Commercial Melon Research Articles

Standardized sampling plan for common blossom thrips management in melon fields from north Brazil

Common blossom thrips, Frankliniella schultzei (Thysanoptera: Thripidae), is one of the major pests of melon (Cucumis melo L.), causing yield losses of up to 40%. Frankliniella schultzei is widely distributed in the world, especially in tropical and subtropical regions. Sampling plans are one of the pillars of integrated pest management (IPM) programs. Despite the economic importance of F. schultzei, to our best knowledge, this is the first study to establish a standardized sampling plan for this pest in melon fields. Studies were conducted in 23 commercial melon fields during two years to determine the appropriate sampling system (sample unit, method and sampling size). For all plant growth stages (vegetative, flowering and fruiting), the apex (first) leaf of melon branches was the ideal sampling unit, and direct counting of thrips was the most suitable method for F. schultzei monitoring. The sampling size was calculated using the formula described for the negative binomial distribution (the prevailing frequency distribution) and applying error levels of up to 25%. With one sample consisting of counting the number of F. schultzei on the apex leaf of one branch (randomly selected) on one plant at the 20% error, 70 samples were required, providing the best cost-precision relationship. For varying field sizes (1- to 20-ha melon fields), total sampling time ranged from 25 to 59 min, costing USD 0.83 and USD 1.90, respectively. The developed sampling plan is reliable and should be easy to implement in IPM programs in melon fields under varying crop systems (different field sizes and plant stages) in north Brazil.

Melon Growing Industry Analysis in Modern Economic Conditions

The purpose of this study is to analyze the development of the melon cultivation industry in the world and in Russia in the context of globalization and economic integration. Systematic and comparative analyzes of information and statistical data of the Russian Federation and the United Nations were used in the research. Despite the fact that Russia has significant soil and climatic resources for the production of melons and gourds, the crop productivity is almost three times lower than the world average. The main areas of commercial melon cultivation in Russia are highlighted. Data on the main indicators are given (crop productivity, land under cultivation and gross output) for the regions of the Russian Federation and the districts of the Volgograd region. The analysis findings are the identification of the main trends in the development of Russian melon cultivation industry. The main ways to increase the gross output of melons and gourds are outlined. An increase in crop productivity is one of the reserves for growth in the production of food melons and gourds. The determining factor for a high and stable productivity of melons and gourds is the creation and introduction of high-quality varieties and hybrids of intensive type crops into production, as well as the use of new agricultural techniques.

Development of SNP markers and validation assays in commercial Korean melon cultivars, using Genotyping-by-sequencing and Fluidigm analyses

Melon is an important horticultural crop across the globe, which consisted of several subspecies. Single nucleotide polymorphisms (SNPs) are the most preferred molecular markers in genetic diversity and genomic studies. Recently, Genotyping-by-sequencing (GBS) has produced sequences that detect genome-wide distribution of these SNP markers. In this study, we identified genome-wide highly efficient SNP markers to differentiate the cultivars of the melon using GBS. Here we detected 9018 SNPs by the analysis of 48 commercialized Korean melon cultivars, which released by various seed companies in South Korea. Further, precise filtering resulted in 5644 high-quality SNPs. Of these, 5293 SNPs and 351 were identified in the genic region and intergenic region, respectively. A total of 192 SNPs were identified as putative SNPs, on the basis of high polymorphism information content (PIC) and physical distance. These SNPs were further analyzed to distinguish 95 commercial melon cultivars via high-throughput Fluidigm system, thus revealed 95.83 % (184 SNPs) of validation ratio. The summary of SNP genotyping revealed estimates of PIC ranged from 0.02 to 0.53 and 179 SNPs (97.28 %) showed more than 0.3 of PIC. This is the first study in melon to develop and validate genome-wide SNP markers using GBS and Fluidigm platform, respectively. The SNP markers reported in this study will be a valuable tool for cultivar identification, genetic diversity, and marker-trait association studies in melon.

Chronic oral exposure to field-realistic pesticide combinations via pollen and nectar: effects on feeding and thermal performance in a solitary bee

Pesticide use is one of the main causes of pollinator declines in agricultural ecosystems. Traditionally, most laboratory studies on bee ecotoxicology test acute exposure to single compounds. However, under field conditions, bees are often chronically exposed to a variety of chemicals, with potential synergistic effects. We studied the effects of field-realistic concentrations of three pesticides measured in pollen and nectar of commercial melon fields on the solitary bee Osmia bicornis L. We orally exposed females of this species throughout their life span to 8 treatments combining two neonicotinoid insecticides (acetamiprid, imidacloprid) and a triazole fungicide (myclobutanil) via pollen and sugar syrup. We measured pollen and syrup consumption, longevity, ovary maturation and thermogenesis. Although bees consumed larger amounts of syrup than pollen, pesticide intake via syrup and pollen were similar. At the tested concentrations, no synergistic effects emerged, and we found no effects on longevity and ovary maturation. However, all treatments containing imidacloprid resulted in suppressed syrup consumption and drastic decreases in thoracic temperature and bee activity. Our results have important implications for pesticide regulation. If we had measured only lethal effects we would have wrongly concluded that the pesticide combinations containing imidacloprid were safe to O. bicornis. The incorporation of tests specifically intended to detect sublethal effects in bee risk assessment schemes should be an urgent priority. In this way, the effects of pesticide exposure on the dynamics of bee populations in agroecosystems will be better assessed.

Surrounding Vegetation, Climatic Elements, and Predators Affect the Spatial Dynamics of Bemisia tabaci (Hemiptera: Aleyrodidae) in Commercial Melon Fields.

Studying the spatial dynamics of pests allows the determination of abiotic and biotic factors affecting time and locations of pest attack to the crops. Such abiotic and biotic factors mainly include 1) climatic elements, 2) natural enemies, 3) phenological stage of plants, and 4) surrounding vegetation. Melon (Cucumis melo L. [Cucurbitales: Cucurbitaceae]) is among the most consumed fruit in the world, and the whitefly Bemisia tabaci (Gennadius) is among the main pests of this crop. This work aimed to determine the effects of surrounding vegetation, natural enemies, climatic elements, and stages of plants on the spatial dynamics of B. tabaci in commercial melon fields. Adult whitefly densities were monitored on four melon fields in a tropical climate region. Sampling location in crops was georeferenced. Experimental data were submitted to geostatistical analysis. The highest densities of B. tabaci occurred during hot periods experiencing lower rainfall, and when the surrounding area presented crops hosting B. tabaci, especially other melon farms. The density ratio of the predators (i.e., spiders and Geocoris sp.) were dependent on pest density. The pattern of field colonization by B. tabaci varies according to its density. Therefore, the surrounding vegetation, air temperature, and predators influence the spatial distribution of B. tabaci in melon fields. These results provide important information to melon farmers, assisting them to improve the management of B. tabaci in the field.

Phenolic Content and Antioxidant Activity of Extracts of 12 Melon (Cucumis melo) Peel Powders Prepared from Commercial Melons.

Melons are a diverse group of fresh, dessert fruits that includes orange flesh cantaloupe, green flesh honeydew, and mixed hybrid melons. As part of an effort to discover potential health benefits of fruit and vegetable peels that are considered to be byproducts of food processing, we determined the total phenolic content and antioxidative activities of methanolic extracts of the powdered peels of the following commercial melon (Cucumis melo) varieties sold at retail markets in California that were imported from Mexico and Honduras: nonorganic Canary, Charentias, Hani Gold, Vine ripened, and Santa Claus; and organic Ambrosia, Cantaloupe, Galia, Goddess, Ham, Honeydew, and Tuscan. The total phenolic content (in mg gallic acid equivalents/g extract) ranged from 0.69 (Tuscan) to 2.96 (Galia) or 4.3-fold variation from lowest to highest value. The antioxidative activity (in mg ascorbic acid equivalents/mL extract) ranged from 0.13 (organic Tuscan) to 0.26 (organic Galia). Similar results were observed using the ABTS antioxidative assay. The content of the phenolic and flavonoid compounds 3-hydroxybenzoic acid, chlorogenic acid, neochlorogenic acid, isovanillic acid, apigenin-7-α-glucoside, luteolin-7-o-glucoside, and quercetin-3-galactoside in three melon flesh samples (nonorganic and organic Galia from Honduras and organic Galia from Mexico and two peel samples (Mexican organic peel and flesh) were analyzed using HPLC. The results suggest that the peel from the Honduran Galia melon with the highest antioxidative activity merits further study to investigate potential health properties. Potential nutritional and health benefits of melon peels, Seeds, and their bioactive compounds are discussed. PRACTICAL APPLICATION: The peel from the Honduran Galia melon variety merits further study for potential health benefits, including antioxidative, anticholesterol, and antidiabetic activities, and stimulation of thyroid function, as reported for peels from other melon varieties, as well as antibiotic activities against pathogenic bacteria, protozoa, and viruses.

Volatile Organic Compounds Role in Selective Pollinator Visits to Commercial Melon Types

Pollination is essential for food production in the world, but in pollinator-dependent crops it relies on the attraction of pollinators to flowers. However, crop varieties vary in their attractiveness to flower visitors and volatile compounds emitted by flowers may play a significant role in attracting or repelling pollinators. Here, we investigated the volatile organic compounds (VOCs) present in both male and hermaphrodite flowers of five commercial types of melon Cucumis melo (Cantaloupe, Charentais, Galia, Piel de sapo and Yellow), and their role in attracting or repelling Apis mellifera foragers. We found significant variation in the identity and proportion of these chemical compounds produced by both melon types and flower genders and observed significant positive and negative correlations between the amount of D-Limonene and Benzaldehyde (bee attractants) and α-Pinene (bee repellent), respectively, to the number of bee visits to flowers particularly in the Cantaloupe type and hermaphrodite flowers, the most visited ones. Our results suggest that differences in the composition of melon floral VOCs and the proportion of the different compounds play significant role in the number of visits by A. mellifera with possible implications to pollination and fruit yield. It also implies to the perspective of breeding varieties more attractive to pollinators through the selection of flower lines richer in bee-attractant and/or poorer in bee-repellent volatiles.

Effect of Red LED Irradiation Setting in Commercial Melon Green House to Control Melon Thrips Thrips palmi

Effect of Red LED Irradiation Setting in Commercial Melon Green House to Control Melon Thrips <i>Thrips palmi</i>

Predator Insect Families Associated With Melon Crop in a Semiarid Region in Brazil

Knowledge of diversity of natural enemies in agroecosystems is vital for the integrated pest management. However, surveys of beneficial insects (predators and parasitoids) in the melon crop (Cucumis melo L.) in the semiarid region in Brazil are scarce. Thus, the objective of this study was to know the families of predator insects associated with melon crop in a semiarid region in the state of Rio Grande do Norte (RN), one of the main melon producers in Brazil. The survey study was carried out in a commercial melon area, in the municipality of Bara&amp;uacute;na (RN). The samples were collected weekly during the cycle of melon, using passive (Pitfall and Moericke traps) and active (sweep net) collection methods. A total of 13 families of predator insects were collected. The families with the highest relative abundances in the passive collection method were Labiduridae (89.53%) and Formicidae (6.91%), while in the active collection method were Chrysopidae (59.81%) and Staphylinidae (20.56%). These families contain important species of predator which can promote crop pest suppression in melon agricultural systems.

Biostimulant Activity of Trichoderma saturnisporum in Melon (Cucumis melo)

Trichoderma-based biostimulants are considered the most effective plant growth–promoting fungi. The purpose of this study is to determine the effect of two Trichoderma saturnisporum isolates on the growth promotion of melon (Cucumis melo) seeds and seedlings as well as their effect on the performance of the cantaloupe “Charentais” melon crop cultivar Gandalf cultivated under a typical parral-type greenhouse. For these purposes, germination trials and two experiments were performed in a commercial nursery, conventional system, and large plant system. Two experiments were also established for 2 years (two crop cycles) in a commercial greenhouse in Almería, Spain. In addition, we evaluated the influence of these isolates (T1 and T2) on the Charentais melon yield and quality. High values for seedling vigor and root length were obtained by T. saturnisporum T1 (93.50%) and T2 (93.75%) against control (62%). Trichoderma saturnisporum T1 and T2 increased the quality of plants in conventional system and large plant system and can be considered as biostimulant. Trichoderma saturnisporum treatments resulted in significantly larger crop productivity without a negative effect on the fruit quality parameters. Melon productivity increased in T. saturnisporum treatments T1 (13.99%) and T2 (16.04%), while at the same time increases the average fruit weight up to 7.71% for T2 isolate. Trichoderma saturnisporum act as biostimulants for nursing and commercial melon crops without negative effects on fruit quality. This is the first report describing T. saturnisporum as a potential crop yield promoter.

GRAFTING TECHNIQUE ONTO CUCURBIT ROOTSTOCKS FOR CONTROL SOIL BORN DISEASES AND ENHANCE THE PRODUCTIVE BEHAVIOR FOR MELON (CUCUMIS MELO) IN EGYPT

Two experiments were conducted at two successive seasons 2015/2016 and 2016/2017 during the activity of the project Grafting techniques to improve production and to solve the problems in under plastic greenhouse by supporting the Agriculture Development Programme in Egypt. The first experiment was conducted to evaluate two melon cultivars i.e., Hybrid London (Galia type) and Hybrid Magd (Ananas type) and eight cucurbit rootstocks for their resistance and/or susceptibility to soil borne diseases such as (Fusarium oxysporum and Verticillium albo-atrum) which considered the most serious pathogens that cause soil born diseases on melon crop. The data revealed that the Squash No3, Super Shintoza, Coplt, FliexFort, Ferro RZ, and Nun 6001 rootstocks were resistant to the F. oxysporum and V. albo-atrum pathogens in infested and non-infested soil except Pakistani luffa rootstock which was susceptible to the two pathogens. Moreover Squash No3, Ferro RZ, and Nun 6001 rootstocks are considered the highly resistant to F. oxysporum while Squash No3, FliexFort and Nun 6001 rootstocks are considered highly resistant to Verticillium albo-atrum. On the other hand the two tested melon varieties {Hybrid London and Hybrid Magd} were highly susceptible to the previous pathogens. The second experiment was conducted to compare between the effects of the previous resistant rootstocks and between three grafting methods (hole insertion grafting, splice grafting and tongue-approach grafting) on melonplant growth and yield components of Hybrid London compared with non-grafted plants which used as control. The highest success rate of grafted melon seedlings was recorded by tongue-approach grafting method followed by hole insertion grafting method. Moreover, the plants survival rate, vegetative growth characteristics (stem length, leaves number and shoot fresh weights), of grafting melon seedlings varied depending on grafting methods, rootstocks and the combination between grafting methods and rootstocks and difference between scion and rootstocks hypocotyls . The data revealed that the grafting onto Squash No3, Super Shintoza, Coplt, FliexFort, Ferro RZ and Nun 6001 rootstocks are suitable method for commercial melons production under greenhouse conditions in Egypt by provides sufficient protection against Fusarium oxysporum and Verticillium albo-atrum especially. This result due to the survival rate of plants grafted onto these rootstocks was extremely high. Moreover, the grafting melon seedlings by hole insertion and splice grafting methods onto FliexFort, Ferro RZ and Nun 6001 gave vigour growth, higher yield under greenhouse conditions without exhibiting any detrimental effects on melon fruit quality of the Hybrid London cultivar.

First Report of Melon necrotic spot virus in Melon Plantations in Brazil

HomePlant DiseaseVol. 102, No. 5First Report of Melon necrotic spot virus in Melon Plantations in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Melon necrotic spot virus in Melon Plantations in BrazilM. C. F. Moura, I. S. A. Holanda, R. Sales Júnior, A. P. O. Queiroz, E. O. A. Araújo, G. D. C. Oliveira, G. H. S. Nunes, T. Nagata, and A. M. P. NegreirosM. C. F. MouraSearch for more papers by this author, I. S. A. Holanda†Corresponding author: I. S. A. Holanda; E-mail: E-mail Address: [email protected]Search for more papers by this author, R. Sales JúniorSearch for more papers by this author, A. P. O. QueirozSearch for more papers by this author, E. O. A. AraújoSearch for more papers by this author, G. D. C. OliveiraSearch for more papers by this author, G. H. S. NunesSearch for more papers by this author, T. NagataSearch for more papers by this author, and A. M. P. NegreirosSearch for more papers by this authorAffiliationsAuthors and Affiliations M. C. F. Moura I. S. A. Holanda † R. Sales Júnior A. P. O. Queiroz E. O. A. Araújo G. D. C. Oliveira G. H. S. Nunes , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil T. Nagata , Department of Cellular Biology, University of Brasília, 70910-900, DF, Brazil A. M. P. Negreiros , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil. Published Online:6 Mar 2018https://doi.org/10.1094/PDIS-09-17-1391-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Melon necrotic spot virus (MNSV) is a carmovirus that causes necrotic spots on melon plants and is transmitted by fungi of the genus Olpidium. In Brazil, the major melon fields are located in the states of Rio Grande do Norte (RN) and Ceará (CE). Different types of virus-like symptoms (necrotic streaks at the base of the stem and vine decline) were observed in commercial fields and infection by MNSV was suspected by symptomatology. To determine the presence of MNSV, soil samples were collected from 10 commercial fields with MNSV-like symptoms from both states in 2012. These samples were processed at the Plant Pathology Laboratory of the Federal Rural University of the Semiarid (UFERSA), Mossoró, RN. The soil samples were placed in plastic trays, and exposed in open air for a week to dry. Then, soil samples were sieved and subsequently used for planting yellow-skin melon (cv. Goldex, a major cultivar in the region). Seeds were pretreated at 70°C for 144 h with a photoperiod of 16 h and relative humidity of approximately 15% (Herrera-Vásquez et al. 2009). The seeds were placed in a Petri dish to germinate, with filter paper and distilled-autoclaved water. Seedlings were planted in a plastic pot containing a mixture of the collected soils in addition to autoclaved sand (1:10 soil/sand ratio). These plants were maintained for 30 days in the greenhouse, with temperature ranging from 25 to 30°C and relative humidity of 60%. RT-PCR for the detection of MNSV was performed using specific primers (MNSV3F - CAGGGAAATCCTAGAATACAG and MNSV4R - ATTAATGCGTCTAACCATCG) (Herrera-Vásquez et al. 2010). Although the seedlings did not present any symptoms of MNSV, RT-PCR confirmed the presence of MNSV in five out of 30 samples in three out of 10 commercial melon fields. For further confirmation, cDNA fragments of five samples amplified by RT-PCR were directly sequenced by the Sanger method and the amplified 7A/7B protein genomic region of 385 nt showed 100% identity among the five samples used (deposited under accession no. LC318764). The obtained sequence showed the highest identity of 97% with a Spanish MNSV isolate (FJ621526). Therefore, soils collected in the states of RN (two samples) and CE (three samples), Brazil, analyzed in this study, showed the presence of MNSV. This is the first report of the occurrence of MNSV in Brazil.

BOTANICAL IDENTIFICATION AND GENETIC DIVERSITY IN MELONS FROM FAMILY FARMING IN THE STATE OF MARANHÃO

ABSTRACT The aim of this work was to perform botanical identification and to estimate genetic diversity in two sequential inbred generations (progenies S1 and S2) of melon accessions from traditional agriculture in the state of Maranhão, in order to generate useful information for commercial melon breeding. Two field experiments were carried out in a completely randomized block, using four replicates of 15 accessions from a first selfing cycle in 2013, and three replicates of 25 subaccessions (generation S2) in 2014. Flower and fruit descriptors were measured to obtain quantitative and qualitative data, in addition to a systematized photographic documentation of fruit for visually comparing the progenies S1 and S2. Distance matrices for quantitative and qualitative data were obtained and used to perform a joint analysis and UPGMA method. Large genetic diversity was found in the accessions analysed, since the presence of melon progenies was observed in the Cucumis melo ssp. agrestis, with its botanical varieties momordica and conomom, and of the Cucumis melo ssp. melo, with the botanical varieties cantalupensis and chandalak. Divergence analysis showed the formation of three groups in generation S1 and four groups in S2. However, the groups were not separated either by subspecies or by botanical variety. Thus, in addition to the large genetic diversity among and within melon accessions from family farming in the state of Maranhão, the progenies presented a large introgression of traits of the different subspecies and their botanical varieties due to the reproductive system and seed management of these species.

Scanning Electron Microscopy study of root tissue of muskmelon: Transferring Fusarium wilt resistance from snapmelon to muskmelon

The overall aim of this study was to investigate the level of Fusarium oxysporum f. sp. Melonis (F.o.m.) infection by studying the Scanning electron micrographs of transverse sections of parent inbred lines and developed F1 hybrid. The current study involved KP4HM-15 (Fusarium wilt resistant inbred line) in a crossing program with well adapted muskmelon cv. Punjab Sunehri (PS) to develop FW resistant hybrid possessing high yield and quality traits. Fom infects melon root and trails through the cortical and endodermal cells to reach xylem vessels by penetrating through pits. This is the first SEM appraisal of the whole tap root of field grown melon accessions, KP4HM-15, PS and PSxKP4HM-15 (MH-41) (F1 hybrid) aimed to discern the role of the root morphometric characters for imparting FW resistance. The trend for root epidermo-cortical thickness was KP4HM-15&gt;PS&gt;MH-41 while for the xylem diameter was MH-41&gt; KP4HM-15&gt;PS. The F1 hybrid exhibited FW resistance intermediate among the two parents i.e. absence or presence of less mycelia as compared to the susceptible parent (PS). However, the extent of infection was higher than the resistant parent KP4HM-15, which shows that partial resistance was transferred from KP4HM-15 to MH-41. This study accentuates the resistance gene mining and use of wild melon accessions to introgress FW resistance in commercial melon cultivars.

Resistance to tomato leaf curl New Delhi virus in melon is controlled by a major QTL located in chromosome 11.

Identification of three genomic regions and underlying candidate genes controlling the high level of resistance to ToLCNDV derived from a wild melon. SNP markers appropriated for MAS management of resistance. Tomato leaf curl New Delhi virus (ToLCNDV) is a bipartite begomovirus that severely affects melon crop (Cucumis melo) in the main production areas of Spain since 2012. In this work, we evaluated the degree of resistance of four accessions (two belonging to the subsp. agrestis var. momordica and two to the wild agrestis group) and their corresponding hybrids with a susceptible commercial melon belonging to the subsp. melo (Piel de Sapo, PS). The analysis using quantitative PCR (qPCR) allowed us to select one wild agrestis genotype (WM-7) with a high level of resistance and use it to construct segregating populations (F 2 and backcrosses). These populations were phenotyped for symptom severity and virus content using qPCR, and genotyped with different sets of SNP markers. Phenotyping and genotyping results in the F 2 and BC1s populations derived from the WM-7×PS cross were used for QTL analysis. Three genomic regions controlling resistance to ToLCNDV were found, one major locus in chromosome 11 and two additional regions in chromosomes 12 and 2. The highest level of resistance (no or mild symptoms and very low viral titer) was obtained with the homozygous WM-7WM-7 genotype at the major QTL in chromosome 11, even with PSPS genotypes at the other two loci. The resistance derived from WM-7 is useful to develop new melon cultivars and the linked SNPs selected in this paper will be highly useful in marker-assisted breeding for ToLCNDV resistance in melon.

Evaluation of two potentialCucumisspp. resources for grafting melons

Cultivation of Cucumis melo is hampered by soil stresses. Grafting is used to overcome these limitations. Different cucurbits belonging to several genera have been used as rootstocks for melons: Cucurbita, Lagenaria, Luffa, etc. However, negative effects on fruit quality appear in some rootstock-scion combinations. The selection of new resistant rootstocks that do not cause this negative impact in quality is necessary to improve melon cultivation. In this work, we evaluated two rootstocks, closer genetically to melon scions than those usually employed: a) an F1 hybrid between a commercial melon (C. melo subspecies melo var. inodorus market class Piel de Sapo) and one exotic accession (C. melo subspecies agrestis var. chinensis) with resistance to Monosporacus cannonballus, the causal agent of melon vine decline, and with a certain level of tolerance to Fusarium oxysporum f. sp. melonis race 1.2, that causes Fusarium wilt, and b) an accession of Cucumis metuliferus, highly resistant to M. cannonballus, F. oxysporum 1.2 and evaluated and classified as highly resistant to Meloidogyne spp. in this work. Grafting compatibility of these two selected genotypes with commercial melons was good. All grafted plants displayed higher vigour and earlier flowering than ungrafted plants. Fruits from plants grafted onto C. metuliferus showed similar quality than those from ungrafted/selfgrafted plants. However, fruits from plants grafted onto the F1 (inodorus × chinensis) had in this experiment lower brix degree than the ungrafted controls. The resistance to soil borne pathogens found in C. metuliferus and the good performance regarding plant development and fruit quality of the scions indicate that this species is a promising rootstock for melons.

Erratum to: Mechanical transmission of Tomato leaf curl New Delhi virus to cucurbit germplasm: selection of tolerance sources in Cucumis melo

Cucurbits are major crop species, including fruits and vegetables cultivated worldwide that supply essential vitamins and minerals to current diets in developed and developing countries. Viral diseases are main factors affecting cucurbits cultivation. The most widespread and damaging have been aphid-borne viruses belonging to the Potyviridae family. Whitefly-transmitted begomoviruses (Geminiviridae) have been identified more recently in different cucurbit species. A severe outbreak of Tomato leaf curl New Delhi virus (ToLCNDV) occurred in pumpkins and melons in the main production area of Southern Spain in 2012–2014. We developed a mechanical inoculation method to facilitate the screening of germplasm against this virus. Mechanical transmission with this method was confirmed in 4 genera and 13 species of the family, including the main crops, cucumber, melon, watermelon and pumpkins, and also crop-related exotic germplasm (landraces and wild species) used for cucurbits breeding. Diversity in the response was observed within and among species. Tolerance to mechanical transmission of ToLCNDV was identified in melon, within Cucumis melo subsp. agrestis var. momordica and in wild agrestis accessions. All the tolerant accessions came from India, the country in which this virus was firstly reported. Some of these accessions have been previously reported to be tolerant or resistant to other viruses and as they are fully crossable to commercial melons, they are good sources to develop new melon varieties with tolerance to ToLCNDV.

Identification of fungal races that cause powdery mildew in melon (Cucumis meloL.) and selection of resistant commercial melon cultivars against the identified races in Korea

국내 멜론 및 박과채소 재배농가(안성, 이천, 영암, 창녕, 순천)에서 발병하고 있는 멜론 흰가루병균을 채집한 후 흰가루병균의 형태학적 특성을 이용한 종류 구분 및 멜론 race 판별계통을 이용한 국내에서 발병하고 있는 흰가루병균의 race를 확인하였다. 그 결과 국내 멜론 흰가루병균의 종류는 Podosphaera xanthii (syn. Sphaerotheca fuliginea) 였으며, 기존에 보고된 race 1, N2, A와 판별결과가 일치하는 3 종류의 균주가 분리되었다. 또한 기존에 보고된 race (1, N1, N2, A, S, 5)와 검정 결과가 다른 새로운 race의 흰가루병균 2종이 동정되었다. 그리고 5개의 분리 및 동정된 흰가루병균을 이용하여 국내 시판중인 멜론 15품종에 대한 저항성을 조사한 결과, race1에 대해서는 15품종 중 9품종이 저항성을 보였다. Race N2와 A대해서는 소수의 품종에서 저항성을 보였으며, 새로운 race BN968에서는 15품종 모두가 이병성을 나타내었다. 또한 멜론 흰가루병 race 1 저항성 DNA 마커 KPMR1M-1과 KPMR1M-2에 의한 이병성 및 저항성 판별 결과와 race 1 접종 결과는 일치하였다. 따라서 국내 멜론 품종 육종에 있어서 다양한 race 특이적 마커 개발 및 이를 활용한 복합 race 저항성 품종 개발이 요구된다.

Indexing melon physiological decline to fruit quality and vine morphometric parameters

While grafting cucurbits has become essential in the management of soil borne diseases and for improving performance under conditions of abiotic stress, commercial melon grafting has been curbed by the incidence of non-pathological decline, usually expressed right before harvest and attributed to physiological scion-rootstock incompatibility. The current study investigated the potential indexing of physiological incompatibility to plant performance, vine morphometric parameters and fruit physicochemical characteristics. Graft combinations sensitive to physiological incompatibility (scions: melon cvs. Elario, Polynica and Raymond; rootstocks: interspecific hybrids ‘TZ148’, ‘N101’, ‘Carnivore’ and ‘30900’) were grown between February and May in a disease-free soil environment. Results indicate that plant collapse shortly before harvest is a onetime event that does not necessarily reflect on the performance of the asymptomatic, surviving plants. However, a negative rootstock effect on scion dry weight was indicative of rootstock-scion combinations subject to incompatibility and prone to decline. The attenuation of the 1st internode’s diameter relative to the hypocotyl’s (‘Elario’ 29.1%; ‘Raymond’ 41.5%; ‘Polynica’ 44.0%) and the loss of mesocarp firmness reflected the categorical sensitivity of the scions to physiological decline. No systematic pattern was identified connecting fruit soluble carbohydrate (fructose, glucose and sucrose) content to physiological incompatibility and plant decline. However, earliness of harvest maturity, pronounced in sensitive climacteric scions ‘Polynica’ and ‘Raymond’, may relate to ethylene-mediated comprehensive acceleration of ripening stressing rootstock-scion synergy to collapse.

Development of Efficient Screening Methods for Melon Plants Resistant to Fusarium oxysporum f. sp. melonis

본 연구는 덩굴쪼김병균(Fusarium oxysporum f. sp. melonis)에 대한 저항성 멜론의 효율적인 검정법을 확립하기 위하여 수행하였다. 고령에서 채집한 덩굴쪼김병이 발생한 멜론으로부터 GR 균주를 분리하였으며, 형태학적 및 분자생물학적 동정 방법에 의해 그리고 오이, 멜론, 참외, 수박의 박과 작물에 대한 기주 특이성 조사를 통하여 GR 균주는F. oxysporum f. sp. melonis로 동정되었다. 그리고 4종 덩굴 쪼김병 race 판별품종들의 저항성 반응에 따라 GR 균주는 race 1임을 알 수 있었다. GR 균주의 접종원(소형분생포자) 대량생산을 위해서는 실험한 6종 액체배지 중 V8-juice broth에서 가장 많은 포자가 형성되었다. 시판 중인 22개의 멜론 품종과 6개 멜론 재배용 대목 품종의 GR 균주에 대한 저항성의 정도를 실험하였다. 실험한 멜론 품종 중 3개 품종을 제외한 모든 품종은 다양한 정도의 저항성을 보였다. 그리고 실험한 대목 품종들 모두에서는 덩굴쪼김병이 전혀 발생하지 않았다. 실험한 멜론 품종 중 GR 균주에 대한 저항성 반응에 차이를 보이는 6개 품종('레드퀸', '썸머쿨', '슈퍼세지', '아시아파파야', '얼룩파파야', '아시아황금')을 선발하여 멜론 생육시기, 뿌리 상처, 침지 시간, 접종원 농도 및 재배 온도 등의 발병 조건에 따른 덩굴쪼김병 발생을 조사하였다. 이들 실험의 결과로부터 멜론 품종들의 덩굴쪼김병에 대한 저항성을 검정하기 위해서는 멜론 종자를 파종하고 온실(<TEX>$25{\pm}5^{\circ}C$</TEX>)에서 7일 동안 재배한 유묘(떡잎 시기)를 뽑아 흙을 제거하고 뿌리 자르기와 같은 상처를 내지 않고 멜론 유묘의 뿌리를 <TEX>$3{\times}10^5conidia/mL$</TEX> 농도의 F. oxysporum f. sp. melonis 포자현탁액에 30분 정도 침지하여 접종하고, 이를 새로운 토양에 이식하고 <TEX>$25-28^{\circ}C$</TEX>에서 약 3주일 동안 재배하는 것이 가장 효율적인 방법임을 알 수 있었다. This study was conducted to establish an efficient screening system to identify melon resistant to Fusarium oxysporum f. sp. melonis. F. oyxsporum f. sp. melonis GR was isolated from infected melon plants collected at Goryeong and identified as F. oxysporum f. sp. melonis based on morphological characteristics, molecular analyses, and host-specificity tests on cucurbits including melon, oriental melon, cucumber, and watermelon. In addition, the GR isolate was determined as race 1 based on resistance responses of melon differentials to the fungus. To select optimized medium for mass production of inoculum of F. oxysporum f. sp. melonis GR, six media were tested. The fungus produced the most spores (microconidia) in V8-juice broth. Resistance degrees to the GR isolate of 22 commercial melon cultivars and 6 rootstocks for melon plants were investigated. All tested rootstocks showed no symptoms of Fusarium wilt. Among the tested melon cultivars, only three cultivars were susceptible and the other cultivars displayed moderate to high resistance to the GR isolate. For further study, six melon cultivars (Redqueen, Summercool, Superseji, Asiapapaya, Eolukpapaya, and Asiahwanggeum) showing different degrees of resistance to the fungus were selected. The development of Fusarium wilt on the cultivars was tested according to several conditions such as plant growth stage, root wounding, dipping period of roots in spore suspension, inoculum concentration, and incubation temperature to develop the disease. On the basis of the test results, we suggest that an efficient screening method for melon plants resistant to F. oxysporum f. sp. melonis is to remove soil from roots of seven-day-old melon seedlings, to dip the seedlings without cutting in s pore s uspension of <TEX>$3{\times}10^5conidia/mL$</TEX> for 30 min, to transplant the inoculated seedlings to plastic pots with horticulture nursery media, and then to cultivate the plants in a growth room at 25 to <TEX>$28^{\circ}C$</TEX> for about 3 weeks with 12-hour light per day.