Coli Lac Research Articles

THE STATE OF INTESTINAL MICROBIOCENOSIS IN DIARRHEA IN CHILDREN WITH HIV INFECTION

to study the state of intestinal microbiocenosis in diarrhea in HIV-infected children. During the study, 876 children under the age of 18 were examined. Healthy children - 130 people, group 1 - 261 children with HIV infection with diarrhea, group 2 - 247 children with only diarrhea without HIV infection and group 3 - 238 children with HIV infection without diarrhea. In HIV-infected children with acute diarrhea, there was a sharp decrease in obligate (Bacteroides spp., Bifidobacterium spp., Lactobacillus spp., E. coli lac+) and an increase in facultative intestinal microflora (E. coli lac-, Enterobacter spp., Enterococcus spp. ., Staphylococcus spp.). High values of Candida spp., Salmonella, Shigella, Cambilobacter, Yersinia were also recorded (P>0.05). This probably indicates the development of invasive diarrhea. High dysbiotic changes in acute infectious diarrhea in HIV-positive children require the introduction of drugs that restore intestinal microbiocenosis into their treatment regimen.

Testing the Effect of Histone Acetyltransferases on Local Chromatin Compaction.

Experiments determining the chromatin association of histone acetylases (HATs) and deacetylases (HDACs) at the genome-wide level provide precise maps of locus occupancy, but do not allow conclusions on the functional consequences of this locus-specific enrichment. Here we describe a protocol that allows tethering of HATs or HDACs to specific genomic loci upon fusion with a fluorescent protein and a DNA-binding protein such as the E. coli Lac repressor (LacI), which binds to genomically inserted lac operon sequences (lacO) via DNA/protein interactions. Integration of these lacO sequences into a genomic region of interest allows to monitor the functional consequences of HAT/HDAC targeting on chromatin (de)compaction, histone modification, and interaction with other proteins by quantitative light microscopy, as described here. As DNA-binding of LacI can be tightly controlled by the addition of galactose-derivatives, this method also allows to monitor the effects of locus-specific recruitment in a time-resolved manner.

РЕЗУЛЬТАТЫ ПРИМЕНЕНИЯ КОМБИНИРОВАННОЙ ПРОБИОТИЧЕСКОЙ ТЕРАПИИ ДЛЯ КОРРЕКЦИИ НАРУШЕНИЙ МИКРОБИОЦЕНОЗА КИШЕЧНИКА БОЛЬНЫХ ТУБЕРКУЛЕЗОМ С МНОЖЕСТВЕННОЙ ЛЕКАРСТВЕННОЙ УСТОЙ- ЧИВОСТЬЮ ВОЗБУДИТЕЛЯ

Introduction. About 90% of TB patients have side effects of anti-TB therapy in the form of gastrointestinal disorders. Currently, the role of disorders of the intestinal microbiocenosis in the formation of dyspepsia has been proven. In turn, dyspeptic syndrome leads to a decrease in patient adherence to treatment, which affects the effectiveness of tuberculosis treatment. The most dangerous in this regard are second-line anti-tuberculosis drugs used in the treatment of drug-resistant tuberculosis. Long-term use of these drugs requires the development and implementation of algorithms for the correction of microecological disorders of the intestine. The aim of the study was to evaluate the microbiological results of using a combined probiotic in persons with tuberculosis and multidrug-resistant pathogen in the course of anti-tuberculosis therapy. Material and methods. A prospective linear study included 30 patients with respiratory tuberculosis and multidrug-resistant pathogen. The study consisted in a two-stage study of the microbiocenosis of the intestinal biotope of these patients by a quantitative bacteriological method before and after combined probiotic therapy with a further comparison of the number of microorganisms. Statistical data processing was performed using the IBM SPSS program. Qualitative signs are represented by absolute and relative frequencies, expressed as a percentage, with 95% confidence intervals calculated for them by the Wilson method (rel.% [95% CI]). Quantitative data are presented in the work in the format of the median and interquartile range (Me (25th; 75th). For variables related to the ordinal scale and nonparametric quantitative variables, the Mann-Whitney U test was used to compare the two groups of observations. the compared groups were considered statistically significant with a statistical significance of less than 0.05. Results and discussion. The use of combined probiotic therapy in patients with multidrug-resistant tuberculosis did not compensate for the deficiency of obligate microorganisms - Bifidobacterium spp., Lactobacillus spp. However, in the process of probiotic therapy noted a decrease in the concentration of Enterococcus spp., E. Coli lac-, E. Coli hly +, Streptococcus spp., as well as a decrease in the titers and species structure of fungi of the genus Candida. A clinical example showing the microbiological and clinical efficacy of probiotic therapy in a patient with co-infection TB / HIV. Despite the changes received, the average population indicators for the region have not been achieved. Conclusion. It was found that the use of combined probiotic therapy in patients with multidrug-resistant tuberculosis led to a decrease in the pool of opportunistic microorganisms in the intestinal lumen and had a positive clinical effect in a patient with TB / HIV co-infection.

The Inducible lac Operator-Repressor System Is Functional in Zebrafish Cells.

BackgroundZebrafish are a foundational model organism for studying the spatio-temporal activity of genes and their regulatory sequences. A variety of approaches are currently available for editing genes and modifying gene expression in zebrafish, including RNAi, Cre/lox, and CRISPR-Cas9. However, the lac operator-repressor system, an E. coli lac operon component which has been adapted for use in many other species and is a valuable, flexible tool for inducible modulation of gene expression studies, has not been previously tested in zebrafish.ResultsHere we demonstrate that the lac operator-repressor system robustly decreases expression of firefly luciferase in cultured zebrafish fibroblast cells. Our work establishes the lac operator-repressor system as a promising tool for the manipulation of gene expression in whole zebrafish.ConclusionOur results lay the groundwork for the development of lac-based reporter assays in zebrafish, and adds to the tools available for investigating dynamic gene expression in embryogenesis. We believe this work will catalyze the development of new reporter assay systems to investigate uncharacterized regulatory elements and their cell-type specific activities.

The establishment process of lac operon model and the analysis of several teaching problems

Gene structure and expression regulation mechanism are the research hotspots and focus of modern life sciences. The lac operon is a cluster of genes through which Escherichia coli catabolizes lactose. It was first proposed by F. Jacob and J. Monod, who were also awarded the Nobel Prize in Physiology or Medicine in 1965 for their contributions. Thereafter, the lac operon has become the classic teaching case of the gene regulation mechanism in microbiology, genetics and molecular biology, and been highly valued by teachers and students alike. Although the conclusion is easy to follow and memorize, its rich connotation and esoteric reasoning has rendered it difficult to understand, neither is it easy for teachers to fully exploit the advantages of this teaching case. Therefore it is necessary to have an in-depth understanding of the genetic structure and working principle of the lac operon, especially the scientific background and thinking process through which scientists revealed these mysteries. In this paper, the historical discovery and analysis process of the E. coli lac operon was reviewed by following their footprints, listening to their analysis of experimental results. Based on the DNA sequences, the reasons for several unusual phenomena of lac operon expression were also discussed to exemplify the teaching value of the classic cases in genetics and molecular biology.

A Bacterial Adenylate Cyclase-Based Two-Hybrid System Compatible with Gateway® Cloning.

The bacterial adenylate cyclase two-hybrid system (BACTH) is a genetic approach used to test protein interactions in vivo in E. coli. This system takes advantage of the two catalytic domains of Bordetella pertussis adenylate cyclase (CyaA) toxin, which can be fused separately to proteins of interest. If the proteins of interest interact, then the adenylate cyclase domains will be brought in close proximity to each other, reconstituting cyclic AMP (cAMP) production. Interacting proteins can be both qualitatively and quantitatively assessed by the expression of chromosomal genes of the E. coli lac or mal operon, which are positively regulated by cAMP production. Because cAMP is diffusible, the proteins of interest do not need to interact near the transcriptional machinery. Consequently, both cytosolic and membrane protein-protein interactions can be tested. The BACTH system has recently been modified to be compatible with Gateway® recombinational cloning, BACTHGW. This chapter explains the principle of the BACTH, its Gateway® modified system, and details of the general procedure.

Occlusion of the Ribosome Binding Site Connects the Translational Initiation Frequency, mRNA Stability and Premature Transcription Termination

Protein production is controlled by ribosome binding to the messenger RNA (mRNA), quantified in part by the binding affinity between the ribosome and the ribosome binding sequence on the mRNA. Using the E. coli lac operon as model, Ringquist et al. (1992) found a more than 1,000-fold difference in protein yield when varying the Shine-Dalgarno sequence and its distance to the translation start site. Their proposed model accounted for this large variation by only a variation in the binding affinity and the subsequent initiation rate. Here we demonstrate that the decrease in protein yield with weaker ribosome binding sites in addition is caused by a decreased mRNA stability, and by an increased rate of premature transcription termination. Using different ribosome binding site sequences of the E. coli lacZ gene, we found that an approximately 100-fold span in protein expression could be subdivided into three mechanisms that each affected expression 3- to 6-fold. Our experiments is consistent with a two-step ribosome initiation model, in which occlusion of the initial part of the mRNA by a ribosome simultaneously protects the mRNA from both premature transcription termination and degradation: The premature termination we suggest is coupled to the absence of occlusion that allows binding of transcription termination factor, possibly Rho. The mRNA stability is explained by occlusion that prevents binding of the degrading enzymes. In our proposed scenario, a mRNA with lower translation initiation rate would at the same time be “hit” by an increased premature termination and a shorter life-time. Our model further suggests that the transcription from most if not all natural promoters is substantially influenced by premature termination.

Virulence genes and antimicrobial susceptibility of lactose-negative and lactose-positive strains of Escherichia coli isolated from pregnant women and neonates

Escherichia coli can cause serious infections in the neonates and pregnant women. Although E. coli is widely studied, E. coli lactose-negative (lac−) strains have been rarely described before. So, the aim of this study was to compare lac− and lactose-positive (lac+) E. coli strains in respect of antimicrobial susceptibility and the frequency of virulence genes (VGs). The study included 58 lac+ and 58 lac− E. coli strains isolated from pregnant women and neonates. Culture and the results of biochemical reactions were conducted for lac− and lac+ E. coli identification and differentiation. Disc diffusion test was performed to study the antimicrobial susceptibility of the isolates, and PCR was used to detect VGs. Resistance to at least one of the tested antibiotics was found among 14 (25.9%) E. coli lac+ and in 26 (44.9%) E. coli lac− strains. Both lac+ and lac− E. coli strains were mostly resistant to ampicillin (22.4 and 39.7%) and ticarcillin (20.7 and 39.7%). None of the tested strains produced extended-spectrum β-lactamases (ESBLs). Genes fimH, fimA, iutA, sfa/foc, neuC, ibeA, and hlyF were detected, respectively, in 96.6, 82.8, 32.8, 24.1, 22.4, 12.1, and 6.9% of lac+ E. coli strains and in 94.8, 86.2, 48.3, 19.0, 8.6, 8.6, and 1.7% of lac− strains. The antimicrobial susceptibility and the pathogenic potential of both tested groups of E. coli strains are similar. Therefore, omitting E. coli lac− strains as a potential etiological agent of infections may pose a threat to the health and life of both mothers and neonates.

����������� ��������������� �������� � ������������ ���������� ����������� ������ ������� ����� � ���� ����� WISTAR

We studied distal colon of Wistar rats including descending transverse colon and rectum. Feature of distal colon in the
 left flexure are short mesenterium growing in size towards rectum, common mesenterium with small intestine attached
 to it on the right side and ligament forming left flexure and attached to it on the left side. It was found that one of the
 variants of normal blood supply is the absence of a. mesenterica caudalis. In this case blood supply comes from arterial
 arch formed by a. rectalis media and a. colica media. Moreover, in the classic variant of blood supply we revealed a
 variation in the amount of straight branches that go to this segment of colon wall from left colic and superior rectal
 arteries (from 3 to 5 from each artery).
 The structural features of rectum is weak expression of rectal ampulla that causes the depletion of fecal masses immediately
 after passing into rectum. Crypt compartment of colon of Wistar rats consists by 80,6 % of obligatory flora
 represented with Bacteroides ssp., Lactobacillus spp., Bifidobacterium spp., Enterococcus faecalis, E. coli (lac+), Grampositive
 rods. Facultative flora is represented with Proteus mirabilis, Peptococcus spp., Candida spp., Staphylococcus
 epidermidis, Citrobacter freundii and makes 19,4 %.

Phase-dependent dynamics of the lac promoter under nutrient stress

To survive, a bacterial population must sense nutrient availability and adjust its growth phase accordingly. Few studies have quantitatively analyzed the single-cell behavior of stress and growth phase-related transcriptional changes in Escherichia coli. To investigate the dynamic changes in transcription during different growth phases and starvation, we analyzed the single-cell transcriptional dynamics of the E. coli lac promoter. Cells were grown under different starvation conditions, including glucose, magnesium, phosphate and thiamine limitations, and transcription dynamics was quantified using a single RNA detection method at different phases. Differences in gene expression over conditions and phases indicate that stochasticity in transcription dynamics is directly connected to cell phase and availability of nutrients. Except for glucose, the pattern of transcription dynamics under all starvation conditions appears to be similar. Transcriptional bursts were more prominent in lag and stationary phase cells starved for energy sources. Identical behavior was observed in exponential phase cells starved for phosphate and thiamine. Noise measurements under all nutrient exhaustion conditions indicate that intrinsic noise is higher than extrinsic noise. Our results, obtained in a relA1 mutational background, which led to suboptimal production of ppGpp, suggest that the single-cell transcriptional changes we observed were largely ppGpp-independent. Taken together, we propose that, under different starvation conditions, cells are able to decrease the trend in cell-to-cell variability in transcription as a common means of adaptation.

DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli.

Escherichia coli lac repressor (LacI) is a paradigmatic transcriptional factor that controls the expression of lacZYA in the lac operon. This tetrameric protein specifically binds to the O1, O2 and O3 operators of the lac operon and forms a DNA loop to repress transcription from the adjacent lac promoter. In this article, we demonstrate that upon binding to the O1 and O2 operators at their native positions LacI constrains three (−) supercoils within the 401-bp DNA loop of the lac promoter and forms a topological barrier. The stability of LacI-mediated DNA topological barriers is directly proportional to its DNA binding affinity. However, we find that DNA supercoiling modulates the basal expression from the lac operon in E. coli. Our results are consistent with the hypothesis that LacI functions as a topological barrier to constrain free, unconstrained (−) supercoils within the 401-bp DNA loop of the lac promoter. These constrained (−) supercoils enhance LacI’s DNA-binding affinity and thereby the repression of the promoter. Thus, LacI binding is superhelically modulated to control the expression of lacZYA in the lac operon under varying growth conditions.

In Pursuit of Genes of Glucose Metabolism

If you don't know where you're going, you might wind up someplace else—Yogi Berra My professional journey, once I accepted the fact that I would not play first base for the Chicago Cubs, was not accomplished in a straight line. I entered medical school intending to become a family physician but soon became interested in research. I took an internal medicine residency at the University of California, San Francisco (UCSF), then a long research fellowship in the nascent field of molecular biology at the National Institutes of Health (NIH), and followed that with training in clinical endocrinology at the University of Wisconsin. I spent the next fifteen years dividing my time between the clinic and laboratory at the University of Iowa. Finally, I decided to concentrate on research and spent the next twenty-three years at Vanderbilt University. For the past eleven years, I have been at the University of Iowa, where I helped establish a new diabetes research center. My research journey also had several different directions. Upon reflection, I guess I ended up “someplace else” by choice, and it certainly has been an interesting trip. It is one I unreservedly recommend.

A highly sensitive and specific electrochemical sensing method for robust detection of Escherichia coli lac Z gene sequence

Based on the interaction mode of capture probe–target–signal probe (CP–T–SP), a simple but efficient electrochemical sensing method is developed for robust detection of Escherichia coli (E. coli) lac Z gene sequence. The sensing system is simply composed of two probes with CP attached to the surface of gold electrode and methylene blue (MB)-labeled SP free in the detecting solution. Two duplexes are formed with the target DNA, an E. coli lac Z gene sequence, hybridizing with two ends of CP and SP separately. This structure can position the MB labels near to the electrode surface, thereby resulting in the change of detecting current. The proposed sensor exhibits a high sensitivity with a detection limit of ∼30fM for target DNA and good mismatch discrimination ability (MDA). This method can also be applied to the construction of other sensors for the analysis of similar designated pathogenic bacteria gene sequence (PBGS).

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm−1. Copyright © 2013 John Wiley & Sons, Ltd.

Genotype to Phenotype Mapping and the Fitness Landscape of the E. coli lac Promoter

Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with its phenotype, the induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. There is a significant selective pressure on the wild type, which we deduce to be multi-objective optimal for gene expression in environments with different nutrient sources. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions without difficult optimization steps. In particular, we observe evidence for previously unexplored genetic regulatory mechanisms, possibly kinetic in nature. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data.

Interplay of Protein and DNA Structure Revealed in Simulations of the lac Operon

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

LacI-DNA-IPTG Loops: Equilibria among Conformations by Single-Molecule FRET

The E. coli Lac repressor (LacI) tetramer binds simultaneously to a promoter-proximal DNA binding site (operator) and an auxiliary operator, resulting in a DNA loop, which increases repression efficiency. Induction of the lac operon by allolactose reduces the affinity of LacI for DNA, but induction does not completely prevent looping in vivo. Our previous work on the conformations of LacI loops used a hyperstable model DNA construct, 9C14, that contains a sequence directed bend flanked by operators. Single-molecule fluorescence resonance energy transfer (SM-FRET) on a dual fluorophore-labeled LacI-9C14 loop showed that it adopts a single, stable, high-FRET V-shaped LacI conformation. Ligand-induced changes in loop geometry can affect loop stability, and the current work assesses loop population distributions for LacI-9C14 complexes containing the synthetic inducer IPTG. SM-FRET confirms that the high-FRET LacI-9C14 loop is only partially destabilized by saturating IPTG. LacI titration experiments and FRET fluctuation analysis suggest that the addition of IPTG induces loop conformational dynamics and re-equilibration between loop population distributions that include a mixture of looped states that do not exhibit high-efficiency FRET. The results show that repression by looping even at saturating IPTG should be considered in models for regulation of the operon. We propose that persistent DNA loops near the operator function biologically to accelerate rerepression upon exhaustion of inducer.

Analysis of glucose-6-phosphate dehydrogenase of the cyanobacterium Synechococcus sp. PCC 7942 in the zwf mutant Escherichia coli DF214 cells

The aim of this study was to express the zwf gene of Synechococcus sp. PCC 7942 in zwf mutant Escherichia coli DF214 cells and to analyse glucose-6-phosphate dehydrogenase (G6PDH) activity. Initially, mutant cells were transformed with plasmid pNUT1 containing a Synechococcus sp. PCC 7942 zwf gene with a 1 kb upstream region that is expected to contain promoter elements. Transformant DF214 cells were not complemented by this fragment in a glucose minimal medium, nor did they exhibit statistically meaningful G6PDH activity. Therefore, the zwf gene was cloned in the lac operon to express the Zwf as a fusion protein; this yielded the construct pSG162. The pSG162 transformant E. coli DF214 cells were complemented in a glucose minimal medium, indicating that cyanobacterial Zwf protein fused with the part of LacZ′ polypeptide, enabling the cells to utilize glucose via the oxidative pentose phosphate pathway. Compared with wild-type E. coli cells, approximately ten times more G6PDH activity was measured in transformant cells. This indicated that the Synechococcus sp. PCC 7942 zwf gene was expressed under the control of the E. coli lac promoter as a fusion protein and the zwf product was converted into an active G6PDH form. Analyses was also carried out to determine whether dithiothreitol (DTT) was an in vitro reducing agent affected the enzyme activity, as was previously reported for this cyanobacterial strain. The results showed no variation in enzyme activity in the reduced assay conditions. Therefore, the zwf mutant E. coli strain DF214 was found to provide a rapid system for analysis of cyanobacterial G6PDH enzymes, but not for the redox state analysis of this enzyme.

Gene Network Homology in Prokaryotes Using a Similarity Search Approach: Queries of Quorum Sensing Signal Transduction

Bacterial cell-cell communication is mediated by small signaling molecules known as autoinducers. Importantly, autoinducer-2 (AI-2) is synthesized via the enzyme LuxS in over 80 species, some of which mediate their pathogenicity by recognizing and transducing this signal in a cell density dependent manner. AI-2 mediated phenotypes are not well understood however, as the means for signal transduction appears varied among species, while AI-2 synthesis processes appear conserved. Approaches to reveal the recognition pathways of AI-2 will shed light on pathogenicity as we believe recognition of the signal is likely as important, if not more, than the signal synthesis. LMNAST (Local Modular Network Alignment Similarity Tool) uses a local similarity search heuristic to study gene order, generating homology hits for the genomic arrangement of a query gene sequence. We develop and apply this tool for the E. coli lac and LuxS regulated (Lsr) systems. Lsr is of great interest as it mediates AI-2 uptake and processing. Both test searches generated results that were subsequently analyzed through a number of different lenses, each with its own level of granularity, from a binary phylogenetic representation down to trackback plots that preserve genomic organizational information. Through a survey of these results, we demonstrate the identification of orthologs, paralogs, hitchhiking genes, gene loss, gene rearrangement within an operon context, and also horizontal gene transfer (HGT). We found a variety of operon structures that are consistent with our hypothesis that the signal can be perceived and transduced by homologous protein complexes, while their regulation may be key to defining subsequent phenotypic behavior.

Direct measurements of IPTG enable analysis of the induction behavior of E. coli in high cell density cultures

BackgroundThe E. coli lac operon and its components have been studied for decades, and lac-derived systems are widely used for recombinant protein production. However, lac operon dynamics and induction behavior remain the paradigm of gene regulation. Recently, an HPLC-MS-based method to quantify IPTG in the medium and inside the biomass has been established, and this tool may be useful to uncover the lack of knowledge and allow optimization of biotechnological processes.ResultsThe results obtained from the study of IPTG distribution profiles in fed-batch, high cell density cultures allowed discrimination between two different depletion patterns of an inducer from the medium to the biomass in E. coli-expressing rhamnulose-1-phosphate aldolase (RhuA). Moreover, we could demonstrate that active transport mediates the uptake of this gratuitous inducer. Additionally, we could study the induction behaviors of this expression system by taking into account the biomass concentration at the induction time.ConclusionsIn the bistable range, partial induction occurred, which led to intermediate levels of RhuA activity. There was a direct relationship between the initial inducer concentrations and the initial inducer transport rate together with the specific activity. A majority of the inducer remains in the medium to reach equilibrium with the intracellular level. The intracellular inducer accumulation was a further evidence of bistability of the lac operon.