Coccidiosis Research Articles

Comparative efficacy of Amprolium, Garlic oil and Ginger oil against Coccidiosis in common quail (Coturnix coturnix).

In birds, Eimeria spp are commonly reported coccidian parasites that cause anorexia, debilitation, bloody diarrhea, mortalities and economical losses. This study was conducted on 30 clinical cases of common quails presented at Pet Centre, University of Veterinary and Animal Sciences, Lahore, suffering from coccidiosis. The aim of this study was to evaluate the comparative anti-coccidial efficacy of amprolium, garlic oil and ginger oil. Drinking water of affected birds was supplemented with amprolium (130 mg/100 mL), garlic oil (150µl/0.5L) and ginger oil (150µl/0.5L) for 15 days and fecal sample screening for coccidia oocyst count was performed on days 0, 3, 5, 7, 11 and 15 using direct microscopy with fecal floatation method and McMaster chamber counting technique. The data was statistically analyzed which revealed that amprolium showed highest and rapid efficacy against coccidiosis with complete disappearance of oocysts and improved activity level with better health, increased feed intake and normal feces on day 11 followed by garlic oil that showed recovery from oocysts on day 15, whereas in ginger oil treated birds oocysts were present till the end of study. It was concluded that amprolium is highly effective against coccidiosis followed by garlic oil; on other hand ginger oil was not clinically effective for the treatment of coccidiosis in quails.

Effect of herbal powder supplementation in protecting histopathological changes associated with caecal coccidiosis

An experiment was conducted on one day old, 120 broiler chicks to study the effect of madar (Calotropis procera) leaf powder and amprolium supplementation on caecal histology of broiler chicks during coccidiosis. Broiler chicks were divided into five groups (I-V) each with two replicates of 12 chicks. Group I and II were provided unsupplemented diet, Group III was supplemented with 0.125% amprolium, group IV and V were supplemented with 0.2% and 0.4% madar leaf powder supplementation respectively. On 15th day of experiment, groups II, III, IV and V were infected with 50,000 sporulated oocysts containing 80% Eimeria tenella. Histopathological changes were studied on 5th, 10th and 15th days post infection from two birds of each replicate. Histopathological changes were minimum in group III. In madar leaf powder supplemented groups (IV and V) protection from histopathological changes was observed from lesions associated with coccidiosis and effect was concentration dependent.

Small-scale farmers' perception and practice on coccidiosis management in broiler farm at Gazipur, Bangladesh.

Farmers' knowledge and farm management practices can potentially help to mitigate the prevalence and severity of chicken coccidiosis, a devastating protozoan disease. Here, we assessed the farmers' perception and on-farm practices of coccidiosis management in small-scale broiler farms at Gazipur district, Bangladesh. A semi-structured questionnaire was used to obtain data from the randomly selected 119 small-scale broiler producers followed by detection of coccidiosis cases through gross and microscopic examination of 58 broilers. Overall bird-level prevalence of coccidiosis was 34.48% in this study. Survey data revealed that most of the farmers maintained all-in-all-out strategy (68.91%), good quality chicks (73.11%) and floor system rearing (96.63%) in their farms, and a mixture of old and new litter was used as bedding in all the study farms. Interval between flocks in 57.99% of farms was 8 to 14 days. Prevalence of coccidiosis was recorded in all surveyed farms, even though routine anticoccidial treatment. At the age of 15 to 18 days of broiler, 68.07% of farmers used chemoprophylaxis. Usage of amprolium was the highest (74.78%) followed by toltrazuril (55.46%), sulphaquinoxaline (23.52%), sulphaclozine (28.57%), sulphadimidine (24.36%) and sulphadimethoxine (24.36%). Traditional herbal medicines like extracts of bollygum (Litsea glutinosa), sal (Shorea robusta) and arjuna (Terminalia arjuna) bark and leaves were also in-use by 4.20% farmers during coccidiosis outbreak. In conclusions, this study explored the field scenario of coccidiosis, relevant farmers' knowledge and practices, and recommends the judicious use of drugs for safe broiler production.

Coccidiosis – a problem in backyard rabbitries

This paper focuses on parasites of the genus Eimeria in rabbits kept in two backyard farms – from Poland (herd A) and Ukraine (herd B). The concentration McMaster technique and sporulation was applied to determine the level of infection, as well as to identify the species composition. The Eimeria sp. oocysts were present in all collected samples (prevalence = 100%), and four to nine coccidian species were identified in the herd A and B, respectively. Eimeria media was the most common species, and the presence of the most pathogenic E. intestinalis and E. flavescens was observed in both studied rabbitries. The results obtained suggest that coccidiosis may cause a serious risk for rabbits kept in backyard farms, therefore prevention guidelines in relation to the backyard breeding are crucial to be developed.

РАСПРОСТРАНЕНИЕ КОКЦИДИОЗОВ КРУПНОГО РОГАТОГО СКОТА В ЖИВОТНОВОДЧЕСКИХ ПРЕДПРИЯТИЯХ СВЕРДЛОВСКОЙ ОБЛАСТИ

РАСПРОСТРАНЕНИЕ КОКЦИДИОЗОВ КРУПНОГО РОГАТОГО СКОТА В ЖИВОТНОВОДЧЕСКИХ ПРЕДПРИЯТИЯХ СВЕРДЛОВСКОЙ ОБЛАСТИ

Epidemiological studies of Eimeria species of cattle in Ilorin, North-Central Nigeria.

Coccidiosis is the most economically impactful enteric protozoan disease of animals including cattle. A year (March 2018 to February 2019) study was conducted on cattle in Ilorin, North-Central Nigeria with the objective of determining the prevalence, intensity of infection, diversity of Eimeria species, co-infection patterns and risk factors associated with the enteric protozoan infection in cattle. To address this, faecal samples from 478 cattle of different age groups, breeds and sex were subjected to the floatation technique, the McMaster counting technique and sporulation procedure. One hundred and eighty-six (38.91%) of the sampled cattle were positive, and 8 different species were identified (Eimeria bovis, E. zuernii, E. auburnensis, E. cylindrica, E. subspherica, E. canadensis, E. bukidnonensis and E. alabamensis) with E. bovis (25.94%) and E. zuernii (23.43%) been the most prevalent. Eimeria oocysts were detected all through the year. The intensity of Eimeria species among infected cattle ranged between 200-12900 oocyst per gram of faeces. Following univariate analysis, breed, age, sex, physiological status, faecal consistency and PCV were significantly (p<0.05) associated with Eimeria infection. Multivariate analysis revealed that breed, age and physiological status were the significant risk factors associated with eimeriosis. The present study constitutes the first attempt to analyse the prevalence, intensity, diversity and epidemiological risk factors involved in bovine eimeriosis in North-Central Nigeria. It is envisaged that the data obtained will facilitate better control and prevention measures for Eimeria infection among cattle in the region.

Correction: Coccidiosis in sheep.

Correction: Coccidiosis in sheep.

Prevalence and associated risk factors of Eimeria species in rabbits (Oryctolagus cuniculus) in Ilorin, Kwara State, Nigeria

Coccidiosis remains a serious concern of great economic impact on domestic animals including rabbits. This study was conducted to determine the prevalence, species diversity, and associated risk factors of rabbit coccidiosis in Ilorin, Kwara State Nigeria. Fecal samples were examined using the floatation technique (positive samples were sporulated for identification of the different Eimeria species). 169 out of 215 (78.6%,) rabbits were found to be infected with Eimeria species. A total of seven Eimeria species (Eimeria coecicola, Eimeria irresidua, Eimeria perforans, Eimeria magna, Eimeria intestinalis, Eimeria stiedai and Eimeria flavescens) were identified. Of these, Eimeria coecicola was the most prevalent (48/215; 22.3%), while E. flavescens (8/215; 3.7%) was the least prevalent. Weaners (80.0%) were more infected than bunnies (79.1%) and adult (77.5%). Females had a higher infection rate (79.4%) than males (77.4%). Californian breed were more infected (84.9%) compared to Chinchila (83.7%), Dutch breed (80.9%), and New Zealand White (63.6%). Rabbits kept in the deep litter housing system had higher prevalence rate (95.2%) compared to those raised in the battery cage system (71.9%). Coccidiosis was more prevalent during the wet season than the dry season. This study concludes that Eimeria infections of rabbit is endemic in Ilorin, Kwara State with breeds and housing type been significant risk factors associated with the infection. This study provides the baseline information as the first report on the different Eimeria species affecting rabbits in Nigeria.

Production impact of parasitisms and coccidiosis in swine

Production impact of parasitisms and coccidiosis in swine

Improving agricultural production of domestic rabbits in Serbia by follow-up study of their parasitic infections.

A study was made on the prevalence of some parasitic infections appearing in domestic rabbits obtained from individual breeders in Serbia in order to improve the agricultural production of these animals. Aside from economic reasons (meat production and reproduction) rabbits are bred for the research purposes, and races are kept as household pets. For these reasons, among others, it is important to gain knowledge of medical culprits including causes of parasitic diseases that compromise their health, well-being and cause economic losses. This parasitological research was conducted in the period from 2010 to 2015 in 8 epidemiological regions of Serbia, on 433 rabbits as representative samples of different races (154 individuals up to 1 years of age and 279 individuals older than 5). Out of the total number of examined rabbits parasitic infections were established in 82.68% of animals. We detected 3 species of endoparasites (Eimeria spp., Trichostrongylus spp., and Passalurus ambiguus) and 3 species of ectoparasites (Scabies from genera Sarcoptes, Psoroptes and Notoedres). In "kits" (small rabbits) coccidiosis was the most prevalent disease (50.65%), while in older animals trichostrongilidosis was common (39.07%). The most represented scabies infection was with the species Psoroptes cuniculi (12.01%). Aiming at better control on the health of rabbits, there is a growing need for continual monitoring of parasitic infections including appropriate diagnosis, application efficient therapeutic protocols and control measures.

Coccidiosis of domestic pigeons (Columba livia domestica Gmelin, 1789) in Kano State, Nigeria

Pigeon coccidiosis is caused by Eimeria spp., a protozoan parasite which limits productivity by causing severe illness. Although numerous studies have been conducted on the coccidiosis of pigeons in some parts of Nigeria, there is no published data from Kano State. The intestinal contents of 144 pigeons (72 females and 72 males) were analysed for Eimeria oocysts in 2007 from 12 Local Government Areas of Kano State over the period of six months including the dry (February–April) and wet (June–August) seasons. The pigeons were divided into three groups according to age: squabs (0–4 weeks), squeakers (5–8 weeks) and youngsters (9+ weeks); each group including 48 pigeons. The results of these studies revealed an overall prevalence of 19.44%. The prevalence was higher in females (20.83%) than males (18.06%) (p<0.05). Furthermore, squabs had the highest prevalence (27.08%) followed by squeakers (20.83%), and youngsters (10.42%) (p<0.05). Infection with Eimeria spp. oocysts was higher during the wet season (8.96%) than dry season (5.98%) (p<0.05). This study provides basic information on the first detection of coccidiosis of pigeons in Kano State, Nigeria which has an implication on the sustainable pigeon production for human protein reguirement.

Anti-coccidial Activity of Moringa Oleifera Plant

Moringa Oleifera leaves were screened for its toxicological effect and some pharmacological activities in broiler chicken. Toxicological effect was studied using upgrading oral doses of 75% ethanolic extract in different groups of mice with monitoring the toxicological symptoms and mortality rate. The anti-coccidal activity of Moringa Oleifera powdered leaves for prevention and its 75% ethanolic extract for treatment of coccidiosis were studied in broilers. The obtained result proved that there were no toxicological symptoms or mortalities obtained till oral administration of 6000 mg/kg b. wt. Inclusion of Moringa olifera powder (0.5 and 1%) to broiler's feed were very efficacious and equal to diclazuril (1ppm) in preventing symptoms of coccidiosis associated with experimental infection with mixed Eimeria species. The anti-coccidal activity of Moringa Oleifera powdered leaves and its 75% ethanolic extract were studied on one-day old chicks. The experimental infected chicks with mixed Eimeria species induced severe coccidiosis in non medicated chicks and led to high mortality reached to (26.76%). Addition of 200 and 400ppm of Moringa Oleifera ethanolic extract induced marked curative effect of cocci diosis manifested by reduced mortality percent and improved PM lesion to be 13.3 and 10% respectively compared to 13.3% for group treated with the reference drug (25ppm) toltrazuril.

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

Large-scale investigation of response to [i]Eimeria Maxima[/i] challenge in broilers

Coccidiosis, a parasitic disease of the intestinal tract caused by members of the genera Eimeria and Isospora, is one of the most common and costly diseases in chicken. The aims of this study were to assess the effect of the challenge and level of variability of measured parameters in chickens during the challenge with Eimeria maxima. Furthermore, this study aimed to investigate which parameters are the most relevant indicators of the health status. Finally, the study also aimed to estimate accuracy of prediction for traits that cannot be measured on large scale (such as intestinal lesion score and fecal oocyst count) using parameters that can easily be measured on all animals. The study was performed in two parts: a pilot challenge on 240 animals, followed by a large-scale challenge on 2,024 animals. In both experiments, animals were challenged with 50,000 Eimeria maxima oocysts at 16 days of age. In the pilot challenge all animals were measured for BW gain, plasma coloration, hematocrit and rectal temperature and in addition a subset of 48 animals was measured for oocyst count and the intestinal lesion score. All animals from the second challenge were measured for BW gain, plasma coloration and hematocrit whereas a subset of 184 animals were measured for intestinal lesion scores, fecal oocyst count, blood parameters, plasma protein content and composition. Most of the parameters measured were significantly affected by the challenge. Lesion scores for duodenum and jejunum (P <0.001), oocyst count (P <0.05), plasma coloration for the optical density values between 450 and 490 nm (P <0.001), albumin (P <0.001), $1-globulin (P <0.01), $2-globulin (P <0.001), $3-globulin (P <0.01) and $2-globulin (P <0.001) were the most strongly affected parameters and expressed the greatest levels of variation. Plasma protein profiles proved to be a new, reliable parameter for measuring response to Eimeria maxima. Prediction of intestinal lesion score and fecal oocyst count using the other parameters measured was not very precise (R2 <0.7). The study was successfully performed in real raising conditions on a large scale. Finally, we observed a high variability in response to the challenge, suggesting that broilers’ response to Eimeria maxima has a strong genetic determinism which may be improved by genetic selection.

Phenotypic and Genotypic Characterization of Eimeria caviae from Guinea Pigs (Cavia porcellus)

Coccidiosis in Guinea pigs ( Cavia porcellus ) has been frequently associated with the presence of Eimeria caviae ; however, this coccidium has never been characterized in detail. This study aimed to present the phenotypic and genotypic characterization of E. caviae from guinea pigs reared under rustic breeding conditions in Brazil. Eimeria caviae oocysts are polymorphic, being sub-spherical, ovoidal or ellipsoidal, 20.9 × 17.7 µm, with a smooth or slightly rough and bi-layered wall, ~ 1.0 µm. Micropyle and oocyst residuum are absent, but one polar granule is present. Sporocysts are ellipsoidal, 10.8 × 6.4 µm. Stieda and parastieda bodies are present, sporocyst residuum is present and sporozoites posses a refractile body and a nucleus. Linear regressions and histograms were performed and confirmed the polymorphism of the oocysts. The internal transcribed spacer 1 of the ribosomal RNA gene (ITS-1 rRNA) of the isolates was sequenced and showed no significant similarity to the orthologous region of other Eimeria species.

The coccidiosis of the broiler in the sub-Saharan regions (Biskra - Algeria).

The audit of poultry breeding and the measure of prevalence of coccidiosis were made on 02 bands ( 74,000 and 48,000 subjects) in a renowned region for being hot and dry ( Biskra). Although buildings are modern, the indices of production do not reach the required standards (188 and 173 Vs 220). the high densities , the lack of material and especially the defect of hygiene, seem to be the main favouring causes. The breedings, although free of coccidiosis (S.L.M = 0), they records strong rates of accumulated mortality (5 % and 11.8 %).

Prevalence of bovine coccidia in Kombolcha district of South Wollo, Ethiopia

A cross sectional study was conducted from November 2011 up to April 2012 in Kombolcha town to determine the prevalence of coccidia infection in calves. Fecal samples were collected from a total of 288 calves with the age of 1 month to 1 year old which were included in the study purposively. After collection, the samples were transported to the laboratory and examined for the presence of Eimeria oocyst by flotation techniques. For positive sample, a solution of 2.5% potassium dichromate (K2Cr2O7) was added to the feces containing the oocyst for sporulation and identification of the species. Out of 288 calves, 92 (31.9%) were found to be positive forEimeria species. There was statistically significant difference (P 0.05) between coccidia infection and sex, breed, body condition, address or management system. Five species of Eimeria were identified in the study and the most prevalent species wereEimeria bovis (42.3%), Eimeria zuernii (28.3%) and Eimeria auburnensis (13.0%). The other species were E. ellipsoidalis (8.7%), E. alabamensis (4.3%) and unidentified oocyst (3.3%). In conclusion, the present finding has demonstrated that bovine coccidia are one of the important pathogens in calves in the study area. Further epidemiological investigations are required to determine the Eimeria species composition and different agro ecological risk factor on the occurrence of the disease. Key words: Calves, coccidiosis, Eimeria, Kombolcha, prevalence, risk factors.

Participatory surveillance of livestock and poultry diseases in Agidi development area of Nasarawa state Nigeria

A participatory surveillance of livestock and poultry diseases was carried out in Agidi Development Area of Nasarawa State among 123 farmers, 29 of the respondent were female, while 94 were male. Open-ended interviews were utilized where necessary to clarify information that needed clarifications by the respondents; physical examination of the some affected animals and it surroundings were carried out during the surveillance. The following diseases were established in the study area: Peste des peptits ruminants, Foot rot, helminthosis, mite/lice/flea infestation, tick infestation, bloat, Orf (Contagious ecthyma), poison, mange, Newcastle disease, fowl pox, coccidiosis, infectious bursal disease (Gumboro), chronic respiratory disease, African Swine Fever (ASF), abortion, Dystocia, sudden death, foot and mouth disease, Fascioliasis, trypanosomosis, black quarter disease, babesiosis, and wounds. Some of these diseases have specific period (season) of outbreak, while some occurs at all season. Analysis of data indicated that Newcastle disease was the most important disease of poultry, Peste des peptits ruminants was the disease that lead to high mortality in small ruminants, while African Swine Fever (ASF) is the most devastating disease of pigs, and Lice/flea infestation is the most common disease to poultry, small ruminants and pigs, in the study area.

SELECTION OF A PRECOCIOUS STRAINE OF EIMERIA ACERVULINA "IN VIVO"

Coccidiosis is a protozoan disease that causes important economic losses in the poultry farms of the world, either because of mortality or due to decreased rate of weight gain. The eimerian species that infect the chicken, especially in the broilers, are E. acervulina, E. tenella and E. maxima. Because of the chimioresistance phenomenon, it appeard the necessity of finding new prevention methods, such as vaccination, existing many available vaccines at the moment. This paper had the purpose of obtaining a precocious strain of Eimeria acervulina, latter used for immunoprophylactic purpose. The preliminary line obtained was characterised concerning the duration of biological cycle, prolificity and degree of pathogenicity and immunoprophylactic efficacy in comparison with the parental strain. The duration of prepatent period of E. acervulina precocious strain decreased from 97 hours after the first passage to 93,49 hours at the fifth passage, registering a decrease of 3,6 hours, and also it had inferior pathogenicity in comparision with parental one, the lesional score being 2 in the precocious line and 4 in the parental line. The highest rate of weight gain was observed in group 3A (positive control), being of 655,71 g/chicken. In the immunized groups the rate was of 611,72 g/chicken in group 1A, respectively 526,36 g/chicken in group 2A. Regarding food conversion, the highest level of consumed feed was registered in group 2A - immunized and infected – 3,20 kg forage/kg rate, followed by group 1A (immunized and uninfected), 2,75 kg foragej/kg rate, the lowest consume being in group 3A –positive control, 2,51 kg feed/kg. Regarding the obtained results it is important to continue the line selection for precocity of E. acervulina and to perform additional studies such as, testing of sensibility and chimioresistance to different coccidiostatics and comparative study of the biological cycle (precocious line – parental line) by hystological smears.

REVITALISATION OF ANTICOCCIDIAL SESITIVITY IN POULTRY FLOCKS BY THE USE OF A LIVE ATTENUATED VACCINE

Coccidiosis is a highly damaging disease of poultry which has traditionally been controlled by the addition of in-feed anticoccidial drugs. However, there is increasing concern about rising levels of drug resistance. The degree and impact of this resistance varies between poultry units, but is having a major impact on operations worldwide.