Whole Genome Sequencing Research Articles

Exploring pangenomic diversity and CRISPR-Cas evasion potential in jumbo phages: a comparative genomics study.

Jumbo phages are large bacterial viruses known for more than 50 years. However, only in recent years, a significant number of complete genome sequences of jumbo phages have become available. In this study, we employed comparative genomic approaches to investigate the genomic diversity and genome protection capabilities of the 331 jumbo phages. Our findings revealed that jumbo phages exhibit high genetic diversity, with only a few genes being relatively conserved across jumbo phages. Interestingly, our data suggest that jumbo phages employ yet-to-be-identified strategies to protect their DNA from the host immune system, such as CRISPR-Cas.

Complete genome sequence of an umbravirus from white snakeroot (Ageratina altissima).

Complete genome sequencing of a virus from a white snakeroot plant (Ageratina altissima (L.) King & H. Rob.) collected in the Great Smoky Mountains National Park, USA, revealed a quadricistronic organization resembling that of umbraviruses. ORFs 1 and 2 are putatively translated via a -1 ribosomal frameshift mechanism as a single polypeptide with a role in viral replication, whereas the 3'-proximal and extensively overlapping ORFs 3 and 4 code for proteins involved in long distance trafficing andcell-to-cell movementwithin the host. Sequence comparisons and phylogenetic analysis strongly suggested that this virus is a previously undescribed member of the genus Umbravirus (family Tombusviridae), for which the name "white snakeroot virus A" (WSVA) is proposed. In addition, we identified and initiated characterization of its possible helper virus, a putative new member of the genus Luteovirus.

COMPARISON OF COMPUTATIONAL METHODS FOR ANALYSING 16S rRNA SEQUENCING DATA PRODUCED WITH THE USE OF SHORT AND LONG READS

This research is driven by the importance of identifying species in microbial community for use in medical testing. Conventional methods including culturing, biochemical assays are often limited to the culturable organisms and do not provide information about relative abundance of different microbial taxa within a community. Comparative analysis of metagenomic programs method was used to identify the most appropriate option for long-read 16S rRNA data. Since the development of high-throughput sequencing technologies, novel methods of identifying species include taxonomic profiling of 16S rRNA. 16S rRNA gene contains variable regions (V1-V9) that are specific to different taxonomic groups. Illumina short-read sequencing technology provides read lengths 2*251 base pairs (bp) for paired-end sequencing, while fraction of 16S rRNA gene is around 1500 bp, thus reads can successfully cover 2 of 9 regions (300-400 bp), but not the whole gene. The Oxford Nanopore Technology (ONT) representing long-read sequencing or so-called 3rd generation sequencing is much more applicable for 16S rRNA profiling, as it can provide reads with length 1500 bp (exactly in line with the length of 16S rRNA gene). Extended read length provides high alignment quality making the downstream taxonomy classification and relative abundance calculation much easier and relevant. The samples from endometrium of uterus were studied in the first part of the research. Endometrial microbiome composition and balance can play an important role in the success of in vitro fertilization (IVF). Taxonomical classification was tested with NCBI, Silva databases. NCBI database consists of full genomes of Bacteria, Archaea and Eukaryote, Silva contains curated and annotated sequences of only small subunit ribosomal RNA of these domains. Among the enormous collection of metagenome classifiers there were selected three particular programs applying completely different algorithms: Emu, PathoScope and Kraken2. The comparative process was divided in three phases. In the first one, pipelines were run with three programs and 11 samples using Silva and NCBI databases, the results were compared both quantitively and visually. In the second phase, the results were compared to the short-read taxonomical classification, the discrepancies were analyzed and questions were put together for further investigation. During the third phase pipelines with best performed programs were run on sample with acknowledged microbial diversity and following metrics were assessed and visualized: True positive, False positive, Precision, Recall, F1-score, L1-norm, L2-norm. Results: After the first phase it was revealed that Kraken2, Emu, PathoScope produce very similar results, while MetaScope discrepancies exceeded substantially 10% threshold for 70% of the reads. Additionally, Kraken2 annotated significantly more genera upon the threshold than other programs indicating its low specificity. Consequently, these two programs were excluded from further analysis. The second phase brought to the conclusion that short-read sequencing reports reveal only one prevailing genus in the community, while long-read establish 3 of them, thus it was assumed that short-read classification is much less sensitive. In the third phase it was determined that Emu and PathoScope have least deviation from reference value of abundances (ground truth) and they successfully annotate all the species introduced in the sample. Therefore, the main outcome of the research is the recommendation to use Emu and PathoScope programs for the purpose of identifying species using long-read data.

Improved inference of population histories by integrating genomic and epigenomic data.

With the availability of high-quality full genome polymorphism (SNPs) data, it becomes feasible to study the past demographic and selective history of populations in exquisite detail. However, such inferences still suffer from a lack of statistical resolution for recent, for example bottlenecks, events, and/or for populations with small nucleotide diversity. Additional heritable (epi)genetic markers, such as indels, transposable elements, microsatellites, or cytosine methylation, may provide further, yet untapped, information on the recent past population history. We extend the Sequential Markovian Coalescent (SMC) framework to jointly use SNPs and other hyper-mutable markers. We are able to (1) improve the accuracy of demographic inference in recent times, (2) uncover past demographic events hidden to SNP-based inference methods, and (3) infer the hyper-mutable marker mutation rates under a finite site model. As a proof of principle, we focus on demographic inference in Arabidopsis thaliana using DNA methylation diversity data from 10 European natural accessions. We demonstrate that segregating single methylated polymorphisms (SMPs) satisfy the modeling assumptions of the SMC framework, while differentially methylated regions (DMRs) are not suitable as their length exceeds that of the genomic distance between two recombination events. Combining SNPs and SMPs while accounting for site- and region-level epimutation processes, we provide new estimates of the glacial age bottleneck and post-glacial population expansion of the European A. thaliana population. Our SMC framework readily accounts for a wide range of heritable genomic markers, thus paving the way for next-generation inference of evolutionary history by combining information from several genetic and epigenetic markers.

Collaborative learning in the digital age: empowering tuberculosis researchers through virtual training.

Integrating whole genome sequencing (WGS) of the Mycobacterium tuberculosis complex into routine care, surveillance, and research in high tuberculosis burden settings remains challenging due to limited resources and skills. While technological platforms for scaling WGS are emerging, scaling wet lab and analytic components often depends on partnerships where such skills have been established. To address this, a virtual training program was developed. Over 12 weeks, 21 trainees from five Southern African institutes engaged in learning from curated theoretical content and interactive virtual meetings with experienced instructors. The training program, developed by a diverse team of experts in molecular biology, biomedical research, microbiology, and tuberculosis research, provided comprehensive coverage aligned with the latest advancements. Teaching strategies included interactive mentor-led sessions and real-time feedback, together with facilitated knowledge exchange and understanding. The virtual training program yielded several successes. Of note, trainees submitted three scientific articles for peer review, based on their acquired knowledge and its application in research. The program also fostered collaborations on Mycobacterium tuberculosis WGS among participants, showcasing the potential for networking and future joint projects. While the virtual training program encountered challenges related to the pandemic, limited resources, trainee engagement, and language barriers, these were creatively mitigated. To improve future training sessions, a platform assessing participant engagement and information retention is recommended. Wider collaborative efforts among experts and institutions in collating resources will lead to more comprehensive training programs. Addressing challenges such as internet connectivity issues and language barriers is crucial for ensuring inclusivity and enhancing the overall learning experience. In conclusion, the virtual training program successfully provided knowledge and skill training in WGS to trainees, leading to scientific article submissions and collaborations. Furthermore, content creators benefited from improved science communication and training opportunities.

Evaluation of the GenoType NTM-DR line probe assay for nontuberculous mycobacteria using whole genome sequences as reference standard

Pulmonary nontuberculous mycobacteria (NTM) disease is an emerging public health challenge that is especially problematic in people with cystic fibrosis (CF). Effective treatment depends on accurate species and subspecies identification and antimicrobial susceptibility status. We evaluated the GenoType NTM-DR VER 1.0 assay using biobanked NTM isolates with whole genome sequence (WGS) data and control isolates (total n=285). Species and subspecies detection sensitivity and specificity were 100 % for all species and subspecies except for two subspecies of M. intracellulare, that demonstrated a small degree of discrepant identification between M. intracellulare subspecies intracellulare and subspecies chimaera. All antimicrobial resistance markers were identified with 100 % sensitivity and specificity.We conclude that the GenoType NTM-DR assay offers a rapid and accurate option for identifying the most frequently encountered pathogenic NTM taxa and drug resistance markers.SUPPORT: Colorado CF Research Development Program and Colorado CF National Resource Centers funded by the Cystic Fibrosis Foundation, NJH Advanced Diagnostics Laboratories, Colorado Advanced Industries Accelerator Grant

Clinical, phenotypic characterization and genomic analysis of the mucoid Acinetobacter baumannii from a teaching hospital

BackgroundAcinetobacter baumannii (A. baumannii) has become a significant nosocomial pathogen globally over the past decade due to the increasing prevalence of antibiotic-resistant isolates. The formation of the mucoid phenotype is a crucial adaptive defense response to external pressure, but the clinical, phenotypic and genotypic characteristics and their relationship with sequence types (ST) and K locus (KL) types remain unclear. MethodsIn this study, we screened a total of 736 A. baumannii isolates, from which we identified and characterized 13 mucoid isolates. The study explored the clinical characteristics of patients with mucoid isolates, investigated the mucoid phenotype, performed capsule observation, quantified capsule production, and assessed antimicrobial susceptibility. Subsequently, whole-genome sequencing (WGS) was used to analyze the sequence types (ST), loci for capsular polysaccharide (KL), antibiotic resistance genes, virulence genes, and core-genome single-nucleotide polymorphisms (SNPs). Additionally, the virulence of all mucoid strains was evaluated through serum resistance assay, biofilm-forming assay, and Galleria mellonella survival assay. ResultsAll mucoid A. baumannii isolates were found to be encapsulated and extremely drug-resistant. Among patients infected with these isolates, 92.3 % had pulmonary infections, and the 30-day mortality rate was 61.5 %. The analysis revealed that not all strains are highly virulent. Whole-genome sequencing (WGS) identified the sequence types as ST136, ST208, ST381, ST195, and ST281, and the capsular types as KL77, KL7, KL33, KL2, and KL3. The ST208 and KL7 isolates exhibited higher virulence and greater biofilm formation, with KL7 isolates also showing higher capsule production. Despite these differences, no significant variations in virulence genes were observed among the mucoid isolates, except for biofilm-associated and quorum-sensing genes. The highly virulent ST208/KL7 strains (AB276, AB313, and AB552) lacked biofilm-associated genes (csuA/BABCDE), indicating these genes do not directly cause differences in biofilm formation. ConclusionThe mucoid A. baumannii isolates were extensively drug-resistant, and infections caused by these isolates could lead to higher mortality. However, not all strains had high virulence, with variations likely related to specific sequence types (ST) and K locus (KL) types.

Complete genome sequence and anti-obesity potential of Lactiplantibacillus plantarum HOM2217 in 3T3-L1 cells and high-fat diet-fed rats

Complete genome sequence and anti-obesity potential of Lactiplantibacillus plantarum HOM2217 in 3T3-L1 cells and high-fat diet-fed rats

Occurrence of Campylobacter, Listeria monocytogenes, and extended-spectrum beta-lactamase Escherichia coli in slaughterhouses before and after cleaning and disinfection

To prevent foodborne illness, adequate cleaning and disinfection (C&D) is essential to remove pathogenic bacteria from the slaughter environment. The aim of this study was to determine the presence of Campylobacter spp., Listeria monocytogenes, and extended-spectrum beta-lactamase-producing Escherichia coli (ESBL E. coli) before and after C&D in slaughterhouses.Samples from food- and non-food contact surfaces taken before and after C&D in one red meat and one poultry slaughterhouse were analyzed for the target bacteria. Whole-genome sequencing and antimicrobial susceptibility testing were performed.In total, 484 samples were analyzed. Campylobacter spp. were isolated from 13.0% to 15.5% of samples before C&D in the red meat and poultry slaughterhouse, respectively. Listeria monocytogenes was isolated before C&D in 12.5% and 5.2% of samples in the red meat and poultry slaughterhouse, respectively. It was noted that C. jejuni was detected on multiple surfaces and that L. monocytogenes showed potential persistence in one slaughterhouse. After C&D, L. monocytogenes was found in one sample. ESBL E. coli was not detected either before or after C&D.These findings show the possibility to remove pathogenic bacteria from slaughter and meat processing facilities, but also indicate that deficiencies in slaughter hygiene pose a risk of cross-contamination of meat.

Insect Mitochondrial Genomics: A Decade of Progress.

The past decade has seen the availability of insect genomic data explode, with mitochondrial (mt) genome data seeing the greatest growth. The widespread adoption of next-generation sequencing has solved many earlier methodological limitations, allowing the routine sequencing of whole mt genomes, including from degraded or museum specimens and in parallel to nuclear genomic projects. The diversity of available taxa now allows finer-scale comparisons between mt and nuclear phylogenomic analyses; high levels of congruence have been found for most orders, with some significant exceptions (e.g., Odonata, Mantodea, Diptera). The evolution of mt gene rearrangements and their association with haplodiploidy have been tested with expanded taxonomic sampling, and earlier proposed trends have been largely supported. Multiple model systems have been developed based on findings unique to insects, including mt genome fragmentation (lice and relatives) and control region duplication (thrips), allowing testing of hypothesized evolutionary drivers of these aberrant genomic phenomena. Finally, emerging research topics consider the contributions of mt genomes to insect speciation and habitat adaption, with very broad potential impacts. Integration between insect mt genomic research and other fields within entomology continues to be our field's greatest opportunity and challenge.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Development of targeted whole genome sequencing approaches for Crimean-Congo haemorrhagic fever virus (CCHFV)

Crimean-Congo haemorrhagic fever (CCHF) is the most prevalent human tick-borne viral disease, with a reported case fatality rate of 30% or higher. The virus contains a tri-segmented, negative-sense RNA genome consisting of the small (S), medium (M) and large (L) segments encoding respectively the nucleoprotein (NP), the glycoproteins precursor (GPC) and the viral RNA-dependent RNA polymerase (RDRP). CCHFV is one of the most genetically diverse arboviruses, with seven distinct lineages named after the region they were first reported in and based on S segment phylogenetic analysis.Due to the high genetic divergence of the virus, a single targeted tiling PCR strategy to enrich for viral nucleic acids prior to sequencing is difficult to develop, and previously we have developed and validated a tiling PCR enrichment method for the Europe 1 genetic lineage.We have developed a targeted, probe hybridisation capture method and validated its performance on clinical as well as cell-cultured material of CCHFV from different genetic lineages, including Europe 1, Europe 2, Africa 2 and Africa 3. The method produced over 95% reference coverages with at least 10x sequencing depth. While we were only able to recover a single complete genome sequence from the tested Europe 1 clinical samples with the capture hybridisation protocol, the data provides evidence of its applicability to different CCHFV genetic lineages.CCHFV is an important tick-borne human pathogen with wide geographical distribution. Environmental as well as anthropogenic factors are causing increased CCHFV transmission. Development of strategies to recover CCHFV sequences from genetically diverse clades of the virus is of paramount importance to monitor the presence of the virus in new areas, and in public health responses for CCHFV molecular surveillance to rapidly detect, diagnose and characterise currently circulating strains.

Integrative taxonomy of Metarhizium anisopliae species complex, based on phylogenomics combined with morphometrics, metabolomics, and virulence data

Metarhizium anisopliae (Clavicipitaceae, Hypocreales) is a globally distributed entomopathogenic fungus, which has been largely studied and used in agriculture for its potent entomopathogenicity. Since its taxonomic establishment as a member of Metarhizium, many closely related taxa have been described with highly similar morphology (cryptic species). A holotype specimen of M. anisopliae is not extant, and the ex-neotype strain (CBS 130.71) does not form a monophyletic clade with other strains, up to now, recognized as M. anisopliae sensu stricto. In this study, we have conducted an integrative taxonomic treatment of M. anisopliae sensu lato by including the ex-neotype strain of M. anisopliae, other unknown strains from our collections identified as M. anisopliae s. lat., as well as other known species that have been previously delimited as closely related but distinct to M. anisopliae. By including whole-genome sequencing, morphometric analysis, LC–MS based metabolomics, and virulence assays, we have demonstrated that M. anisopliae s. str. should also include M. lepidiotae (synonym), and that M. anisopliae s. str. differentiates from the other species of the complex by its metabolome and less severe entomopathogenicity. New taxa, namely M. hybridum, M. neoanisopliae and M. parapingshaense spp. nov., are proposed. The novel taxa proposed here have strong phylogenomics support, corroborated by fine-scale differences in the length/width of conidia/phialides, while the metabolomics and virulence data still largely overlap. We have also demonstrated via population genomics data the existence of local clonal lineages, particularly the one corresponding to the persistence of a biocontrol candidate strain that has been used in the field application for three years. This study showcases the utility of combining various data sources for accurate delimitation of species within an important group of fungal biocontrol agents against pest insects.

Whole genome analysis of Salmonella Gallinarum strains isolated from a fowl typhoid outbreak in southern Brazil

ABSTRACT 1. Salmonella Gallinarum strains isolated from a southern Brazil fowl typhoid outbreak were subjected to phenotypic and genotypic analyses to identify genetic elements that could improve prevention and control strategies. 2. Whole-genome sequencing revealed the presence of the aac(6’)-Iaa gene, conferring aminoglycoside resistance, along with novel chromosomal point mutations, including the first detection of parE p.S451F in Salmonella Gallinarum. 3. Additionally, IncFII(S) plasmid replicons, Salmonella pathogenicity islands and 105 virulence genes associated with cell adhesion, invasion and antimicrobial peptide resistance were identified. 4. These findings shed light on the molecular mechanisms of fowl typhoid and provide crucial insights into emerging antimicrobial resistance and virulence factors.

Molecular characterization of clinically isolated Pseudomonas aeruginosa with varying resistance to ceftazidime-avibactam and ceftolozane-tazobactam collected as a part of the ATLAS global surveillance program from 2020 to 2021.

Ceftazidime-avibactam (CZA) and ceftolozane-tazobactam (C/T) are important agents for treating multidrug-resistant P. aeruginosa infections. In this study, we evaluated the molecular characteristics of 300 globally collected clinical P. aeruginosa isolates non-susceptible (NS) to CZA, C/T, or both agents. Isolates were CZA-NS and C/T-NS (n = 57), CZA-susceptible (S) and C/T-NS (n = 145), or CZA-NS and C/T-S (n = 98) selected from the Antimicrobial Testing Leadership and Surveillance (ATLAS) surveillance program from 2020 to 2021. Characterization was by whole-genome sequencing. Analysis was performed to identify β-lactamase genes and mutations that impact efflux regulation, AmpC regulation, and target binding (PBP3). Of the 57 CZA-NS+C/T-NS isolates, 64.9% carried a metallo-β-lactamase (MBL), and a cumulative 84.2% carried any non-intrinsic β-lactamase [i.e., not Pseudomonas-derived cephalosporinase (PDC) or OXA-50-like]. Of the 145 CZA-S+C/T-NS isolates, 26.2% carried an extended-spectrum β-lactamase (ESBL) and no carbapenemase, 17.9% carried a serine-carbapenemase, and 42.1% were negative for non-intrinsic β-lactamases. Of 98 CZA-NS+C/T-S isolates, 34.7% carried mutations previously described as causing an upregulation of the MexAB-OprM efflux pump, while only 9.2% carried a non-intrinsic β-lactamase, and no resistance mechanism was identified in 29.6% of these isolates. MBLs were present in most isolates NS to both agents. More than half of the CZA-S+C/T-NS isolates carried serine β-lactamases. The most frequently identified resistance mechanism identified in CZA-NS+C/T-S isolates was a marker indicating the upregulation of MexAB-OprM. No mechanism was identified that is thought to support resistance to these agents in numerous isolates. This may be due in part to the fact that whole genome sequencing (WGS) cannot directly measure gene expression of chromosomal resistance mechanisms.

Population genomic evidence of a putative ‘far-west’ African cryptic taxon in the Anopheles gambiae complex

The two main Afrotropical malaria vectors - Anopheles coluzzii and An. gambiae – are genetically distinct and reproductively isolated across West Africa. However, populations at the western extreme of their range are assigned as “intermediate” between the two species by whole genome sequence (WGS) data, and as hybrid forms by conventional molecular diagnostics. By exploiting WGS data from 1190 specimens collected across west Africa via the Anopheles gambiae 1000 Genomes network, we identified a putative taxon in the far-west (provisionally named Bissau molecular form), which did not arise by admixture but rather may have originated at the same time as the split between An. coluzzii and An. gambiae. Intriguingly, this taxon lacks insecticide resistance mechanisms commonly observed in the two main species. These findings lead to a change of perspective on malaria vector species in the far-west region with potential for epidemiological implications, and a new challenge for genetic-based mosquito control approaches.

Genomic Analysis of Enterobacter Species Isolated from Patients in United States Hospitals

We analyzed the whole genome sequences (WGS) and antibiograms of 35 Enterobacter isolates, including E. hormaechei and E. asburiae, and the recently described E. bugandensis, E. kobei, E. ludwigii, and E. roggenkampii species. Isolates were obtained from human blood and urinary tract infections in patients in the United States. Our goal was to understand the genetic diversity of antimicrobial resistance genes and virulence factors among the various species. Thirty-four of 35 isolates contained an AmpC class blaACT allele; however, the E. roggenkampii isolate contained blaMIR-5. Of the six Enterobacter isolates resistant to ertapenem, imipenem, and meropenem, four harbored a carbapenemase gene, including blaKPC or blaNDM. All four isolates were mCIM-positive. The remaining two isolates had alterations in ompC genes that may have contributed to the resistance phenotype. Interpretations of cefepime test results were variable when disk diffusion and automated broth microdilution results were compared due to the Clinical Laboratory and Standards Institute use of the “susceptible dose-dependent” classification. The diversity of the blaACT alleles paralleled species identifications, as did the presence of various virulence genes. The classification of recently described Enterobacter species is consistent with their resistance gene and virulence gene profiles.

The complete genomic sequencing of a Klebsiella pneumoniae isolate derived from the blood of a patient suffering from severe neurological problems in Zhengzhou, China.

This study presents the comprehensive analysis of the genomic sequence of Klebsiella pneumoniae strain FAHZZU7042hy, having a 5,690,191 bp chromosome size. This strain was obtained from a blood sample of a patient suffering from severe neurological problems in Zhengzhou, China, 2023.

Pathogenic and genomic characterization of Ostreid herpesvirus 1 associated with mass mortalities of blood cockle (Anadara kagoshimensis)

Ostreid herpesvirus 1 (OsHV-1) is an infectious viral disease of bivalve mollusks with a wide geographic distribution across five continents. Since its initial identification in 1991, the disease has been identified as the cause of mortality in more than ten species of bivalve mollusks. The transmission of OsHV-1 is thought to be facilitated by water. In 2019 and 2021, mass mortalities of blood cockle (Anadara kagoshimensis) hatchery broodstock associated with OsHV-1 infection were reported. The presence of OsHV-1 DNA was confirmed in all hatchery samples with levels exceeding 106 copies per milligram of DNA. OsHV-1 was not detected in the wild populations from which the broodstock was collected, indicating that the virus was introduced into the hatchery with seawater from the open ocean. The results of the histopathological examination indicated that tissue lesions and associated hemocyte infiltration were most prevalent in the connective tissues of the digestive tract, mantle, gills and foot of the diseased A. kagoshimensis. In situ hybridization (ISH) signals of OsHV-1 DNA were frequently observed in infiltrated hemocytes, putative fibroblasts, and on occasion, in muscle cells with weak staining. Transmission electron microscopy analysis demonstrated the presence of herpes-like viral particles within the nucleus of infected cells. The genomes of the OsHV-1 variants from cases 2019 and 2021 were successfully resolved through direct high-throughput sequencing of infected tissues. A phylogenetic analysis of the complete genome sequences of 32 OsHV-1 variants revealed that the segregation of the virus was primarily structured by host species and geographic origin, with some exceptions. We propose that the sympatric distribution of different host species and the potential occurrence of cross-species transmission of OsHV-1 are responsible for the inconsistency between the phylogenetic segregation and their host species. This is the first report on the pathogenic and genomic characterization of OsHV-1 infecting A. kagoshimensis. The epidemiological and phylogenetic analyses offer new insights into the evolution of the virus and provide valuable information for the prevention and control of the disease.

Anthrax in the Russian Federation in 2023 or in other words, «the same old story»

Introduction. The current anthrax situation in Russia is characterized by instability. In 2023, there was an increase in the number of infection outbreaks compared to the long-term average (for five years). The aim of the study is to assess the epizootological and epidemiological situation regarding anthrax in the Russian Federation in 2023 and the reasons for its deterioration, and to analyze data from genomic epidemiological surveillance of this infection. Materials and methods. The information of the territorial bodies of Rospotrebnadzor on the investigation of anthrax outbreaks, reference materials about anthrax stationary hazardous areas and anthrax burials were used. The phylogenetic position of the identified Bacíllus anthracis strains and genomes structure were determined based on whole-genome sequencing data. Results. In 2023 anthrax outbreaks were registered in the Chuvash Republic — Chuvashia (1), the Tyva Republic (1), Tambov (1), Ryazan (1) and Voronezh (3) regions. 14 farm animals and 19 people fell ill. The infection of animals not vaccinated against anthrax, as well as vaccinated long before contact with the source of infection, occurred mainly during grazing in the territories of old (unregistered) anthrax soil foci. Human disease is caused by contact with sick animals during care, forced slaughter, cutting, transportation of carcasses and meat, cooking processing of contaminated meat and offal, and consumption of insufficiently heat-treated liver. 17 patients were diagnosed with a cutaneous form of anthrax, while 2 had an oropharyngeal form combined with a cutaneous form of the disease. In all cases, the genome structure typical of the B. anthracis species has been established. The phylogenetic relationship of B. anthracis isolates with B. anthracis strains previously isolated in Russia is shown. Conclusion. The reason for the trouble in anthrax in 2023 was a number of violations of veterinary and sanitary-epidemiological regulations against the background of the presence of soil foci of infection. Stabilization of the situation can be achieved only in full range of regulated preventive measures are constantly implementated. The results of molecular genetic typing of B. anthracis strains isolated during the epidemiologic investigation of seven anthrax outbreaks in the Russian Federation in 2023 allow us to conclude that they are of local origin and have a genome structure typical of the species. Genetic analysis of the isolated strains demonstrated the effectiveness of the developed wgSNP typing system in the epidemiologic investigation of outbreaks.