Abstract
Hydrocarbonoclastic microorganisms elaborate a number of hydrocarbons utilising genes that enable them to use crude oil hydrocarbons as carbon sources. These genes could either be located on the plasmid or chromosome. The primary aim of this study was, therefore, to isolate hydrocarbon utilising microbes and profile their plasmid for alkB gene. The physicochemical, microbiological and plasmid analyses were done using standard methods described previously. Plasmid profiling for the alkB gene was carried with four selected bacteria isolates using the universal degenerate primers Rh alkB1-F: ATCTGGGCGCGTTGGGATTTGAGCG, Rh alkB1-R: CGCATGGTGATCGCTGTGCCGCTGC and Pp alkBP-F: TGGCCGGCT ACTCCGATGATCGGAATCTGG, Pp alkBP-R: GCGTGGTGATCCGAGTGCCGCTGAAGGTG. Physicochemical analysis revealed anthropogenic influence on the environment as iron and copper levels were higher than permissible international levels. Aerobic counts for bacteria were higher than those of fungi with values that ranged from 70 to 92 (x106) CFU/g for bacteria and 14 to 19 (x103) CFU/g for fungi. Microbiological and biochemical characterisation revealed that the hydrocarbonoclastic bacterial isolates were Enterobacter sp, Bacillus sp, Micrococcus sp, Pseudomonas sp, Corynebacterium sp and Klebsiella sp while the fungal isolates were Penicillium sp, Aspergillus flavus, Fusarium sp, Rhizopus sp and Aspergillus sp. Molecular characterisation revealed that the selected isolates for plasmid profiling were Bacillus thuringiensis, Pseudomonas stutzeri, Bacillus cereus and Klebsiella pneumoniae. Plasmid profiling revealed that none of the isolates were positive for the monoxygenase (alk B) genes. The findings in this study support earlier findings that indicated that the chromosome could indeed a preferred location for domiciliation of functional genes.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.