Coli Sequence Research Articles

Evolutionary History of the Global Emergence of the Escherichia coli Epidemic Clone ST131.

ABSTRACTEscherichia coli sequence type 131 (ST131) has emerged globally as the most predominant extraintestinal pathogenic lineage within this clinically important species, and its association with fluoroquinolone and extended-spectrum cephalosporin resistance impacts significantly on treatment. The evolutionary histories of this lineage, and of important antimicrobial resistance elements within it, remain unclearly defined. This study of the largest worldwide collection (n = 215) of sequenced ST131 E. coli isolates to date demonstrates that the clonal expansion of two previously recognized antimicrobial-resistant clades, C1/H30R and C2/H30Rx, started around 25 years ago, consistent with the widespread introduction of fluoroquinolones and extended-spectrum cephalosporins in clinical medicine. These two clades appear to have emerged in the United States, with the expansion of the C2/H30Rx clade driven by the acquisition of a blaCTX-M-15-containing IncFII-like plasmid that has subsequently undergone extensive rearrangement. Several other evolutionary processes influencing the trajectory of this drug-resistant lineage are described, including sporadic acquisitions of CTX-M resistance plasmids and chromosomal integration of blaCTX-M within subclusters followed by vertical evolution. These processes are also occurring for another family of CTX-M gene variants more recently observed among ST131, the blaCTX-M-14/14-like group. The complexity of the evolutionary history of ST131 has important implications for antimicrobial resistance surveillance, epidemiological analysis, and control of emerging clinical lineages of E. coli. These data also highlight the global imperative to reduce specific antibiotic selection pressures and demonstrate the important and varied roles played by plasmids and other mobile genetic elements in the perpetuation of antimicrobial resistance within lineages.

Lineage-Specific Methyltransferases Define the Methylome of the Globally Disseminated Escherichia coli ST131 Clone.

ABSTRACTEscherichia coli sequence type 131 (ST131) is a clone of uropathogenic E. coli that has emerged rapidly and disseminated globally in both clinical and community settings. Members of the ST131 lineage from across the globe have been comprehensively characterized in terms of antibiotic resistance, virulence potential, and pathogenicity, but to date nothing is known about the methylome of these important human pathogens. Here we used single-molecule real-time (SMRT) PacBio sequencing to determine the methylome of E. coli EC958, the most-well-characterized completely sequenced ST131 strain. Our analysis of 52,081 methylated adenines in the genome of EC958 discovered three m6A methylation motifs that have not been described previously. Subsequent SMRT sequencing of isogenic knockout mutants identified the two type I methyltransferases (MTases) and one type IIG MTase responsible for m6A methylation of novel recognition sites. Although both type I sites were rare, the type IIG sites accounted for more than 12% of all methylated adenines in EC958. Analysis of the distribution of MTase genes across 95 ST131 genomes revealed their prevalence is highly conserved within the ST131 lineage, with most variation due to the presence or absence of mobile genetic elements on which individual MTase genes are located.

The role of H4 flagella in Escherichia coli ST131 virulence.

Escherichia coli sequence type 131 (ST131) is a globally dominant multidrug resistant clone associated with urinary tract and bloodstream infections. Most ST131 strains exhibit resistance to multiple antibiotics and cause infections associated with limited treatment options. The largest sub-clonal ST131 lineage is resistant to fluoroquinolones, contains the type 1 fimbriae fimH30 allele and expresses an H4 flagella antigen. Flagella are motility organelles that contribute to UPEC colonisation of the upper urinary tract. In this study, we examined the specific role of H4 flagella in ST131 motility and interaction with host epithelial and immune cells. We show that the majority of H4-positive ST131 strains are motile and are enriched for flagella expression during static pellicle growth. We also tested the role of H4 flagella in ST131 through the construction of specific mutants, over-expression strains and isogenic mutants that expressed alternative H1 and H7 flagellar subtypes. Overall, our results revealed that H4, H1 and H7 flagella possess conserved phenotypes with regards to motility, epithelial cell adhesion, invasion and uptake by macrophages. In contrast, H4 flagella trigger enhanced induction of the anti-inflammatory cytokine IL-10 compared to H1 and H7 flagella, a property that may contribute to ST131 fitness in the urinary tract.

Predicting a novel pathogenicity island inHelicobacter pyloriby genomic barcoding

To apply a new, integrated technique for visualizing bacterial genomes to identify novel pathogenicity islands in Helicobacter pylori (H. pylori). A genomic barcode imaging method (converting frequency matrices to grey-scale levels) was designed to visually distinguish origin-specific genomic regions in H. pylori. The complete genome sequences of the six H. pylori strains published in the National Center for Biotechnological Information prokaryotic genome database were scanned, and compared to the genome barcodes of Escherichia coli (E. coli) O157:H7 strain EDL933 and a random nucleotide sequence. The following criteria were applied to identify potential pathogenicity islands (PAIs): (1) barcode distance distinct from that of the general background; (2) length greater than 10000 continuous base pairs; and (3) containing genes with known virulence-related functions (as determined by PfamScan and Blast2GO). Comparison of the barcode images generated for the 26695, HPAG1, J99, Shi470, G27 and P12 H. pylori genomes with those for the E. coli and random sequence controls revealed that H. pylori genomes contained fewer anomalous regions. Among the H. pylori-specific continuous anomalous regions (longer than 20 kbp in each strain's genome), two fit the criteria for identifying candidate PAIs. The bioinformatic-based functional analyses revealed that one of the two anomalous regions was the known pathogenicity island cag-PAI, this finding also served as proof-of-principle for the utility of the genomic barcoding approach for identifying PAIs, and characterized the other as a novel PAI, which was designated as tfs3-PAI. Furthermore, the cag-PAI and tfs3-PAI harbored genes encoding type IV secretion system proteins and were predicted to have potential for functional synergy. Genomic barcode imaging represents an effective bioinformatic-based approach for scanning bacterial genomes, such as H. pylori, to identify candidate PAIs.

Carbapenemase-producing Enterobacteriaceae in Finland: the first years (2008-11)

Carbapenemase-producing Enterobacteriaceae (CPE) are becoming a global problem; they are often resistant to nearly all available antibiotics. Here we report details on all Finnish CPE isolates found until the end of 2011: carbapenemase genes, travel history and multilocus sequence typing (MLST) data. Enterobacteriaceae sent to the Antimicrobial Resistance Unit of the National Institute for Health and Welfare were tested for susceptibility to carbapenems, screened for carbapenemases by PCR and isolates with decreased susceptibility to carbapenems were tested for hydrolysis of imipenem. Carbapenemase-producing Escherichia coli and Klebsiella pneumoniae isolates were typed by MLST. In all, 26 CPE strains were found from 25 patients: 10 with OXA-48-like enzymes, 5 with KPC, 4 with VIM, 3 with NDM, 3 with IMI/NMC-A and 1 with GES-14. The species were K. pneumoniae (n = 16), E. coli (n = 6), Enterobacter cloacae (n = 3) and Raoultella planticola (n = 1). Of the 25 patients, 18 had a known travel history/hospital transfer from abroad. Local spread/transmission was suspected in 2011, but there were no hospital outbreaks. The K. pneumoniae multilocus sequence types ST258, ST182, ST147, ST244, ST14, ST13, ST383, ST101 and ST15, and the E. coli sequence types ST38 and ST90 were found. Many of these are global epidemic clones. CPE strains are increasingly found in Finland, but still at a very low prevalence.

Virulence of Escherichia coli Clinical Isolates in a Murine Sepsis Model in Relation to Sequence Type ST131 Status, Fluoroquinolone Resistance, and Virulence Genotype

Escherichia coli sequence type ST131 (O25b:H4) has emerged over the past decade as a globally disseminated, multidrug-resistant pathogen. Unlike traditional antimicrobial-resistant E. coli, ST131 derives from virulence-associated phylogenetic group B2 and exhibits extraintestinal virulence factors. This, plus preliminary evidence of virulence in experimental animals, has suggested that ST131's epidemic emergence may be due to high virulence potential, compared with other E. coli types. To test this hypothesis, we compared a large number of matched ST131 and non-ST131 E. coli clinical isolates, both fluoroquinolone resistant and susceptible, plus isolates from classic extraintestinal pathogenic E. coli (ExPEC) sequence types (STs) and case report ST131 household transmission isolates, for virulence in a mouse subcutaneous sepsis model. Overall, in mice, the study isolates produced a wide range of lethality and clinical illness. However, neither ST131 status nor fluoroquinolone phenotype correlated with this diversity of illness severity, which occurred within each of the 6 study groups. In contrast, multiple known or suspected ExPEC virulence genes, including pap (P fimbriae), vat (vacuolating toxin), kpsM II (group 2 capsule), ibeA (invasion of brain endothelium), and clbB/N (colibactin synthesis), plus molecularly defined ExPEC status, were significantly associated with virulence. These findings point away from ST131 isolates as having higher virulence potential compared with other E. coli types in causing invasive extraintestinal infections and suggest instead that ST131's epidemiological success may reflect enhanced fitness for upstream steps in pathogenesis or in colonization and transmission. Additionally, the extensive within-ST virulence diversity suggests an opportunity to compare closely related strains to identify the responsible genetic determinants.

Assessment of clustering algorithms for unsupervised transcription factor binding site discovery

Identification of transcription factor binding sites is a key task to understand gene regulation mechanism to discover gene networks and functions. Clustering approach is proved to be useful when finding such patterns residing in promoter regions of co-regulated genes. Four clustering algorithms, Self-Organizing Map, K-Means, Fuzzy C-Means and Expectation-Maximization are studied in this paper to discover motifs in datasets extracted from Saccharomyces cerevisiae, Escherichia coli, Droshophila melanogaster and Homo sapiens DNA sequences. Required modifications to clustering algorithms in order to adapt them to motif finding task are presented through the paper. Then, their motif-finding performances are discussed carefully and evaluated against a popular motif-finding method, MEME.

Solution structure of the C-terminal DUF1000 domain of the human thioredoxin-like 1 protein

Solution structure of the C-terminal DUF1000 domain of the human thioredoxin-like 1 protein

Dissemination of fluoroquinolone-resistant Campylobacter spp. within an integrated commercial poultry production system.

While characterizing the intestinal bacterial community of broiler chickens, we detected epsilon-proteobacterial DNA in the ilea of 3-day-old commercial broiler chicks (J. Lu, U. Idris, B. Harmon, C. Hofacre, J. J. Maurer, and M. D. Lee, Appl. Environ. Microbiol. 69:6816-6824, 2003). The sequences exhibited high levels of similarity to Campylobacter jejuni and Campylobacter coli sequences, suggesting that chickens can carry Campylobacter at a very young age. Campylobacter sp. was detected by PCR in all samples collected from the ilea of chicks that were 3 to 49 days old; however, it was detected only in the cecal contents of chickens that were at least 21 days old. In order to determine whether the presence of Campylobacter DNA in young chicks was due to ingestion of the bacteria in food or water, we obtained commercial broiler hatching eggs, which were incubated in a research facility until the chicks hatched. DNA sequencing of the amplicons resulting from Campylobacter-specific 16S PCR performed with the ileal, cecal, and yolk contents of the day-of-hatching chicks revealed that Campylobacter DNA was present before the chicks consumed food or water. The 16S rRNA sequences exhibited 99% similarity to C. jejuni and C. coli sequences and 95 to 98% similarity to sequences of other thermophilic Campylobacter species, such as C. lari and C. upsaliensis. The presence of C. coli DNA was detected by specific PCR in the samples from chicks obtained from a commercial hatchery; however, no Campylobacter was detected by culturing. In order to determine whether the same strains of bacteria were present in multiple levels of the integrator, we cultured Campylobacter sp. from a flock of broiler breeders and their 6-week-old progeny that resided on a commercial broiler farm. The broiler breeders had been given fluoroquinolone antibiotics, and we sought to determine whether the same fluoroquinolone-resistant strain was present in their progeny. The isolates were typed by pulsed-field gel electrophoresis, which confirmed that the parental and progeny flocks contained the same strain of fluoroquinolone-resistant C. coli. These data indicate that resistant C. coli can be present in multiple levels of an integrated poultry system and demonstrated that molecular techniques or more sensitive culture methods may be necessary to detect early colonization by Campylobacter in broiler chicks.

Evaluation of the Need for Histopathological Examination in Routine Tonsillectomies

Outbreaks of infections with multidrug-resistant bacteria in neonatal intensive care units (NICUs) pose a major threat, especially to extremely preterm infants. This study describes a 35-day outbreak of multidrug-resistant Escherichia coli (E. coli) in a tertiary-level NICU in Germany.To underline the importance of surveillance policies in the particularly vulnerable cohort of preterm infants and to describe the efficacy of outbreak control strategies.Data were collected retrospectively from medical reports. Infants and environment were tested for E. coli.The outbreak affected a total of 13 infants between 25+1 and 35+0 weeks of gestation with seven infants showing signs of infection. The outbreak strain was identified as E. coli sequence type 131. Environmental screening provided no evidence for an environmental source. Through colonization surveillance and immediate and adequate treatment of potentially infected preterm infants, no fatalities occurred. Outbreak control was achieved by strict contact precautions, enhanced screening and temporary relocation of the NICU. Relocation and reconstruction improved the NICU's structural layout, focusing on isolation capacities. Follow-up indicated carriage for several months in some infants.Routine surveillance allowed early detection of the outbreak. The identification of carriers of the outbreak strain was successfully used to direct antibiotic treatment in case of infection. Enhanced hygienic measures and ward relocation were instrumental in controlling the outbreak.

High Resolution Structure of the Phosphohistidine-activated Form of Escherichia coli Cofactor-dependent Phosphoglycerate Mutase

The active conformation of the dimeric cofactor-dependent phosphoglycerate mutase (dPGM) from Escherichia coli has been elucidated by crystallographic methods to a resolution of 1.25 A (R-factor 0.121; R-free 0.168). The active site residue His(10), central in the catalytic mechanism of dPGM, is present as a phosphohistidine with occupancy of 0.28. The structural changes on histidine phosphorylation highlight various features that are significant in the catalytic mechanism. The C-terminal 10-residue tail, which is not observed in previous dPGM structures, is well ordered and interacts with residues implicated in substrate binding; the displacement of a loop adjacent to the active histidine brings previously overlooked residues into positions where they may directly influence catalysis. E. coli dPGM, like the mammalian dPGMs, is a dimer, whereas previous structural work has concentrated on monomeric and tetrameric yeast forms. We can now analyze the sequence differences that cause this variation of quaternary structure.

Cloning of a cDNA encoding a 3-dehydroquinate synthase from a higher plant, and analysis of the organ-specific and elicitor-induced expression of the corresponding gene.

cDNA clones for all enzymes of the prechorismate pathway of higher plants have previously been cloned, with the exception of the second enzyme of the pathway, 3-dehydroquinate synthase. Here we describe the isolation of a cDNA encoding a 3-dehydroquinate synthase from tomato which was identified by complementing a 3-dehydroquinate synthase-deficient Escherichia coli strain with a tomato cDNA library. The deduced amino acid sequence contains a putative N-terminal plastid-specific transit peptide, and the sequence of the mature enzyme resembles those of the corresponding bacterial enzymes more than of the fungal enzymes. Sequence identity was even higher between the tomato and E. coli sequences than between the E. coli and other known bacterial sequences. The abundance of 3-dehydroquinate synthase transcripts differ in the organs of tomato plants analyzed. In cultured tomato cells, the abundance of 3-dehydroquinate synthase transcripts increased 9-fold within 4 to 5 h of elicitor treatment.

The Alcaligenes eutrophus ldh structural gene encodes a novel type of lactate dehydrogenase.

The lactate dehydrogenase gene, ldh, of Alcaligenes eutrophus H16 was identified on a 14-kbp EcoRI restriction fragment of a genomic library in the cosmid pHC79 by hybridization with a 50-mer synthetic oligonucleotide which was derived from the N-terminal amino acid sequence of the purified enzyme. Recombinant strains of Escherichia coli JM83, which harboured a 2.0-kbp PstI subfragment in pUC9-1, expressed LDH at a high level, if ldh was downstream from and colinear to the E. coli lac promoter. The nucleotide sequence of a region of 4245 bp revealed several open reading frames which might represent coding regions. One represented the ldh gene. The amino acid sequence deduced from ldh exhibited 29% and 36% identity to the L-malate dehydrogenase of Methanothermus fervidus and to the putative translation product of an E. coli sequence of unknown function, respectively. The ldh was separated by short intergenic regions from two other open reading frames: ORF5 was located downstream of and colinear to ldh, and its putative translational product revealed 38 to 56% amino acid identity to penicillin-binding proteins. ORF3 was located upstream of and colinear to ldh, and its putative gene translational product represented a hydrophobic protein. A sequence, which resembled the A. eutrophus alcohol dehydrogenase promoter, was detected upstream of ORF3, which most probably represents the first transcribed gene of an operon consisting of ORF3, ldh and ORF5.

Stable genetic transformation of a beneficial arthropod, Metaseiulus occidentalis (Acari: Phytoseiidae), by a microinjection technique.

A microinjection technique has resulted in stable transformation of the western predatory mite Metaseiulus occidentalis. Early preblastoderm eggs within gravid females were microinjected. The needle was inserted through the cuticle of gravid females into the egg, or the tissue immediately surrounding the egg. This maternal injection method resulted in relatively high levels of survival and transformation. Transformation was achieved without the aid of any transposase-producing helper plasmid. The predatory mite was transformed with a plasmid containing the Escherichia coli beta-galactosidase gene (lacZ) regulated by the Drosophila hsp70 heat-shock promoter. Putatively transformed lines were isolated based on beta-galactosidase activity in first-generation larvae. Transformation was confirmed in the sixth generation by polymerase chain reaction amplification of a region spanning the Drosophila/E. coli sequences. Amplification of a nested region, also spanning the interspecific boundary, provided further evidence for stable transformation. Maternal microinjection may be adaptable to other beneficial arthropods, particularly other phytoseiid mites. Genetic transformation of M. occidentalis may improve its efficiency as a biological control agent as well as provide a method for investigating details of its physiology and ecology.

DNA mismatch correction by Very Short Patch repair may have altered the abundance of oligonucleotides in the E. coli genome.

A base mismatch correction process in E. coli K-12 called Very Short Patch (VSP) repair corrects T:G mismatches to C:G when found in certain sequence contexts. Two of the substrate mismatches (5'-CTWGG/3'-GGW'CC; W = A or T) occur in the context of cytosine methylation in DNA and reduce the mutagenic effects of 5-methylcytosine deamination to thymine. However, VSP repair is also known to repair T:G mismatches that are not expected to arise from 5-methylcytosine deamination (example--CTAG/GGT-C). In these cases, if the original base pair were a T:A, VSP repair would cause a T to C transition. We have carried out Markov chain analysis of an E. coli sequence database to determine if repair at the latter class of sites has altered the abundance of the relevant tetranucleotides. The results are consistent with the prediction that VSP repair would tend to deplete the genome of the 'T' containing sequences (example--CTAG), while enriching it for the corresponding 'C' containing sequences (CCAG). Further, they provide an explanation for the known scarcity of CTAG containing restriction enzyme sites among the genomes of enteric bacteria and identify VSP repair as a force in shaping the sequence composition of bacterial genomes.

Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus

The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

Incidence of common DNA sequences in bovine and porcine Escherichia coli strains causing diarrhoea

Seventeen bovine and 56 porcine Escherichia coli isolates from cases of diarrhoea and from healthy animals were examined for DNA sequences homologous to the genes for verocytotoxins ( VT), enterotoxins and human enterohaemorrhagic E coli/enteropathogenic E coli ( EHEC/SPEC) sequences. VT-1 was the most common toxin among the bovine isolates and VT-2 the most common in the porcine isolates. No isolates had homologous sequences to enteropathogenic adherence factor, but 71·2 per cent hybridised to the DNA probe encoding specific EHEC sequences, and 95·9 per cent showed homology with a 23 kb DNA fragment common to EHEC and SPEC plasmids.

Characterization of Escherichia coli-Anabaena sp. hybrid thioredoxins.

Thioredoxin is a small redox protein with an active-site disulfide/dithiol. The protein from Escherichia coli has been well characterized. The genes encoding thioredoxin in E. coli and in the filamentous cyanobacterium Anabaena PCC 7119 have been cloned and sequenced. Anabaena thioredoxin exhibits 50% amino acid identity with the E. coli protein and interacts with E. coli enzymes. The genes encoding Anabaena and E. coli thioredoxin were fused via a common restriction site in the nucleotide sequence coding for the active site of the proteins to generate hybrid genes, coding for two chimeric thioredoxins. These proteins are designated Anabaena-E. coli (A-E) thioredoxin for the construct with the Anabaena sequence from the N-terminus to the middle of the active site and the E. coli sequence to the C-terminus, and E. coli-Anabaena (E-A) for the opposite construct. The gene encoding the A-E thioredoxin complements all phenotypes of an E. coli thioredoxin-deficient strain, whereas the gene encoding E-A thioredoxin is only partially effective. Purified E-A thioredoxin exhibits a much lower catalytic efficiency with E. coli thioredoxin reductase and ribonucleotide reductase than either E. coli or Anabaena thioredoxin. In contrast, the A-E thioredoxin has a higher catalytic efficiency in these reactions than either parental protein. Reaction with antibodies to E. coli and Anabaena thioredoxins shows that the antigenic determinants for thioredoxin are located in the C-terminal part of the molecule and retain the native conformation in the hybrid proteins.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene organization and structure of the Streptomyces lividans gal operon.

We present the gene organization and DNA sequence of the Streptomyces lividans galactose utilization genes. Complementation of Escherichia coli galE, galT, or galK mutants and DNA sequence analysis were used to demonstrate that the galactose utilization genes are organized within an operon with the gene order galT, galE, and galK. Comparison of the inferred protein sequences for the S. lividans gal gene products to the corresponding E. coli and Saccharomyces carlbergensis sequences identified regions of structural homology within each of the galactose utilization enzymes. Finally, we discuss a potential relationship between the gene organization of the operon and the functional roles of the gal enzymes in cellular metabolism.

Preparation and sequencing of the cloacin fragment of [formula omitted] 16S RNA

A fast method for isolation of a 3′-terminal fragment of Streptomyces aureofaciens 16S RNA was developed. The procedure involves reaction of 70S ribosomes with cloacin DF13 and subsequent fractionation of the reaction mixture by polyacrylamide gel electrophoresis. The cloacin fragment was eluted from the gel and used directly for 3′-end labeling with cytidine-3′,5′-[5′- 32P]bisphosphate. The labeled RNA fragment was sequenced by the enzymatic method. It consists of 50 nucleotides and has the sequence 5′-GUCGUAACAAGGUAACCGUACCGGAAGGUGCGGUUGGAUCACCUCCUUUC OH. The differences from the E. coli and Bacillus sequences and their possible influence on the rate and specificity of polypeptide synthesis are discussed.