil hydrocarbons as carbon sources. These genes could either be located on the plasmid or chromosome. The primary aim of this study was, therefore, to isolate hydrocarbon utilising microbes and profile their plasmid for alkB gene. The physicochemical, microbiological and plasmid analyses were done using standard methods described previously. Plasmid profiling for the alkB gene was carried with four selected bacteria isolates using the universal degenerate primers Rh alkB1-F: ATCTGGGCGCGTTGGGATTTGAGCG, Rh alkB1-R: CGCATGGTGATCGCTGTGCCGCTGC and Pp alkBP-F: TGGCCGGCT ACTCCGATGATCGGAATCTGG, Pp alkBP-R: GCGTGGTGATCCGAGTGCCGCTGAAGGTG. Physicochemical analysis revealed anthropogenic influence on the environment as iron and copper levels were higher than permissible international levels. Aerobic counts for bacteria were higher than those of fungi with values that ranged from 70 to 92 (x106) CFU/g for bacteria and 14 to 19 (x103) CFU/g for fungi. Microbiological and biochemical characterisation revealed that the hydrocarbonoclastic bacterial isolates were Enterobacter sp, Bacillus sp, Micrococcus sp, Pseudomonas sp, Corynebacterium sp and Klebsiella sp while the fungal isolates were Penicillium sp, Aspergillus flavus, Fusarium sp, Rhizopus sp and Aspergillus sp. Molecular characterisation revealed that the selected isolates for plasmid profiling were Bacillus thuringiensis, Pseudomonas stutzeri, Bacillus cereus and Klebsiella pneumoniae. Plasmid profiling revealed that none of the isolates were positive for the monoxygenase (alk B) genes. The findings in this study support earlier findings that indicated that the chromosome could indeed a preferred location for domiciliation of functional genes.

ISOLASI DAN IDENTIFIKASI BAKTERI ENDOFIT DARI TANAMAN PADI (Oryza sativa) SEBAGAI PENGENDALI PENYAKIT HAWAR DAUN BAKTERI AKIBAT Xanthomonas oryzae pv. oryzae

Rice cultivation often face obstacles, and one of them is bacterial leaf blight (BLB) disease caused by Xanthomonas oryzae pv. oryzae (Xoo). The application of endophytic bacteria is one of solutions to overcome this problem. Endophytic bacteria are non-pathogenic bacteria, which live in plant tissues. These bacteria could be isolated from the plant tissues. They may adapt to the plant tissues and produce antibiosis that could increase the plant resistance. Therefore, objectives of the research were to isolate the endophytic bacteria from healthy plant tissues and to identify them through morphology, physiology, biochemistry, and molecular. Method of the research was explorative along with three principal activities, such as isolation, selection, and identification on the potential endophytic bacteria. The isolation of the endophytic bacteria from healthy rice tissues has resulted 53 isolates and five of them have antagonistic ability in vitro against Xoo. Isolate ak9 has the highest antagonistic ability, 7.67 mm, in comparison with other isolates. Results of identification showed that those five potential bacteria have close relations, such as da3 with Bacillus cereus, isolate ak9 with Burkholderia sp., isolate ak30 with Enterobacter sp and isolate da9, as well as ak15 are Corynebacterium sp.

ISOLASI DAN IDENTIFIKASI BAKTERI ENDOFIT DARI TANAMAN PADI (Oryza sativa) SEBAGAI PENGENDALI PENYAKIT HAWAR DAUN BAKTERI AKIBAT Xanthomonas oryzae pv. oryzae

Rice cultivation often face obstacles, and one of them is bacterial leaf blight (BLB) disease caused by Xanthomonas oryzae pv. oryzae (Xoo). The application of endophytic bacteria is one of solutions to overcome this problem. Endophytic bacteria are non-pathogenic bacteria, which live in plant tissues. These bacteria could be isolated from the plant tissues. They may adapt to the plant tissues and produce antibiosis that could increase the plant resistance. Therefore, objectives of the research were to isolate the endophytic bacteria from healthy plant tissues and to identify them through morphology, physiology, biochemistry, and molecular. Method of the research was explorative along with three principal activities, such as isolation, selection, and identification on the potential endophytic bacteria. The isolation of the endophytic bacteria from healthy rice tissues has resulted 53 isolates and five of them have antagonistic ability in vitro against Xoo. Isolate ak9 has the highest antagonistic ability, 7.67 mm, in comparison with other isolates. Results of identification showed that those five potential bacteria have close relations, such as da3 with Bacillus cereus, isolate ak9 with Burkholderia sp., isolate ak30 with Enterobacter sp and isolate da9, as well as ak15 are Corynebacterium sp.

Intratumorale chemotherapie van een plaveicelcarcinoom van de huid bij een valkparkiet (Nymphicus hollandicus)

Een acht jaar oude, vrouwelijke valkparkiet (Nymphicus hollandicus) werd aangeboden met klachten van anorexie, lethargie, een massa onderaan de vleugel en verkleuring van het vederkleed. Het lichamelijk onderzoek toonde een ulceratief nodulair letsel van de huid van ongeveer 4 cm³, ventromediaal op de vleugel ter hoogte van het propatagium en de humerus. Op een laterale en ventrodorsale radiografie was er als enige afwijking hepatomegalie zichtbaar. Na een stabilisatieperiode werd er een chirurgische excisie van de tumor uitgevoerd. Uit het histopathologisch onderzoek en de bacteriële cultuur van de chirurgisch verwijderde massa bleek de laesie een integumentaal plaveicelcarcinoom te zijn, secundair bacterieel geïnfecteerd met Corynebacterium sp. Vier weken postoperatief was de tumor gerecidiveerd. Een behandeling met chemotherapie werd opgestart, waarbij éénmaal per week carboplatine intratumoraal (1,5 mg/cm³) werd toegediend. Omwille van de verdere tumorgroei na de tweede toediening van carboplatine werd de massa gereseceerd voordat de volgende toediening van carboplatine plaatsvond. De vogel overleed echter tijdens de anesthesie. Histopathologisch en immunohistochemisch onderzoek toonde degeneratie van de tumor met intercellulair oedeem en vacuolisatie van de tumorcellen aan, ondanks de toenemende tumorgrootte. Vermoedelijk was dit het resultaat van de carboplatinetoediening. Verder onderzoek is nodig om de werkzaamheid en veiligheid van de intratumorale toediening van carboplatine te bestuderen als behandelingsoptie bij vogels met een plaveicelcarcinoom van de huid.

Enhanced selective oxidation of trimethylolpropane to 2,2-bis(hydroxymethyl)butyric acid using Corynebacterium sp. ATCC 21245

2,2-Bis(hydroxymethyl)butyric acid (BHMB) is an important multifunctional chemical for the emerging bio-based polymer industry. It can be produced from trimethylolpropane (TMP) by selective oxidation using growing cells of Corynebacterium sp. ATCC 21245. However, this process is limited by the low volumetric productivity and low concentration of the final product. In the present study, we performed sequential batch operation with cell recycling in media containing glycerol, acetic acid, and increasing concentrations of yeast extract. This approach enhanced the conversion of 10 and 15 g/L TMP to 11.0 and 16.3 g/L BHMB at rates of 0.50 and 0.20 g/L.h, respectively. Applying a cell bleeding strategy resulted in an overall 10-fold improvement in productivity. The consequently prolonged biocatalyst viability resulted in a quantitative conversion of 20 g/L TMP to 22.3 g/L BHMB and a yield of 1.10 gBHMB/gTMP (100% molar yield). This work facilitates further studies of the selective oxidation on other industrially important polyols.

English

The king weakfish (Macrodon ancylodon) has a wide geographic distribution in South America and provides a positive economic outlook for the fishing industry in Brazil. The present study aimed to identify the intestinal microbiota and bacterial strains that can increase during storage of the king weakfish. Characterization of the microbiological quality was performed on samples to identify the microflora through isolation on culture media and identification using BD BBL kits for Gram-negative and Gram-positive bacteria. The growth of isolated strains was tested at conventional storage temperatures of 7 and 3°C used to limit the expansion of pathogenic bacteria populations. All king weakfish samples were within the limits established by Brazilian law for microbiological standards. Twenty strains that were isolated from the intestinal microbiota of M. ancylodon were identified; five stood out and may play a role in the safety and/or shelf-life of this fish species: Staphylococcus cohnii subsp. urealyticum, Burkholderia cepacia, Pseudomonas stutzeri, Pseudomonas fluorescens and Corynebacterium sp. However, only the first two strains showed significant growth at 3°C after three days of storage, mainly B. cepacia which is also considered an opportunistic pathogen. Key words: King weakfish, intestinal microbiota, opportunistic pathogen, shelf-life.

EFFECT OF STATIC MAGNETIC FIELD ON MICROBIAL GROWTH KINETICS AND PHYSIOCHEMICAL PROPERTIES OF NONO (FERMENTED MILK DRINK)

This study assessed the effect of 0.5T static magnetic field (SMF) on microbial growth kinetics and physiochemical properties of Nono drinks stored at uncertain condition for six days. Magnetatic bacterial were predominated by Lactobacillus casei (40%), Corynebacterium sp(50%), and Staphylococcus sp (10%); while fungi were Penicillum sp(30%), Mucorsp(20%) and Aspergillus sp(50%). SMF significantly (P

Evaluation of microbiological, cellular and risk factors associated with subclinical mastitis in female buffaloes

ObjectiveThis study aimed to evaluate the microbiological and cellular milk profile for the diagnosis of subclinical mastitis in female buffaloes and to assess risk factors for predisposition of the disease.MethodsAnalyses were carried out by standard plate count (SPC), identification of species and antibiotic resistance, somatic cell count (SCC), electrical electrical conductivity of milk (ECM), and lactoferrin content in milk. Teat cups were swabbed to evaluate risk factors, observing hyperkeratosis, milking vacuum pressure and cleanliness of the site. Hence, 30 female buffaloes were randomly selected (15 from a group in early lactation and 15 in late lactation).ResultsThe most common bacteria in the microbiological examination were Staphylococcus spp., Streptococcus spp. and Corynebacterium sp. In the antibiotic sensitivity test, 10 (58.82%) of the 17 antibiotics tested were sensitive to all isolates, and resistant bacteria were Streptococcus uberis, Streptococcus dysgalactiae, Streptococcus haemolyticus, and Escherichia coli. It was observed that positive samples in the microbiological examination showed total bacterial count between 9.10×103 to 6.94×106 colony forming units/mL, SCC between 42,000 to 4,320,000 cells/mL and ECM ranging from 1.85 to 7.40 mS/cm. It was also found that the teat cups had high microbial counts indicating poor hygiene, and even faults in the cleanliness of the animals’ waiting room were observed. It is concluded that values of SCC above 537,000 cells/mL and ECM above 3.0 mS/mL are indications of mammary gland infection for this herd; however, the association of these values with a microbiological analysis is necessary to more accurately evaluate the health status of mammary glands with subclinical mastitis.ConclusionThrough phenotypic characterization of bacteria involved in the samples, the genera Staphylococcus spp., Streptococcus spp., and Corynebacterimum bovis were the most prevalent in this study. Faults in environment and equipment hygienization are factors that are directly associated with mastitis.

Improvement of enantioselectivity of the B-type halohydrin hydrogen-halide-lyase from Corynebacterium sp. N-1074

Halohydrin hydrogen-halide-lyase (H-Lyase) is a bacterial enzyme involved in the degradation of halohydrins. This enzyme catalyzes the intramolecular nucleophilic displacement of a halogen by a vicinal hydroxyl group in halohydrins, producing the corresponding epoxides. The H-Lyases have been classified into A, B and C subtypes based on amino acid sequence similarities. These enzymes have attracted much attention as industrial catalysts in the synthesis of chiral chemicals from prochiral halohydrins. In the present study, we constructed mutants of B-type H-Lyase from Corynebacterium sp. N-1074 (HheB) displaying higher enantioselectivity by structure-based site-directed mutagenesis and random mutagenesis. A triple mutant of HheB exhibited 98.5% enantioselectivity, the highest ever reported, toward (R)-4-chloro-3-hydroxy-butyronitrile production, with the yield reaching approximately two-fold that of the wild-type enzyme. We discuss the structural basis of the high enantioselectivity and productivity of the mutant by comparing the crystal structures of the mutant HheB and the wild-type enzyme in complex with or without the substrate analogue.

Fluctuation of Bacteria on Bleb Surface After Trabeculectomy With Adjunctive Mitomycin C

To determine whether the bacterial and floral patterns on the bleb surface are affected by the season in eyes that had undergone trabeculectomy with adjunctive mitomycin C. Forty-four glaucoma patients who had an avascular or a hypovascular cystic filtering bleb were studied. Swabs of the bleb surface were taken 4 times in 1 year. The samples were cultured, and all organisms isolated were identified and tested for antibiotic sensitivity and resistance. Of the 176 specimens, 48 tested positive in cultures. Out of the 44 glaucoma eyes that had undergone trabeculectomy, 30 (68.2%) eyes were culture positive. A total of 58 strains were isolated. The organisms isolated were 22 strains of Staphylococcus epidermidis, 21 strains of Propionibacterium acnes, 8 strains of Corynebacterium sp., 5 strains of Staphylococcus sp., and 1 strain of both Neisseria sp., and Candida parapsilosis. Fifteen eyes had a positive culture ≥2 times, and in 10 of these eyes, the same strain was isolated. There was no resistance to vancomycin by S. epidermidis, P. acnes, and Corynebacterium sp. All of the isolates of S.epidermidis were sensitive to minocycline and amikacin. The rate of bacterial detection in the spring was 13.6%, summer was 20.5%, autumn was 45.5%, and winter was 29.5%. The increase in the incidence of bacterial presence during autumn was significant (P=0.006; the Fisher exact probability test). It is not rare to detect the bacterial organisms on the bleb surface in glaucomatous eyes that had undergone trabeculectomy. The prevalence varied with the season and was highest in the autumn.

Selective oxidation of trimethylolpropane to 2,2-bis(hydroxymethyl)butyric acid using growing cells of Corynebacterium sp. ATCC 21245

Multifunctional chemicals including hydroxycarboxylic acids are gaining increasing interest due to their growing applications in the polymer industry. One approach for their production is a biological selective oxidation of polyols, which is difficult to achieve by conventional chemical catalysis. In the present study, trimethylolpropane (TMP), a trihydric alcohol, was subjected to selective oxidation using growing cells of Corynebacterium sp. ATCC 21245 as a biocatalyst and yielding the dihydroxy-monocarboxylic acid, 2,2-bis(hydroxymethyl)butyric acid (BHMB). The study revealed that co-substrates are crucial for this reaction. Among the different evaluated co-substrates, a mixture of glucose, xylose and acetate at a ratio of 5:5:2 was found optimum. The optimal conditions for biotransformation were pH 8, 1v/v/m airflow and 500rpm stirring speed. In batch mode of operation, 70.6% of 5g/l TMP was converted to BHMB in 10 days. For recovery of the product the adsorption pattern of BHMB to the anion exchange resin, Ambersep® 900 (OH−), was investigated in batch and column experiments giving maximum static and dynamic binding capacities of 135 and 144mg/g resin, respectively. BHMB was separated with 89.7% of recovery yield from the fermentation broth. The approach is applicable for selective oxidation of other highly branched polyols by biotransformation.

Isolation of α-Amylase Producing Bacteria from Naini lake and Assessment of their Anti-Oxidant and anti-Fungal Properties

Bacterial enzymes play an important role in the industry. The objective of this study was to isolate and screen αamylase producing bacteria from water samples obtained from various regions of the Naini Lake, Uttarakhand, India. A total of 11 bacterial isolates were obtained on nutrient agar medium, which were then screened for the production of α-amylase. Antioxidant and anti-fungal property of the bacterial isolates which tested positive for α-amylase production was also assessed. Bacterial isolates NLWS 5 and NLWS 7 showed the highest enzyme production with a zone of 14mm and 10mm respectively. These two strains showed anti-oxidant as well as anti fungal activity which were then selected for identification using Bergey's Manual of Determinative Microbiology. It was found that the bacterial isolates which showed the highest amount of α-amylase production, anti-oxidant and anti-fungal activity belonged to Corynebacterium sp.

Bacterias oportunistas involucradas en infecciones oculares

Este artículo busca describir las bacterias oportunistas que causan infecciones oculares para ello, se realizó una búsqueda bibliográfica en bases de datos (PubMed, SciELO, EBSCO Medline, ProQuest, ScienceDirect y Scopus) y libros. Se encontró que las bacterias oportunistas causantes de infecciones oculares son habitantes residentes o transitorios de la microbiota ocular: Staphylococcus epidermidis, Corynebacterium sp., Propionibacterium sp., y Micrococcus del ambiente: Enterobacter erogenes, Citrobacter, Pseudomonas, Acinetobacter, Sphingomonas, Bradyrhizobium, Aquabacterium, Brevundimonas y Bacillus y de los animales: Francisella tularensis, Chlamydia psittacii y Leptospira. Estas bacterias ocasionan conjuntivitis, blefaritis, dacriocistitis, endoftalmitis, celulitis, queratitis y uveítis, en pacientes inmunocomprometidos, con una frecuencia mayor al 37 %. Además, la mayoría de especies son multirresistentes a los antimicrobianos, por lo cual representan un problema de salud pública que requiere el estudio de su hábitat y sus formas de transmisión, así como el diagnóstico y el control por parte del personal de la salud visual y ocular.

Danofloxacin and Marbofloxacin Activity on Some Bacterial Isolates from Camels (Camelus dromedarius)

Bacterial diseases in camel cause morbidity, mortality, suffering and significant economic losses. This study assessed the types of bacteria involved in different types of lesions encountered in camel's lung and liver slaughtered at municipal slaughter houses of Rabat, Morocco. Bacterial species isolated and identified included Staphylococcus aureus (19.2%), Staphylococcus sp (46.1%), Streptococcus sp (7.6%), Corynebacterium sp (15.3%) and Acinetobacter sp (11.5%). The percentage of resistance of isolates to the antibiotics varied from 0 to 84.6%. The most frequent resistance was to Ampicillin and Penicillin G (84.6%) followed by Gentamycin and Tetracycline (11.5. %), while all the isolates were susceptible to Cephalothin and Ciprofloxacin. Minimum inhibitory concentrations (MIC) of danofloxacin and marbofloxacin were determined against these bacteria. Time-kill curves against staphylococcus aureus (MIC=0.25μg/ml), Streptococcus sp (MIC=0.5μg/ml), Corynebacterium sp (MIC=0.5μg/ml) for both danofloxacin and marbofloxacin, and Acinetobacter sp (MIC=0.125μg/ml for marbofloxacin and 0.25 μg/ml for danofloxacin) were then determined according to a broth microdilution test. The pharmacodynamic parameters as lowest effective concentration (LEC) and optimal bactericidal concentration (OBC) were determined. Optimal values of surrogate markers predicting the antimicrobial effect and preventing the development of resistance were widely reached.