The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

Abstract

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm−1. Copyright © 2013 John Wiley & Sons, Ltd.